1-How does loneliness distort your perceptions of the people in your life and your relationships with them? 2-Describe an experience from your own life that, in hindsight, was an opportunity to apply emotional first aid and explain why it might have been useful to do so.

Answers

Answer 1

Answer:

Ans 1.

There are many paths to loneliness. ... Loneliness distorts our perceptions, making us believe the people around us care much less than they actually do, and it makes us view our existing relationships more negatively, such that we see them as less meaningful and important than we would if we were not lonely.

Answer 2

Answer:

Loneliness distorts our perceptions, making us believe the people around us care much less than they actually do, and it makes us view our existing relationships more negatively, such that we see them as less meaningful and important than we would if we were not lonely.

Explanation:

Take slow, deep breaths, and allow a little extra time to exhale.

Remind yourself that this, too, shall pass.

Allow space for all of your feelings.

Have faith in yourself. ...

Don't take anything personally.

Try to stick with your routine, even if you are feeling dazed or numb.


Related Questions

taiwan essay
describe a market in the morning, the atmosphere, the streets
nighttime - the nightview, the silence, the streets in comparison, night markets - crowded, noisy

Answers

Answer:

The night markets in Taiwan are some of the best we have come across during our travels through Asia. They are extremely popular with the locals and offer a huge variety of wonderful snacks, shopping and entertainment. Around 70 night markets are found across the whole of Taiwan, and we found pretty much all of the ones we visited were so popular you could barely move around parts of it!

The night markets in Taiwan are a few of the leading we have come over amid our voyages through Asia. They are greatly well known with the local people and offer a colossal assortment of superb snacks, shopping and excitement. Around 70 night markets are found over the full of Taiwan, and we found lovely much all of the ones we gone by were so prevalent you'll scarcely move around parts of it!

How should the sentence below be changed to include a verb phrase using the indicated verb? Janet ______________ a successful singer. (be) Question 4 options: a) Janet could be a successful singer. b) Janet is a successful singer. c) Janet wants to be a successful singer. d) None of the above

Answers

Answer:

i think its A ( not sure )

Explanation:

Read this excerpt from Abraham Lincoln's Gettysburg Address and then answer the question that follows: (1) Four score and seven years ago, our fathers brought forth upon this continent a new nation: conceived in liberty, and dedicated to the proposition that all men are created equal. Now we are engaged in a great civil war … testing whether that nation, or any nation so conceived and so dedicated … can long endure. We are met on a great battlefield of that war. (2) We have come to dedicate a portion of that field as a final resting place for those who here gave their lives that this nation might live. It is altogether fitting and proper that we should do this. But, in a larger sense, we cannot dedicate … we cannot consecrate … we cannot hallow this ground. The brave men, living and dead, who struggled here have consecrated it, far above our poor power to add or detract. The world will little note, nor long remember, what we say here, but it can never forget what they did here. What is the main purpose of the first paragraph of this speech? A. It clearly and directly states the counterclaim. B. It introduces the topic and hooks the audience. C. It gives the speaker's history for common ground. D. It provides a transition between arguments.

Answers

The answer to this is d

The main purpose of the first paragraph of this speech is it provides a transition between arguments. The correct option is d.

What is speech?

Speech can be defined as human vocal communication using language. Each language uses phonetic combinations of vowel and consonant sounds that form the sound of its words and uses those words in their semantic character as words in the lexicon of a language according to the syntactic constraints that govern lexical words' function in a sentence.

In speaking, speakers perform many different intentional speech acts, such as informing, declaring, asking, persuading, directing, etc and other non-representational or paralinguistic aspects of vocalization to convey meaning. In their speech, speakers also unintentionally communicate many aspects of their social position such as sex, age, place of origin, physical states.

Further psychological states, physico-psychological states, education or experience etc.

Learn more about speech, here:

https://brainly.com/question/29586134

#SPJ2

“The Case of Susan B. Anthony:” What is most likely the author’s reason for writing this letter to the editor? Question 30 options: a) To gain public support in favor or Susan B. Anthony. b) To convince readers of Susan B. Anthony’s guilt. c) To write an unbiased report of all of the facts in Anthony’s case. d) To change the Constitution.\

Answers

Answer:

the correct answer is a

Explanation:

The correct answer is E

What change is needed to form a complete sentence below? Which the school paper published. Question 3 options: a) Add the subject Tina b) Add the predicate wrote a fantastic editorial c) Add the subject Tina and the predicate wrote a fantastic editorial in front of which d) No changes need to be made

Answers

Answer:

c) Add the subject Tina and the predicate wrote a fantastic editorial in front of which

Explanation:

The sentence is incomplete because it is missing the subject and predicate.

By adding the subject and predicate, the sentence will be complete and will make sense: Tina wrote a fantastic editorial which the school paper published.

C) As in order to have a complete sentence, you must have a subject and a predicate! Hope this helps!

Which of the following describes a strategy used during the prewriting stage of short-story writing? freewriting to generate ideas for a story’s theme making corrections to grammar and spelling revising to ensure the story is interesting following a story map to stay on track and keep the story line moving forward

Answers

Free writing is the only pre-writing technique from the list given. The other options are either writing or after writing strategies. Free writing is a prewriting technique it consists of writing continuously for a period of time without paying attention to grammar or spelling. It gives writers ideas to write short stories.

What is one example of a type of medium?
O A. Figurative language
O B. Informal language
C. Live theatre
O D. Point of view​

Answers

Answer:

C, Live theatre.

Explanation:

This is a medium because it is a form of communication.

*FIFTY POINTS* Write a four-line stanza of your own that would go well with music. After you write the stanza, answer these questions: What rhyme scheme and meter does your poem have? How do those qualities help express the meaning of the poem? What genre of music do you see your poem fitting into? In what ways is the musical genre you envision connected to the rhyme scheme and meter that you chose? someone help please Im desperate lol.

Answers

Answer:Friends make a little family ,

And they can't talk calmly.

They become monsters ,

When they all are together.

They have sleepovers,

Which can never be over...

Explanation:I don't know the other but the above is a poem that I wrote on my own

Noo I was gonna answer

5. Conan of Aquilonia is a collection of
four linked fantasy short stories written
by L. Sprague de Camp and Lin Carter
featuring Robert E. Howard's seminal
sword and sorcery hero Conan the
Barbarian.
The stories were originally published in
Fantastic for August 1972, July 1973,
July 1974, and February 1975. The
collected stories were intended for
book publication by Lancer Books, but
this edition never appeared due to
Lancer's bankruptcy. The first book
edition was issued in paperback by
Ace Books in paperback in May 1977
In what year was the second Conan of
Aquilonia short story published?
a. 1974
b. 1973
C. 1972
d. 1977

Answers

The answer is d. 1977

HAVE a GREAT day!!
answer is 1977


not sure

Baseline writing - Wednesday August 5, 2020
"What is the role of conflict in peace?" Consider this question and write an approximately 250-
word response. American Literature is full of conflict because it chronicles the history of the
United States through independence from Britain, Native Americans and European settlers
sharing a vast land, and emerging ideas of leat creates a national identity, whether it's religious,
political or something else entirely (Not to mention the Civil War, World Wars I and II, and the
Civil Rights era of the 1960s.)
Feel free to write openly and without regard to how many paragraphs you should have, whether
there should be an introduction or conclusion, or even how well you understand the question. If it
helps to write from a historical viewpoint, do it, if it helps to write from a personal point of view
(including the use of "I,” do it.)

Answers

Peace and conflict studies is a social science field that identifies and analyzes violent and nonviolent behaviours as well as the structural mechanisms attending conflicts (including social conflicts), with a view towards understanding those processes which lead to a more desirable human condition.[1] A variation on this, peace studies (irenology), is an interdisciplinary effort aiming at the prevention, de-escalation, and solution of conflicts by peaceful means, thereby seeking "victory" for all parties involved in the conflict.

This social science is in contrast to military studies, which has as its aim on the efficient attainment of victory in conflicts, primarily by violent means to the satisfaction of one or more, but not all, parties involved. Disciplines involved may include philosophy, political science, geography, economics, psychology, sociology, international relations, history, anthropology, religious studies, and gender studies, as well as a variety of others. Relevant sub-disciplines of such fields, such as peace economics, may be regarded as belonging to peace and conflict studies also.

do you still want this answered

addresses a current issue or topic regarding immigration today. Read the article and detail what the article is about and explain the issue at hand.

Answers

Answer:

Raising children and helping them succeed in school.

Cultural barriers.

Securing housing.

Many cons or should I say troubles of immigration today is the constant worry of work. With racism still alive many immigrants are looked down upon and treated as inferior. Also illegal immigration leads to constant fear of deportation but the legal children are in fear of living on their own and providing themselves financially.

PLEASE HELPPP!!!!!
“The world on the turtles back” summarize a part of the story that explains the origin of something (how something came to be)
20 POINTS!

Answers

Answer:

Hey there!

First, a little background of this story. This story was written a long, long time ago by Native Americans of the Iroquois Tribe. It was passed down generation by generation, until in the 1800's a Iroquois writer wrote about it. One thing the story wants to explain is why there is land on earth, and the origins of the land.

At the beginning of the story, "The world on the turtle's back," we are told that  in the beginning, there was nothing, but there was a "Sky World." Here, lived gods, who were like normal people. However, when a woman falls to the "Normal World" she is saved by birds, and placed on the turtle's back. The story goes on to tell, that a muskrat brings her soil, which she used to build the land. That is why, the land formed.

Let me know if this helps :)

Answer:

!

Explanation:

First, a little background of this story. This story was written a  long time ago by Native Americans of the Iroquois Tribe. It was passed down generation by generation, until in the 1800's a Iroquois writer wrote about it. One thing he wants to explain is why there is land on earth, and the natural things of the land.

Frank is having hydration therapy prior to his chemotherapy session. The hydration intravenous infusion lasts 45



minutes. This is properly coded as



O 96360



96361



O 96360, 96361



O 96365

Answers

The answer is minutes!
Hope this helps!

if you could be any animal what would you be and why

Answers

I would be a dog because, I would get pet and lots of love.

I would be rather be a super human with the power of the elements

ᕙ( • ‿ • )ᕗ

Select the correct answer. What is a text’s main idea? A. supporting evidence for the topic B. the topic of the paragraph C. a statement about or way of looking at the topic D. detailed information about the topic

Answers

Answer:

[tex]\boxed{\sf B. \ the \ topic \ of \ the \ paragraph}[/tex]

Explanation:

The main idea is also the topic of the paragraph. The main idea is the main point of the paragraph. It is the most important piece of information about the paragraph.

Answer:

b

Explanation:

From "The Tyranny of Things" by Elizabeth Morris Once upon a time, when I was very tired, I chanced to go away to a little house by the sea. "It is empty," they said, "but you can easily furnish it." Empty! Yes, thank Heaven! Furnish it? Heaven forbid! Its floors were bare, its walls were bare, its tables there were only two in the house were bare. There was nothing in the closets but books; nothing in the bureau drawers but the smell of clean, fresh wood; nothing in the kitchen but an oil stove, and a few a very few dishes; nothing in the attic but rafters and sunshine, and a view of the sea. After I had been there an hour there descended upon me a great peace, a sense of freedom, of in finite leisure. In the twilight I sat before the flickering embers of the open fire, and looked out through the open door to the sea, and asked myself, "Why?" Then the answer came: I was emancipated from things. There was nothing in the house to demand care, to claim attention, to cumber my consciousness with its insistent, unchanging companionship. There was nothing but a shelter, and outside, the fields and marshes, the shore and the sea. These did not have to be taken down and put up and arranged and dusted and cared for. They were not things at all, they were powers, presences. And so I rested. While the spell was still unbroken, I came away. For broken it would have been, I know, had I not fled first. Even in this refuge the enemy would have pursued me, found me out, encompassed me. If we could but free ourselves once for all, how simple life might become! One of my friends, who, with six young children and only one servant, keeps a spotless house and a soul serene, told me once how she did it. "My dear, once a month I give away every single thing in the house that we do not imperatively need. It sounds wasteful, but I don’t believe it really is. Sometimes Jeremiah mourns over missing old clothes, or back numbers of the magazines, but I tell him if he doesn’t want to be mated to a gibbering maniac he will let me do as I like." The old monks knew all this very well. One wonders sometimes how they got their power; but go up to Fiesole, and sit a while in one of those little, bare, white-walled cells, and you will begin to understand. If there were any spiritual force in one, it would have to come out there. I have not their courage, and I win no such freedom. I allow myself to be overwhelmed by the invading host of things, making fitful resistance, but without any real steadiness of purpose. Yet never do I wholly give up the struggle, and in my heart I cherish an ideal, remotely typified by that empty little house beside the sea. Which three statements from the essay illustrate how Morris feels about things? Choose one answer from each group. Type the LETTER ONLY for each answer in the correct blank. Type A, B, or C for Blank 1. Empty! Yes, thank Heaven It sounds wasteful, but I don’t believe it really is I have not their courage, and I win no such freedom. Type D, E, or F for Blank 2. I cherish an ideal, remotely typified by that empty little house beside the sea. One wonders sometimes how they got their power Even in this refuge the enemy would have pursued me, found me out, encompassed me. Type G, H, or I for Blank 3. While the spell was still unbroken, I came away. Yet never do I wholly give up the struggle. The old monks knew all this very well.

Answers

Answer:

Answer blank 1:  

A

Answer blank 2:  

E

Answer blank 3:

H

Explanation:

I took the test and can assure you its right

Answer:

BEH

Explanation:

I put AEH and got 4/6 points and I believ it is b insted not too sure

Which line(s) from the poem show the reader that the poet is not just making

a statement about trees?

O

A. Now, of my threescore years and ten/ Twenty will not come again,

B. And stands about the woodland ride/Wearing white for

Eastertide.

) C. Loveliest of trees, the cherry now/ Is hung with bloom along the

bough.

O

D. About the woodlands I will go/To see the cherry hung with snow.

Answers

The answer is most definitely c

Loveliest of trees, the cherry now/ Is hung with bloom along the bough  just making a statement about trees.

What is Woodland?

A woodland (/wdlnd/ (listen)) is a low-density forest that forms open habitats with plenty of sunlight and little shade. It can also refer to wood (or, in the U.S., the plurale tantum woods) in a narrow sense.

Differences between British, American, and Australian English are explained below. Savanna woods, for example, are savannas that also have a light canopy of trees and plants

A shrubby and herbaceous understory, including grasses, may be present in woodlands. Under drier conditions or during the initial stages of primary or secondary succession, woodland may change to shrubland.

Therefore, Loveliest of trees, the cherry now/ Is hung with bloom along the bough  just making a statement about trees.

To learn more about British, refer to the link:

https://brainly.com/question/2280126

#SPJ7

The Case of Susan B. Anthony:” Which sentence from the text most strongly supports the central idea of the reading? Question 29 options: a) “Through the storms and cold of a most inclement March she made her way to every town and village in Monroe County, asking, night after night, large audiences the question ‘Is it a Crime for a United States Citizen to Vote?’” b) “Such courage and energy as hers deserve admiration, and what is more, support.” c) “That is, they were ostensibly so treated; in reality, nearly all the parties concerned in the prosecution showed themselves, to their credit be it said, heartily ashamed of their part in the proceedings.” d) “Last Fall Miss Anthony, her sister, and several other women, voted the full State and National Republican tickets on the 5th of November.”

Answers

Answer:

Explanation:

The answer may be (A) not sure though

Plz Help. Read the excerpt below and answer the question. In this way, Mr. Brown learned a good deal about the religion of the clan and he came to the conclusion that a frontal attack on it would not succeed. And so he built a school and a little hospital in Umuofia. In this excerpt from Things Fall Apart, Achebe’s use of the phrase “frontal attack” hints that _____.
Mr. Brown has ultimately hostile motives
Mr. Brown was once a member of the military
Mr. Brown is deadly serious about converting the Igbo
Mr. Brown considers charitable work to be a matter of life and death

Answers

Answer:

I would say that most likely he was once a member of the military to use such a figure of speech, but also meaning that discretion would be the better part of valor to proceed with doing something positive for the community and win their hearts that way and perhaps influence their religion that way.

I believe the answer is the once was a member of the military.

PLEASE HELP WITH THIS QUESTION

what important connections can you make between civic responsibility and possible career paths?​

Answers

Answer:

I will become a Lawyer and help the societies

Nights and Dragons— From the memoir of author Abigail Prynne 1 I sit at my desk listening to thunder growl outside my window. Flashes of light burst through the darkness, and wind races past my window. The thrilling combination of sight and sound conjures up visions of dragons roaring proudly, breathing fire, and soaring across the midnight sky. Dragons first fascinated me when I was a little girl. They have followed me ever since. The magnificent creatures appeared in storybooks I read in the library, paintings I saw in museums, movies I watched in the theater, and the dreams I had in my sleep. By the time I was thirteen, one question consumed me. I wanted to know if dragons ever existed, so I set out on a quest for facts. 2 As I started my research, I discovered many skeptics. Scientists presented evidence to show why dragons could not—and did not—exist. They explained that it would be impossible for dragons to fly because they would be too big. They laughed at the idea of dragons breathing fire. They pointed out that no other animal has ever done this. They said that if dragons had lived, someone would have found remains somewhere in the world. No bones about it, there were plenty of logical explanations. It would have been easy for me to accept that the only place dragons ever existed was in the imaginations of those who believed. 3 I could have given up, but I thought about my grandmother. She always told me that "people who believe that science is the answer to everything are missing out on everything else." With her words in mind, I searched some more. There were many facts that hinted that dragons may not be fictional. I noticed that cultures across the world all described dragons in similar ways. This was odd because they had no way to communicate with each other. I found dragons mentioned in more than just stories. They appeared in old legal papers, in the travel logs of Marco Polo, and in the Bible. I saw that the Chinese calendar uses a different animal each year. Dragons are included along with eleven real animals. I began to believe it was a real possibility that all of these people were talking about a creature that actually existed. 4 With renewed hope that there was some truth to the legends, I looked for new research. I found that some experts disagreed with popular arguments against dragons. They suggested that a dragon could have four stomachs like a cow. If it created stomach gases like birds, it might create enough to lift itself off the ground. This would give it the ability to fly. If it forced out air when diving toward the earth, it might release gases which could ignite into flame. When the animal died, the stomachs would release strong acids that would dissolve its dead body over time. Biologists backed up these ideas with sketches and models based on known animals. Not everyone agreed with these ideas, but many of the things we accept about dinosaurs and other extinct species started the same way. 5 I doubt we will ever truly know whether dragons existed. There may always be two sides to the fiery debate. Some will say the stories come from active imaginations. Some will believe with all their hearts that the legendary creatures roamed our ancient world. I don't know for certain which side to believe, but the sound and fury of a night like this makes me smile. It rekindles my childhood dreams and keeps the exciting possibility alive. Which sentence from paragraph 4 makes an explicit statement without offering any implicit suggestions? With renewed hope that there was some truth to the legends, I looked for new research. If it created stomach gases like birds, it might create enough to lift itself off the ground. Biologists backed up these ideas with sketches and models based on known animals.

Answers

Answer:

1The main idea would be "Scientists have lots of evidence to explain why dragons don't exist."

2. Emphasized by the evidence and word choice related to scientific evidence

3. The main idea would be "I have always wondered if dragons existed, and I hope they did."

4. Displayed through the author's nature of questioning and evaluating different kinds of evidence and ideas.  

:)

Yea what that person said lol bc I have no idea I just need questions to ask so I have to “answer”

Which statements are true about "evidence"? select all that appy observations which answer questions proof that an idea is true information for or against an idea data to help draw a conclusion

Answers

Answer:

based on the info that you have provided:

evidence - proof, confirmation, verification are all synonyms.  

Explanation:

observations which answer questions - this would have to have been proved with empirical evidence - data evidence that has been proven more than one time. I would not choose this answer.

proof that an idea is true - i would choose this answer due to the wording of "proof"

information for or against an idea - this could be someone's opinion and not have valid data to prove.  notice that "proof" is not in this answer. I would not choose this answer.

data - this would be empirical info and I would choose this as an answer.

I hope this helps.

:)

Answer:

evidence - proof, confirmation, verification are all synonyms.

Explanation:

hope it helps

We hope everything will go.......(SWIM)

Answers

We hope everything will go swimmingly

we hope everything will go swimmingly

nswer the following in a complete paragraph or more using good organization, standard formal English, proper grammar, and great content. If you could have the power to read people’s minds, would you choose to have this super power? Why or why not?

Answers

Answer:

     I would choose to not have this super power, because you can be hurt by what you see in people‘s minds. For example, if you asked your friend if they liked you outfit, and they said yes, if you could read your friends mind you could find that they hate it, and that not only do they not like it, but they think it is horrendous! so, all together I believe it would be better to go though life without the ability to read minds. Because of how much it could it could hurt me.

Explanation:

Hope you like it!

If You Wouldn't Want This Super Power...      

    If I could read people's minds, I would choose not to have it. I wouldn't want to have this super power because it might hurt me. For example, someone might say, "Wow you look amazing!" but they're just saying that to make me feel good. They might think I look bad, and if you could know that, you would feel bad as well. It also won't benefit me either. I'm already pretty good at detecting lies, and I certainly don't want to know the weird things going on inside of random people's heads. Therefore, I would not choose to be able to read people's minds, because it would do nothing but hurt me.

If You Would Want This Super Power...

    If I could read people's minds, I would choose to have it! I would want to have this super power because I could know everything going on inside of peoples heads; like what they actually thought about me, or if there's any mischief going on inside their heads! (you should probably not include this part) You could also protect yourself. For example, if someone wanted to murder you, you would know. Also you could know what people experience, if they are dying inside or anything. Overall, I think being able to read people's minds would be amusing and cool!

You can say yes or no, and also you can tweak this to what's true about you and what you think! ♡

Hope this helped! ♡

❀ 0ranges ❀

Your thoughts on the accessibility of personal information 5. What are the positives of being able to have this information? 6. What are the negatives of being able to access this information? 7. Should there be laws preventing access to such information? Why or why not? 8. Who's privacy should be protected and why? 9. Should our information be able to be collected? Why or why not? 10. If it had to be collected, who should be responsible for collecting our information?

Answers

Answer:

For Q8) The user's privacy should be protected.

The users privacy should be protected because that’s the most important

“The Case of Susan B. Anthony:” Which of these inferences about the Anthony case is best supported by the text? Question 11 options: a) Anthony was majorly discouraged when the trial was moved to another county. b) Anthony is solely focused on her own self-interest. c) Local and state authorities are eager to bring their own charges against Anthony as well. d) The district attorney and federal authorities seem extremely motivated to prosecute Anthony.

Answers

Answer:

Is it D

Explanation:

I think the answer is D.

Do you think it’s ever appropriate to confound audience expectations? Explain your answer.

Answers

Answer:

Explanation:

100% it can be appropriate. It isnt always gun to be right and suprising the audience can always improve your work just as long as you foreshadow and raise the expactations not lower them hope i helped☺️

Which detail most strongly develops the theme of loneliness in "The Raven"? The speaker looks to the bird for company by sitting on a chair and studying it. The speaker explains that like other friends and his hopes, the raven will leave him, too. The speaker whispers Lenore's name when he opens the door to see who has been tapping on it. The speaker asks the raven if he will see Lenore again.

Answers

Answer:

B

Explanation:

The speaker has a dejected tone, talking about how the raven will leave him like everything else.

The speaker explains that like other friends and his hopes, the raven will leave him, too is the detail most strongly develops the theme of loneliness in "The Raven".

What is loneliness ?

The emotion we experience when our demand for fulfilling social interaction and connections is unmet is a frequent definition of loneliness.

However, being lonely is not necessarily the same as being by yourself. Some people could find it isolating to be alone and have a happy life with little interaction from others.

A mismatch between the amount and quality of the social relationships can lead to the unpleasant, subjective sense of being alone or losing company.

Situational aspects including physical isolation, relocation, and divorce are contributing elements to loneliness.  Feelings of loneliness can also result from the loss of a significant someone in a person's life. There are also internal causes of loneliness.

Thus, option B is correct.

To learn more about loneliness follow the link below;

https://brainly.com/question/24450911

#SPJ5

Macbeth act 5 scene 1

Answers

Answer:

???

Explanation:

Answer:

Summary: Act 5, scene 1

Suddenly, Lady Macbeth enters in a trance with a candle in her hand. Bemoaning the murders of Lady Macduff and Banquo, she seems to see blood on her hands and claims that nothing will ever wash it off. She leaves, and the doctor and gentlewoman marvel at her descent into madness.

Explanation:

spark notes credit*

Click to read "The Story of Icarus and Daedalus" by Ovid and "Musée des

Beaux Arts," by W. H. Auden. Then answer the question.

What detail does Auden include in his poem that is not part of Ovid's story of

Icarus and Daedalus?

A. Icarus struggles to stay alive when he crashes into the sea.

B. The people on the shore ignore Icarus falling into the water.

C. Icarus falls into the water.

O

D. Icarus's wings melt because of the sun's heat.

SUBMIT

Answers

Answer:

B. The people on the shore ignore Icarus falling into the water.

Explanation:

The myth of "Icarus and Daedalus" by Ovid tells the story of a captive father Daedalus, an inventor inventing ways for him and his son Icarus to escape from their captivity on an island. But in the heat of the moment, the young son went too near to the sun which melted the wax in his wings and eventually led him to drown in the sea below.

W. H. Auden's poem "Musée des  Beaux Arts" also recounts the moment Icarus drowned. But what the short poem details is somewhat a bit different from the mythical story in that Auden describes the people nearby the sea, completely ignorant or indifferent to the drowning boy's plight.

Thus, the correct answer is option B.

Hello!!

The answer to this question is B. The people on the shore ignore Icarus falling into the water.
Other Questions
On a plane trip, baggage over 40 pounds ischarged at the rate per pound of 1% of the one-way fare. The charge for a bag weighing 52pounds on a trip where the one-way fare is $98is:HELP PLEASEE!! QUICK!! When the hydraulic conductivity Ks = 10 mm/hr; effective matrix potential Ns = 20 mm, and rainfall intensity I = 30 mm/hr , determine the amount of runoff generated when the runoff rate reaches 15 mm/hr?( 2.7 mm or 0.21 mm or 18 mm or 0.67 mm) PLS HELP ASAP Solve the inequality and enter your solution as an inequality in the box below 8>4-x>6 difference between photosynthesis and respiration In a survey of adults in a certain country conducted during a period of economic uncertainty, % thought that wages paid to workers in industry were too low. The margin of error was percentage points with % confidence. For parts (a) through (d) below, which represent a reasonable interpretation of the survey results? For those that are not reasonable, explain the flaw. how many are 2 raised to 2 ??? Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG This rectangular patio is tiled using 50 cm by 50 cm square tiles. How many tiles are used? Imagine that you are the supply chain manager for the Magic Widget company and you need to measure your supply chain performance. The chart shows the financial variables that you will need to perform your task. Financial Variables Total Assets (in $ billions) 15.1 Cost of Goods Sold (in $ billions) 14.3 Inventory: Raw Material Inventory (in $ billions) 0.76 Work-in-progress Inventory (in $ billions) 0.12 Finished Goods Inventory (in $ billions) 0.82 Compute the percentage of assets committed to inventory and inventory turnover. What is the quotient of 35,423 15? The plateau phase of population growth is best described as: A. The population stops growing because they moved into the plateau environment at this stage. B. The population pauses in its growth after a natural disaster before growing again. C. The population moves onto a large, raised, flat area called a plateau for protection from predator. D. The population stops growing because the environment has reached its carrying capacity. The Coriolis effect Choose one: A. causes north-flowing currents in the northern hemisphere to curve to the west. B. causes the same direction of deflection in the northern and southern hemispheres. C. is a deflection of wind or water flowing over the Earth's surface. D. is a phenomenon created by the movement of ocean currents. Light passes through a single slit. If the width of the slit is reduced, what happens to the width of the central bright fringe Our Senate has finally emerged from weeks of debate with a decided version of the Missouri Compromise. Among its list of provisions, all lands acquired in the Louisiana Purchase that are north of the southern border of Missouri, with the exception of Arkansas, will now d. Write the symbol for the nucleus that completes each nuclear equation. (1 point each) URGENT PLS HELP ASAP! THANK YOU :) What is the x-value of point A? I need some help plsssssssssssss Which of the following is a characteristic of outer planets?O Close to the sunFew moonsHave ringsRocky surfaces Find the formula for the inverse function.f(x)=2/3-4x