1. The Hawaiian Islands are examples of islands that formed over a hotspot. Based on this information, which of the following processes formed the Hawaiian Islands? (2 points) Melted rock called magma rose through holes in Earth's crust and gradually solidified as it cooled. Tectonic movement forced certain segments of Earth's crust downward and other segments upward in jagged chunks. One tectonic plate moved beneath another plate at a subduction zone, causing the rock to melt and rise above Earth's surface. Segments of Earth's crust bent and doubled over, and moving wind and water gradually shaped the rock into gently sloping domes.

Answers

Answer 1

Answer:

The correct answer is -  Melted rock called magma rose through holes in Earth's crust and gradually solidified as it cooled.

Explanation:

The Hawaiian Islands are the chain of eight major islands situated in U.S. of Hawaii. These are formed over a hot spot. About 75 million years ago such hotspot took place in the center of the Pacific Plate.

There are hot spot due to the volconic activity and in the moving over the tectonic plate of a subduction zone. Volcanic activity and overriding of plates that cause rising magma by melting the moving down plates whice leads to volcanic arcs formation. The magma that rose gradually cooled down and become solid over the time. It is an example of a large seamount and island chain created by hot-spot volcanism.

Thus, The correct answer is - Melted rock called magma rose through holes in Earth's crust and gradually solidified as it cooled.


Related Questions

The hypothalamic hormone that triggers the secretion of FSH and LH from the anterior pituitary is

Answers

Answer:

Hypothalamic-Pituitary-Gonadal Axis

GnRH produced by the hypothalamus stimulates the production of both LH and FSH. FSH functions by stimulating ovarian follicular development in females and regulating spermatogenesis in males. LH induces ovulation and corpus luteum formation in the ovaries.

plz give brainlist

hope this helped

what are the different types of waste? and what are the methods used in biodegrable waste managment​

Answers

2 ypes of waste liquid and solid

Explanation:

biodegradable waste can be found in municipal soild waste or sometimes called biodegradable municipal waste ,or as green waste ,food waste,paper waste and biodegradable plastic.other biodegradable waste include human waste ,manure,sewage,sewage sludge and slaughterhouse waste .

you can send it for recycling into compost.

you can treat biodegradable waste on an industrial scale by either composting or anaerobic digestion.

composting is more suitable for fibrous materials.

anaerobic digestion is more suitable for wastes and sludgest that degrade easily.

Consider the following chromosomes and if they are affected by hemophilia. X - unaffected X chromosome, x = X affected by hemophilia, and Y = Y chromosome. If an Xx female and XY male have children, what fraction of their offspring will have an affected chromosome, and what fraction is likely to be affected by the hemophilia? (1 point) A. 1/4 and 1/2 B. 1/2 and 1/4 C. 1/2 and 1/3 D. 1/4 and 1/4 Ive been stuck on this for a while now, can someone please assist?

Answers

Answer:

B. 1/2 and 1/4

Explanation:

Hemophilia is a disease inherited in humans. It is only carried on the X chromosome, hence, it is said to be X-linked. In this question;

X - unaffected X chromosome

x = X chromosome affected by hemophilia,

Y = Y chromosome

Hence, in a cross between a Xx female (carrier) and a XY male (unaffected), the following chromosomes will be present in the gametes produced by each parent:

Xx- X and x gametes

XY- X and Y gametes

Using these gametes in a punnet square (see attached image), offsprings with genotypes: XX, Xx, XY and xY are produced.

XX (1) - unaffected normal female

Xx (1) - unaffected carrier female

XY (1) - unaffected normal male

xY (1) - affected male

Based on the questions;

- 2 out of the possible 4 children have the affected chromosomes i.e. both xY son and Xx daughter have the x chromosome. Hence, the fraction is 1/2

- 1 out of the 4 possible children is affected by hemophilia, which is the xY son. Hence, the fraction is 1/4.

Answer:

1/2 and 1/4

Explanation:

Took the test

a student hypothesized that pillar coral eat and digest zooxanthellae. which of these observations would cause the student to change this hypothesis

Answers

Answer:

the zooxanthellae in a pillar coral's body are alive

Which of the following is found in the 'rungs' of a DNA strand?
A. Uracil
B. Thymine
C. Deoxy Ribose
D. Phosphate

Answers

Answer:

Thymine

Explanation:

SIOM CSserials
What has a greater influence on protein levels?
(1 point)
Protein degradation has a greater influence because outside factors like antibiotics can
cause it, and it is difficult to recover from.
O
Protein degradation has a greater influence because they are denatured faster than the cell
can produce them.
mRNA destroyer concentration has a greater influence because it is destroying mRNA before
proteins can even be produced.
mRNA destroyer concentration has a greater influence because mRNA is destroyed right
after the proteins are produced.

Answers

Answer:

mRNA destroyer concentration has a greater influence because it is destroying mRNA before  proteins can even be produced.

Explanation:

Proteins are synthesized from mRNA through the process of translation. mRNAs are first synthesized from a coding DNA template through the process of transcription. Hence, if mRNAs are destroyed, it means proteins will not be synthesized at all.

Protein not being synthesized at all means that mRNA destroyer concentration has a greater influence on protein levels than protein degradation. With protein degradation, not all the protein is degraded at once and some quantity of the protein can still be found, but with mRNA destroyer concentration, no protein can be found at all because it was not synthesized in the first place.

Some food material is given
below. What are the diffrent
possible ways of cooking them?
Find out and write them.
Meat - Groundnuts - Potatoes
Spinach​

Answers

Answer:

Meat-Boiling, Grilling, frying and roasting

Groundnuts-frying,boiling

Potatoes-Boiling frying and roasting

a pupil performed an experiment in a school lab to show the action of a digestive enzyme on a food substance

a) Name and enzyme suitable for such an experiment
b) Name a food substance on which the enzyme that you have named will act
c) Describe any preparation of the food required before the experiment is performed. If no preparation is required state why?
d) give the temperature at which the enzyme-food mix should be maintained for the experiment to work
e) how much time is needed for digestion of food in this experiment?
f) describe a test to confirm that digestion has occurred ​

Answers

I prefer d as the correct answer!!!

The arrangement of leaves on a tree branch that reduces overlapping and overshadowingof leaves from sunlight is referred to as leaf …………………………………………………………This ensures exposure of most of the leaves to sunlight for maximum ……………………………………………..to take place in the ………………………………………………………………………of leaf cells. The grana contains numerous……………………………………………molecules which trap light………………………………….for ………………………………………………….of water, producing ………………………………………atoms required for the process of carbon (IV) oxide…………………………………………………………in the light……………………………………………………………stage of photosynthesis which takes place in the……………………………………………..of the chloroplast.

Answers

Answer:

phyllotaxy

photosynthesis

chloroplasts

chlorophyll

energy

oxidation

oxygen

reduction

independent

stroma

Explanation:

The arrangement of leaves that provide maximum exposure to sunlight is referred to as leaf phyllotaxy that reduces overlapping and overshadowing of leaves and supports maximum photosynsthesis.

The contains numerous chlorophyll molecules that trap the light energy for the oxidation of water and producing oxygen (O2) atoms required for carbon (IV) oxide reduction in light-independent, which takes place in the stroma of the chloroplast.

Hence, the correct answer in a sequential manner is as follows:

phyllotaxy

photosynthesis

chloroplasts

chlorophyll

energy

oxidation

oxygen

reduction

independent

stroma

Mendel always got close to a 9:3:3:1 ratio for phenotypes in the F2 generation of any dihybrid cross. If false, make it a correct statement

a. True
b. False

Answers

Answer:

True

Explanation:

It is true that Mendel always got close to a 9:3:3:1 ratio for phenotypes in the F2 generation of any dihybrid cross. This validates his law of independent assortment of genes.

The 9:3:3:1 is usually gotten from any dihybrid cross of F2 generation. The results given are always 9 offsprings containing dominant traits, 3 offsprings each which possess a dominant and recessive trait and 1 offspring with a recessive trait.

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

Muscle cell are richer in lysosomes , as they require lot of energy. correct and rewrite the following statement.

Answers

Answer:

See below

Explanation:

The correct statement is:

=> Muscle cells are richer in mitochondria, as they required lots of energy.

Mitochondrion acts as power house of the cell providing the cell with the required energy.

Correct Statement:-

Muscle cells are richer in Mitochondria, as they require a lot of energy.

[tex] \large{ \underline{ \boxed{ \pink{ \rm{Explanation}}}}}[/tex]

Especially in Skeletal muscles, Mitochondria and glycogen granules are found in abundance. Our limbs that includes our arms and legs shows movement which needs energy. The food is oxidized and energy is released.

More to know:-Mitochondria is popularly known as Power house of the cell or ATP generation site.It is a double-membranous structure with outer membrane smooth and inner membrane surrounds the matrix.The inner membrane have cristae which increase surface area.The cristae bear Oxysomes or F0-F1 particles.Mitocondria is semi-autonomous, it have it's own DNA and ribosomes.

━━━━━━━━━━━━━━━━━━━━

what does Ecology mean

Answers

The branch of biology that deals with the relations of organisms to one another and to their physical surrounding

Answer:

a branch of science concerned with the relationships between living things and their environment or the pattern of relationships between living things and their environment.

Explanation:

Question What was the ratio of tall to short plants in the F2 generation of Mendel's experiments? A. 3:1 B. 2:1 O C. 1:1 D. 6:1 ​

Answers

Answer:

A

Explanation:

Answer: 3:1

Explanation:

i got it right on the test

what are sex hormones?why are they named so? state their function.

Answers

Answer:

Sex hormones or hormones of the reproductive organs are certain cells in the reproductive organs that produce hormones.

The testis produces testosterone,the male sex hormone,and the ovaries produces oestrogen and progesterone, the female sex hormones.

In a sexually mature male,testosterone influences sexual behaviour, and together with FSH,regulates sperm production in the seminiferous tubules of the testes.

Sexually matured females undergo a regular 4-week reproductive or menstrual cycle during which a mature egg is released.This cycle is regulated by oestrogen and progesterone. During pregnancy, progesterone inhibits egg production (ovulation),brings about the development of the placenta and prevents the uterus from contracting....I hope this answers your question... Thank you for the question.

Which is most likely a source of air pollution? littering CFCs oil spill runoff

Answers

Answer: CFCs

Explanation: The other options aren’t as relevant to air pollution.

Answer:

cfcs

Explanation:

Consider a system in which low levels of protein "Q" triggers production of hormone A. The reaction of target cells of hormone A is to produce and release hormone B, which stimulates production of hormone C. In response to hormone C, the target cells up-regulate protein Q. In this scenario we see an example of _____.

Answers

Answer:

Negative feedback

Explanation:

Negative feedback is produced when a mechanism is amplified through an inverse loop, which tends to reduce the fluctuations in the system. In this case, the negative feedback mechanism represents a homeostatic response of the body where the release of a target hormone (hormone C) decreases in response to the increase of a protein (protein Q) upstream in the signaling pathway. Therefore, in this scenario, it is expected that negative feedback causes a decrease in hormone function.

I have four brothers
"This is what type of
observation?

Answers

Quantatative data since it is physically counting

If a hermit crab leaves its shell, is the shell biotic?

Answers

No, because the shell was never alive.

Answer:

no

Explanation:

How are the molecules in photosynthesis and cellular respiration similar? Please include descriptions of the molecules

Answers

Answer:

They are similar because they both produce energy but in two different forms.

Photosynthesis- It produces oxygen and G3P, simple carbohydrate molecules that are high in energy and can be converted into glucose, sucrose, or other sugar molecules.

cellular respiration-During cellular respiration, a glucose molecule is gradually broken down into carbon dioxide and water.

They exhibit the same responses, but they do so in reverse. Carbon dioxide and water are converted during photosynthesis into glucose and oxygen. Carbon dioxide and water are produced during respiration in exchange for glucose and oxygen.

What similarity in photosynthesis and cellular respiration?

Energy transformations from one form to another are a part of both respiration and photosynthesis through a sequence of metabolic reactions.

The reactions that are carried out by both processes—which both use and produce ATP—are carried out on membranes and are managed by enzymes.

Light energy is converted by photosynthesis into chemical energy that is stored in glucose, which is then released by cellular respiration to create ATP, the life-sustaining compound.

Therefore, They are similar because they both produce energy, but in two different forms.

Learn more about cellular respiration here:

https://brainly.com/question/28532054

#SPJ2

How are the proteins inside your body affected by the presence of water and other molecules?

Answers

Answer:

Our body is constitute of several essential molecules such as proteins, fat, carbohydrate, water, and other molecules.

Each molecule has some of the impact of other molecules in the body. Impact of water and other molecules on proteins inside the body are as follows:

Proteins have ligand-binding site and water provide stability to the ligand-binding site of proteins through its hydrogen bonds.Conformational flexibility and transitions of proteins are due to the presence of water molecules in it.Disbalance in the pH of body due to changing concentration of sodium-potassium ions can denature the protein. Enzymes present in the body can control the rate of formation of proteins in the body.

How much time is required for a P-wave to travel 6,000 kilometers?

Answers

Answer:

294.1 minutes

Explanation:

5,882 seconds (98 minutes) to travel 2,000 km.

2,000 x 3 = 6,000

5,882 seconds x 3 = 17,646

(294.1 minutes) to travel 6,000 km

Metamorphosis is:______.a. changing of one body form to another within a species, such as the change from an aquatic tadpole to a terrestrial frog. b. an intermediate condition, such as length of legs in mice between longer legs of some mice and shorter legs in others, a condition caused by Hox genes. c. the evolutionary transition from fishes to amphibians. d. the developmental changing of a scale to a feather.

Answers

Answer:

changing i think

Explanation:

Write TRUE or FALSE
(a)
A 'system' is the part of an organism that carries out a certain function.​

Answers

Answer:

TRUE

Explanation:

what action is a reflex action

Answers

Answer:

A reflex action is an involuntary , quick  response to a stimulus, which minimises any damage to the body from potentially harmful conditions, such as touching something hot.

Explanation:


which of the following is not irrational number?
(1)√2
(2)2/√6
(3)√36/1296
(4)-√6+6

Answers

Explanation:

hi !!

here i think all areirrational expect root 36/1296,

1. root 2= root 2= 1.414213562

2. 2/root 6= root 6 /3 = 0.8164965809

3. root 36/1296=1/6=1.66666667

4. - root 6+6= -2 root 3 = -3.464101615

so, they are extended and dont have exact value so all are irrational expect no. 3 because it can be expressed in 1/6 fraction form but others will come on root form.

Hope it helps...

Answer:

[tex]\frac{\sqrt{36} }{1296}[/tex]

Explanation:

[tex]\sf A \ rational \ number \ can \ be \ expressed \ as \ a \ quotient \ of \ two \ whole \ integers.[/tex]

[tex]\sqrt{2} = 1.41421356237...[/tex]

[tex]\frac{2}{\sqrt{6} } = 0.816497...[/tex]

[tex]\frac{\sqrt{36} }{1296} =\frac{6}{1296} =\frac{1}{216}[/tex]

[tex]-\sqrt{6} +6= 3.55051...[/tex]

[tex]\sf The \ rational \ number \ from \ the \ list \ is \ \frac{\sqrt{36} }{1296}[/tex]

What percentage of the Earth's surface do forests cover? 20% 30% 40% 10%

Answers

30% of the earth's surface is covered by forests.

----------------------------------------------------------------------------------------

Metals are useful in industry because they can be shaped without breaking. What is this property of metals called?

Answers

Answer:

malleable ................

Answer:

versatility ductility conductivity malleability

Consider this animal cell. The organelles in an animal cell are labeled. Part E represents small dots on the nucleolus. What is the function of the small, dark organelles labeled E? They contain enzymes for the digestion of old cell parts. They regulate what enters and leaves the cell. They produce proteins for the cell. They store water and other materials.

Answers

The dark organelles labelled E is called the Ribosomes.    

The answer is Ribosomes

What is another name of molecular biology????

Answers

Answer:

biotechnology

Explanation:

hope it help you

Answer:

biotechnology biotech

biological engineering biological science

Other Questions
Explain what a limiting reactant is and describe the process to determine the limiting reactant in the example listed below: Given 3.4 grams of x compound with a molar mass of 85 g and 4.2 grams of y compound with a molar mass of 48 g How much of compound xy can be generated 2x + y2 = 2xy Sheridan Company, had 837000 shares of common stock issued and outstanding at December 31, 2017. On July 1, 2018, an additional 40600 shares of common stock were issued for cash. Sheridan also had unexercised stock options to purchase 31400 shares of common stock at $15 per share outstanding at the beginning and end of 2018. The average market price of Sheridan's common stock was $20 during 2018. What is the number of shares that should be used in computing diluted earnings per share for the year ended December 31, 2018 Calculate the [H+] and pH of a 0.0010 M acetic acid solution. The Ka of acetic acid is 1.76105. Use the method of successive approximations in your calculations. Identify the sentence that has the subordinating conjunction underlined and is punctuated correctly.A. Please take a few minutes to help me clean up, even if you feel you are too busy.B. We have to finish our work, before we can play a game.C. Although it is not fun to do chores everyone must do their share.D. You must finish your homework early because we have a busy night. Which of the following is true? Tangent is positive in Quadrant I. Sine is negative in Quadrant II. Cosine is positive in Quadrant III. Sine is positive in Quadrant IV. If x3 + ax2 bx + 10 is divisible by x2 3x + 2,find the values of1) a-b2) 2a-b An atom of 120In has a mass of 119.907890 amu. Calculate the mass defect (deficit) in amu/atom. Use the masses: mass of 1H atom What is the solution to this system of linear equations?y-x = 6y + x = -10(-2,-8)(-8.-2)(6.-10)(-10.6) Help please all questions. Carlos is using the software development life cycle to create a new app. He has finished coding and is ready to see the output it produces. Which stage of the software development life cycle is Carlos ready for next? Coding Design Maintenance Testing How to graph the line y=4/3x William Bradford was one of the elected governors for which group of colonies? Please help with this Harry and Sally formed the Evergreen partnership by contributing the following assets in exchange for a 50 percent capital and profits interest in the partnership. Basis Fair Market Value Harry: Cash $30,000 $30,000 Land $100,000 $120,000 Totals $130,000 $150,000 Sally: Equipment used in business $200,000 $150,000 Totals $200,000 $150,000 a. How much gain or loss will Harry recognize on the contribution? b. How much gain or loss will Sally recognize on the contribution? c. Should Sally consider selling the property to the partnership rather than contributing it? A. YesB. No What is the reason for using short sentences at the beginning of this article?O The author wanted to become more famous.O The author wants to describe things clearly.O The author wants to analyze important details.O The author wants to get the readers' attention. Solve for x. 3x-91>-87 AND 17x-16>18 Latanya buys 5 yard of blue fabric and 8 yards of green fabric. the blue fabric cost $2 dollars more than the green fabric.she pays a total of $ 62. what would be the combined cost of 1 yard of blue fabric and one yard of green fabric? Which of the following best explains the potential health problems associated with endocrine disruptors? A) Endocrine disruptors are the only available pesticides,hence they are used widely. B) Endocrine disruptors mimic hormones that regulate critical biological processes. C) Endocrine disruptors do not biodegrade, remaining toxic years after their release. D) There are no major health problems associated with exposure to endocrine disruptors. E) Endocrine disruptors encompass a wide array of toxic pesticides. I need help ASAP!! Can someone explain this? And answer it? I am so confused!! Water pressurized to 3.5 x 105 Pa is flowing at 5.0 m/s in a horizontal pipe which contracts to 1/2 its former radius. a. What are the pressure and velocity of the water after the contraction