1. What were the three Colonial Regions?

Answers

Answer 1
New England, the Middle Colonies, and the Southern Colonies.

Related Questions

Please help ASAP (NO LINKS)

Answers

Answer:

C

Explanation:

Answer:

C .. the attacks on the world trade center and pentagon

hope it is helpful to you

can you helo me with my questions and I will give you brainly​

Answers

Answer:

The executive.

Explanation:

With progressive taxes, the person with the highest income pays the most money.

Analyze the advantages of both the Union and Conferderate forces during the war. Why was the north able to win

Answers

Answer:

Compared to the Confederacy, the Union had numerous advantages. In comparison to the South, the North had a larger population. The Union had an industrial economy as well, while the Confederacy relied on agriculture. The Union possessed the majority of natural resources such as coal, iron, and gold, as well as a well-developed rail network.

The north was able to win the war because of its abundant amount of soldiers and factories to make equipment.


What were Americans afraid of? Why do
you think they were afraid?
1920

Answers

Answer:

Enraged by the bombings, the United States government responded by raiding the headquarters of radical organizations and arresting thousands of suspected radicals. Several thousand who were aliens were deported. The largest raids occurred on January 2, 1920 when over 4000 suspected radicals were seized nationwide.

Explanation:

In 1920 Americans had a fear of communism because of what it would do to society and the economy.


Who created the TV commercial?

Answers

The company that aired the first television commercial was Bulova, a watch company in 1941.

What is a television commercial?

A television commercial is a term to refer to an audiovisual sample broadcast on television that generally lasts between 10 and 70 seconds and its main purpose is to promote a product, service or commercial institution.

When was the first TV commercial aired?

The first television commercial was broadcast on July 1, 1941, promoting watches from the American company Bulova.

Learn more about TV commercial in: https://brainly.com/question/11932254

#SPJ1

Who challenged the Soviet Union to tear down the Berlin wall and also maintained a hard line against communism?​

Answers

Answer:

Reagan called for the General Secretary of the Communist Party of the Soviet Union, Mikhail Gorbachev, to open the Berlin Wall, which had separated West and East Berlin since 1961. The name is derived from a key line in the middle of the speech: "Mr. Gorbachev, tear down this wall!"

Explanation:

would really like it if you followed me

!!Please help.!!This is overdue, and I can’t figure it out

Answers

Answer:

based on what u read u need to fill in the blanks. look for key details that would help you. if u need any more help doing that i would be here <3

Explanation:

What did Dorothea Dix believe should be done with the mentally ill?

Answers

Explanation:

"Before she led the Union Army nursing corps during the Civil War, New England’s Dorothea Dix led the most ambitious reform efforts for the care of the mentally ill ever attempted in the U.S. Dix argued that a land grant system, similar to the one that created state universities, should be used to create mental hospitals across the country."

___________________ believed that states had the right to declare a law null and void if it is unconstitutional.

John Quincy Adams
John C. Calhoun
Daniel Webster
Andrew Jackson

Answers

Answer:

John C. Calhoun

Explanation:

In the 1920s and 30s, why did Western powers like the US and the UK favor Fascism over Communism?
HELP ASAP PLEASE

Answers

Answer:The last time fascism was brazenly embraced was in the 1930s. ... At the time, Jews served the same role for U.S. fascists that immigrants, ... As in Europe, worries about communism intensified fascism's appeal in the U.S. “I thank ... Over the 20th century, democracy spread from a few isolated outposts

Explanation:

The first American space probe to land on the moon was what.
please hurry

Answers

Answer:

The answer is Apollo 11 :)

Which century did Mali start importing books from other places?

I need it asap thank you‼️

Answers

Answer:

by the fourteenth century

Explanation:

how does national dept effect future generations?

Answers

Answer:

it slows economic growth, which in turn slows the growth of wages and income. This slower growth occurs mainly due to the phenomenon known as “crowd out,” whereby investors purchase government debt at the expense of making productive investments in private capital.

Explanation:

Answer:

rising debt is that it slows economic growth, which in turn slows the growth of wages and income

Explanation:

ZOHA FATTY cuteee...........​

Answers

Answer:

tuba I love you

Explanation:

please come to me

Put in order from first to last the major phases of U.S. involvement in Vietnam.

The Tet Offensive pushed a majority of Americans to oppose the war.

Johnson urged Congress to pass the Gulf of Tonkin Resolution, and sent more American soldiers to Vietnam.

Eisenhower sent American military advisors to South Vietnam to train the regime's army

Kennedy sent 3,000 military advisors, helicopters, and American pilots to South Vietnam

Nixon announced a Vietnamization plan, withdrawing U.S. troops without the appearance of defeat.

Answers

Answer:

Answer in the image. Hope this helps!

Explanation:

I took it

The US was involved in the Vietnam war as it did not want to fall into Vietnam into Communism by sending troops in the nation.

What were the phases of the US involvement in Vietnam?

Eisenhower sent American military advisors to South Vietnam to train the regime's army.

Kennedy sent 3,000 military advisors, helicopters, and American pilots to South Vietnam.

Johnson urged Congress to pass the Gulf of Tonkin Resolution and sent more American soldiers to Vietnam.

The Tet Offensive pushed a majority of Americans to oppose the war.

Nixon announced a Vietnamization plan, withdrawing U.S. troops without the appearance of defeat.

Learn more about the Vietnam war here:

https://brainly.com/question/4292602

The DNA must be equally distributed to each new cell to be identical to the parent cell. What needs to happen first, in
order for the DNA to be the same in the new cells?

Answers

Answer:

Mitosis is used to produce daughter cells that are genetically identical to the parent cells. The cell copies - or 'replicates' - its chromosomes, and then split the copied chromosomes equally to make sure that each daughter cell has a full set.on:

Explanation:

hope this helps:)

Early Christianity developed in which commu-
nities?

Answers

Answer:

D

Explanation:

I literly just finished studying this and amnow taking the test lol.

The French Institute of Tropical America, which is located in French Guiana, studies:

disease
South American Airlines
snakes
soil and ocean water

Answers

I’m pretty sure it’s soil and ocean water

Which of the following is an example of one person making a difference? A. John Adams getting elected as president B. John Doe submitting a petition signed by hundreds C. Rosa Parks refusing to give up her seat on the bus​

Answers

Answer:

c

Explanation:

it help with the segregation and getting rid of segregation

How did the experiences of Irish immigrants in Newark compare with those of
African Americans from 1820-1950?

Answers

looked down upon and treated poorly

Use the chart below to answer the question. • Congress feared a possible war with Mexico • Abolitionists feared the expansion of slavery • Northern states feared the addition of another slave state would lead to a Civil War How did the above concerns affect Texas?

Answers

Answer:

The above concerns affect Texas during the period of Annexation of Texas

Explanation:

Before the Annexation of Texas by the United States on 29th December 1845, the United States Congress feared a possible war with Mexico, this is because the Texas territory was initially part of the Mexico country before it declared independence.

Also, Abolitionists feared the expansion of slavery, this is because the Texas territory was a slave territory at the time, and the United States abolitionist believed that annexation of Texas would increase the Slave States

Northern states feared the addition of another slave state would lead to a Civil War, this is because the Northern states are free, and with the inclusion of Texas, which is slave territory, there would be more agitation and counter agitation of the issue of slave and free state which may lead to civil war eventually.

Question 22
"I am become death, the destroyer of worlds
Any man whose errors take ten years to correct is quite a man
Both the man of science and the man of action live always at the edge of mystery, surrounded by it."
-J. Robert Oppenheimer, after witnessing the first successful test of an atomic bomb
The top-secret federally funded plan that researched, produced, and tested the atmoic bomb was
A the Manhattan Project
B
the A-Bomb Plan
С
the Chicago Project
D
The Roosevelt-Bomb Project

Answers

Answer:

the Manhattan Project

Explanation:

https://constitutioncenter.org/blog/on-this-day-fdr-approves-funding-the-manhattan-project#:~:text=On%20this%20day%20in%201941,the%20world's%20first%20atomic%20bombs.

slum brigades

1) Were a part of the Salvation Army that was sent to instruct the lower class about middle class values, hard work, and temperance.

2) ​​​​​​A part of the YMCA which recruited young Christian men to join and learn about religious values

3) Visited cities and urban areas and cleaned up the area

​​​​​​​4) Held conventions every Thursday night dressed in costumes and chanting

Answers

Because uncanny recruited young Christian for a reason and that is the reason

A) Many countries were fighting World War II, and the Chinese were allies with the United States.

B) Each person arrives with a dream or a plan, and each hopes that America can provide opportunity.

C) Many Chinese immigrants worked on a portion of the project that started in California and headed east.

D) After 80 years, a large number of Chinese people began to come to America again.

Answers

Answer:

C

Explanation:

Most logical answer

After Sputnik, what was the concern for
the U.S. military about Russia's ability
to launch rockets into space?
A Russia would go to the moon.
B. Russia would launch a man.
C. Russia would launch bombs,
D. Russia would win the race.

Answers

Answer:

D

Explanation:

On July 3, 1969, The USSR made its second attempt to launch its own moon rocket, known as N1.

hope this helps! :)

If D means Russia would win the Arms race and raise tensions in the Cold War then the answer is D

Which amendment protects unenumerated rights such as voting right?
the First Amendment
the Fourth Amendment
the Fifth Amendment
the Ninth Amendment

Answers

Answer:

D

Explanation:

Which amendment protects unenumerated rights such as voting rights?

the First Amendment

the Fourth Amendment

the Fifth Amendment

the Ninth Amendment

              Unenumerated rights

The Ninth Amendment amendment protects unenumerated rights such as voting right

For the main purpose of Privacy, rights must be respected, also unless forbidden by state law.

When Some rights are not included in the Constitution but are still protected.

Also when the Certain rights are included in the Constitution and also should be protected.

Although when Some rights found in the Constitution should be denied in certain situations.

Thus, The decisions the Supreme Court makes such as declaring that abortion is constitution also give people Unenumerated constitutional rights even though they are not in the Constitution.

Find out more information about unenumerated rights here:

https://brainly.com/question/26358184

Describe the events of the Korean War.

Answers

Question:Describe the events of the Korean War.Explanation: The Korean War happen on Jun 25,1950-July 27,1953. The Korean War was a war between North Korea and South Korea. The war began on 25 June 1950 when North Korea invaded South Korea following clashes along the border and insurrections in the south. The war ended unofficially on 27 July 1953 in an armistice.Truman orders air and naval support for South Korea & calls for UN intervention June 27, 1950U.S. troops invade at Inchon September 15, 1950Pyongyang falls to UN forces October 19, 1950Chinese divisions enter fighting November 4, 1950MacArthur declares "There is no substitute for victory" March 1951 In message to House Republican leader Martin, MacArthur expresses his frustration with the limited war U.S. is fighting against communistsTruman relieves MacArthur of command April 11, 1951 Following several warnings about insubordination, Truman angers public (69% support MacArthur) by firing the US commanderMacArthur addresses Congress after being away from the U.S. since 1935 April 19, 1951 In emotional speech, MacArthur declares "Old soldiers never die, they merely fade away".Negotiations begin at Panmunjon July 1951 Talks drag on until 1953 and war is settled with the establishment of a DMZ (demilitarized zone) on each side of the 38th parallelKorea becomes campaign issue in 1952 presidential election Summer 1952 Eisenhower pledges to go to Korea to end the war. VP candidate Nixon contends Democrats had caved in to communists in Korea and that Democrat presidential candidate Stevenson should be called "Adlai the Appeaser"Armistice formally re-established the division of Korea March 1953 Formal peace treaty never signed. Over 1,000,000 Koreans and 54,000 Americans killed in conflict plus thousands who die as prisoners of war

Is it enough if the school is afraid there might be disruption

Answers

Wait what are u saying

Answer:

yes I agree even though I have no Idea what u are talking about

Explanation:

mark me brainy plz!??

write a fictional short story about an Irish immigrant working on building the Erie canal


plz write a short story

Answers

Answer:

On July 4, 1817, a shovel plunged into the soil in Rome, NY, thereby beginning one of the most significant turning points in American history. On that day, the Erie Canal began and set in motion the new nation's future of transportation, trade, and technology. To celebrate the 200th anniversary of this historic moment, museums, local governments, schools, and civic organizations all over New York are hosting events and creating special projects. The Irish and The Erie live program and CD is Craobh Dugan's contribution.

Having lived his whole life near the Erie Canal, Craobh Dugan's lead fiddler and creative director Mike Hoke was inspired to look into the history of our Irish ancestors' contribution to the digging of "Clinton's Ditch". He knew that thousands of Irish immigrants had spent long hard days digging through the rough wilderness, facing perils like malaria and cholera, and he wanted to make sure the 200th anniversary commemorations didn't leave them out.

After many hours spent at the Jervis Library, Mike wrote the script for The Irish and The Erie live performance filling it with stories and humor. Then he blended in traditional Irish tunes and songs and even added some new lyrics about the Erie Canal. Craobh Dugan mandolin and banjo player Bill Fahy contributed an original Erie Canal song too.

Explanation:

What a grand jury decides to do if there is enough evidence against a person ______

1. Implicate
2. Indict



Plzzzzzzz help me

Answers

Implicate maybe not sure

Answer:

indictment.

Explanation:

Indictment is when someone is convicted of a crime and the grand jury formally accuses the defendant of the crime. This is not the sentencing part of the trial. Impeachment is when a president/governor commits a crime and gets removed by the Legislature. The answer is indictment. Hope this helps you!

Other Questions
The coefficients of a quadratic equation are all integers.The discriminant is 0. Which statement best describes its roots?A) Two irrational rootsB) No real rootsC) One rational rootD) Two rational roots plz help im having a really tuff time right now Eloise spent $1.65 on potato salad that costs $0.25 per pound. How many pounds of potato salad did she buy? - Identify which 2 positions the Earth is in during an equinox. For what reason are the ideas of democracy and the practice of democracy in separately linked? Mr. Rogers wanted to study the affect of different types of music would have on students ability to complete the IA. What is his dependent variable? What Is his independent variable ?A. classroomsB. types of musicC. IA scoresD. students Monopolies are inefficient compared to perfectly competitive firms because monopolies produce output with average total cost exceeding average revenue produce output with average total cost exceeding average revenue A produce more output than is social desirable produce more output than is social desirable B charge a price less than marginal revenue charge a price less than marginal revenue C charge a price greater than marginal cost charge a price greater than marginal cost D charge a price less than average total cost A baseball is hit in the air. Its height above the ground is described by the function Ht=-16t^2+45t+5, where H(t) represents the height in feet of the ball t seconds after it is hit. To the nearest hundredth of a second, for how much time will the ball be in the air? Find algebraically. help guys plz i suck at math, also step by step is needed Branliest is the reward like always Help, please help!!!!!!!!!!!!!!!!! the difference of two numbers is 7. Three times the greater number is 72. find the numbers What is an example of biotechnology? who is VluspPlease help ASAP!!!!! What is the strongest piece of evidence in the second paragraph of thearticle by Douglass?A)greatness in the ability to organizeB) greatness in the ability to discover truthTheodore Parker's three grades of human greatnessD) greatness in executive and administrative ability PLEASE HELP ME IM GIVING EVERTYTHING FOR THISAll About Me Graffiti Wall PowerPointWorth 25 PointsDue Thursday, April 1, 2021 Can someone help me with this? And no links or random answers please. i dunno TvTSAYS I NEED MORE WORDS OK HERE I AM what does martin luther king jr urge americans to do after police attack protestors on the bridge Please complete the following DNA strands1. AGGTCCAAGCTCAAATTTCCCC2. GAAACCCCTTAAACCTTAATTCC3. GCGCGCGCAAATTTTTCCCATCTPlease complete the following strands using RNA:1. AGGTCCCAAAGGCCCTTTCC2. UAAAGGGCCCAGCCCACC3. CUAAAAGGGGGUUUUAACC Juan wants to buy a doll house that is 45% off. The original price is$74.85.What is amount of discount (nearest hundredth)?Answer this quick pls!! :,) Can someone plzzzz help meeee!!!!! Wayne charges the following for repairing washing machines:28 call-out charge + 16 for each half-hour he spends on the repairIf a repair costs 76, how long did it take?