12. What group of organisms are most in danger of extinction?

those with small populations

both a and b

those with large populations that breed quickly

those that migrate or need special habitats

Answers

Answer 1

Answer:

Both A and B

Explanation:


Related Questions

What is another name of molecular biology????

Answers

Answer:

biotechnology

Explanation:

hope it help you

Answer:

biotechnology biotech

biological engineering biological science

Shivering and vasoconstriction would be signaled to cause a: A. increase in pH. B. decrease in temperature. C. decrease in pH. D. increase in temperature.

Answers

Answer:D

Explanation: shivering occurs when someone is cold and vasoconstriction is when the blood vessels close to the skin and the veins closer to the skin surface constrict as a result of dat air doesn’t enter the body

Vasoconstriction is the narrowing of the blood vessels that hinders blood flow. Vasoconstriction and shivering will lead to an increase in the temperature through thermoregulation. Thus, option d is correct.

What is thermoregulation?

Thermoregulation is the maintenance and balancing of the temperature and heat in the body. They are regulated by many factors including shivering and vasoconstriction.

During the vasoconstriction, the blood vessels close to the skin surface close and the body shivers as a result of cold or decreased temperature. This signals the body to increase the temperature so that shivering can be stopped.

Therefore, vasoconstriction and shivering signal the body to increase the temperature.

Learn more about thermoregulation here:

https://brainly.com/question/7450241

#SPJ2

Metamorphosis is:______.a. changing of one body form to another within a species, such as the change from an aquatic tadpole to a terrestrial frog. b. an intermediate condition, such as length of legs in mice between longer legs of some mice and shorter legs in others, a condition caused by Hox genes. c. the evolutionary transition from fishes to amphibians. d. the developmental changing of a scale to a feather.

Answers

Answer:

changing i think

Explanation:

Beyond changes in relationships described above, explain what other characteristics of man changed after the Fall.

Answers

Answer:

The consequences of the fall was man and woman will die man turned to mortal and will turn back into dust. woman would bring children in pain. relationships between husband and wife would be difficult. The ground was cursed labor would be very hard. human was banned from the paradise and the garden. no longer would they enjoy the holiness and justice they had in paradise.

Explanation:

any 3 communicable diseases,its symptoms,prevention and source.

Answers

Answer:

1) Flu

2) Hantavirus

3)HIV/AIDS

hope it helps you

Explanation:

How are the molecules in photosynthesis and cellular respiration similar? Please include descriptions of the molecules

Answers

Answer:

They are similar because they both produce energy but in two different forms.

Photosynthesis- It produces oxygen and G3P, simple carbohydrate molecules that are high in energy and can be converted into glucose, sucrose, or other sugar molecules.

cellular respiration-During cellular respiration, a glucose molecule is gradually broken down into carbon dioxide and water.

They exhibit the same responses, but they do so in reverse. Carbon dioxide and water are converted during photosynthesis into glucose and oxygen. Carbon dioxide and water are produced during respiration in exchange for glucose and oxygen.

What similarity in photosynthesis and cellular respiration?

Energy transformations from one form to another are a part of both respiration and photosynthesis through a sequence of metabolic reactions.

The reactions that are carried out by both processes—which both use and produce ATP—are carried out on membranes and are managed by enzymes.

Light energy is converted by photosynthesis into chemical energy that is stored in glucose, which is then released by cellular respiration to create ATP, the life-sustaining compound.

Therefore, They are similar because they both produce energy, but in two different forms.

Learn more about cellular respiration here:

https://brainly.com/question/28532054

#SPJ2

How are the proteins inside your body affected by the presence of water and other molecules?

Answers

Answer:

Our body is constitute of several essential molecules such as proteins, fat, carbohydrate, water, and other molecules.

Each molecule has some of the impact of other molecules in the body. Impact of water and other molecules on proteins inside the body are as follows:

Proteins have ligand-binding site and water provide stability to the ligand-binding site of proteins through its hydrogen bonds.Conformational flexibility and transitions of proteins are due to the presence of water molecules in it.Disbalance in the pH of body due to changing concentration of sodium-potassium ions can denature the protein. Enzymes present in the body can control the rate of formation of proteins in the body.

what are some non examples of hydroshere

Answers

Oceans, lakes, seas, and clouds are examples.

The hydrosphere is made up of all the water on the planet, including the water found below the surface and in the atmosphere. A planet's hydrosphere may be liquid, vaporous, or composed of ice. The three surface water bodies on Earth are oceans, lakes, and rivers.

What are some non examples of hydrosphere?

It comprises all surface waters that are liquid or frozen, groundwater that is contained in soil or rock, and atmospheric water vapor. The hydrologic cycle continuously circulates almost all of these waters. In wells and aquifers, it can also be found underground as groundwater.

Within the hydrosphere, water circulates in a cycle. Clouds contain water that eventually falls to Earth as rain or snow.

Therefore, Rivers, lakes, and seas are where this water gathers. The cycle is then restarted by its evaporation into the atmosphere. The water cycle refers to this.

Learn more about hydrosphere here:

https://brainly.com/question/14686427

#SPJ2

please answer the question​

Answers

Answer:

two of the DNA fingerprint are same when they contain the same nitrogenous bases in the same location of the DNA.

Explanation:

The DNA fingerprint is one of the most important tool as a forensic medicine expert to to form such condition and rule it out to come to a diagnosis.

DNA fingerprint uses the base pair which a different for all the other human beings. Due to this from the blood or other cells of the body there can be an evidence of the person and this is usually done on a comparative basis.

To know more about DNA fingerprint,

what is DNA fingerprinting? - Brainly.in

brainly.in/question/3388325

HOPE IT HELPS!!!

MARK IT BRAINLIEST!!!!

what are sex hormones?why are they named so? state their function.

Answers

Answer:

Sex hormones or hormones of the reproductive organs are certain cells in the reproductive organs that produce hormones.

The testis produces testosterone,the male sex hormone,and the ovaries produces oestrogen and progesterone, the female sex hormones.

In a sexually mature male,testosterone influences sexual behaviour, and together with FSH,regulates sperm production in the seminiferous tubules of the testes.

Sexually matured females undergo a regular 4-week reproductive or menstrual cycle during which a mature egg is released.This cycle is regulated by oestrogen and progesterone. During pregnancy, progesterone inhibits egg production (ovulation),brings about the development of the placenta and prevents the uterus from contracting....I hope this answers your question... Thank you for the question.

Which would have a bigger effect on an organism, an error during transcription or a point mutation?

Answers

Answer: Point mutation would have a bigger effect on an organism.

Explanation:

PLEASE ANSWER ASAP!!!!!!!! ITS DUE IN 5 MINUTES.

1.) How do organisms benefit from Mitosis? Write a paragraph using at least five sentences.


Answers

Answer:

Organisms benefit from mitosis because mitosis helps regenerate cells. This helps them recover from injuries and more.

Explanation:

Name four breeds of cattle

Answers

Answer:

Black Angus, Red Angus, Holstein, Gelbvieh

Hope this helps!

Tara placed a grape in a solution, after sometime she noticed that the grape started to shrink.
a. Name the solution and explain.
b. Then Tara placed the raisin in a solution and noticed it started to swell up. Name the solution and explain

Answers

Answer:

a. Hypertonic solution

b. Hypotonic solution

Explanation:

There are basically 3 types of solutions in biology,

1) Isotonic-Same concentration of solute and solvent inside  the grape and in the solution.

2)Hypotonic solution-More concentration of solvent in the solution than in the grape.

3)Hypertonic solution-More concentration of solvent in the grape than in the solution.

Now,

a. Tara had kept the grape in a hypertonic solution. The solvent will start draining from the grape to equalize the concentrations of solvent inside and outside. So, the grape shrank due to loss of water.

b. Tara kept it in a hypotonic solution. The solvent will start entering the grape to equalize the concentrations of solvent. So, the grape started swelling.

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

Witch statement correctly compares the “analysis” and “conclusion” section of a lab report

Answers

Answer:

Analysis section of lab report comprises of making comparisons while Conclusion section is used to make further research about the experiment.

Explanation:

Analysis section of lab report comprises of making comparisons between specific data. After knowing the scope and objectives of the experiment, data is collected either by performing the experiment or adopted data from other organization such as hydrological data obtained from hydrological agency, analysis of such data comprises of making comparisons.

While

Conclusion section is used to make further research about the experiment. It is used to report the outcome of the result and also to determine other possibilities of results from the experiment.

can DNA be extracted from dead cells

Answers

The short answer is yes. Based on your DNA, your body is better suited for some foods than others. This company found that 45% of people’s genes need a high carb diet, 47% need moderate and only 8% need low.

Hope this helped! <3

Metals are useful in industry because they can be shaped without breaking. What is this property of metals called?

Answers

Answer:

malleable ................

Answer:

versatility ductility conductivity malleability

The hypothalamic hormone that triggers the secretion of FSH and LH from the anterior pituitary is

Answers

Answer:

Hypothalamic-Pituitary-Gonadal Axis

GnRH produced by the hypothalamus stimulates the production of both LH and FSH. FSH functions by stimulating ovarian follicular development in females and regulating spermatogenesis in males. LH induces ovulation and corpus luteum formation in the ovaries.

plz give brainlist

hope this helped

what action is a reflex action

Answers

Answer:

A reflex action is an involuntary , quick  response to a stimulus, which minimises any damage to the body from potentially harmful conditions, such as touching something hot.

Explanation:

How much time is required for a P-wave to travel 6,000 kilometers?

Answers

Answer:

294.1 minutes

Explanation:

5,882 seconds (98 minutes) to travel 2,000 km.

2,000 x 3 = 6,000

5,882 seconds x 3 = 17,646

(294.1 minutes) to travel 6,000 km

what mode of nutrition is house fly​

Answers

Answer:

Houseflies do not have chewing mouthparts like a cockroach or piercing-sucking mouthparts like a mosquito. They regurgitate digestive enzymes, soften and liquify the food material, and then they sop it up with their sponging mouthparts.

Hope this makes sense and helps

Question What was the ratio of tall to short plants in the F2 generation of Mendel's experiments? A. 3:1 B. 2:1 O C. 1:1 D. 6:1 ​

Answers

Answer:

A

Explanation:

Answer: 3:1

Explanation:

i got it right on the test

Muscle cell are richer in lysosomes , as they require lot of energy. correct and rewrite the following statement.

Answers

Answer:

See below

Explanation:

The correct statement is:

=> Muscle cells are richer in mitochondria, as they required lots of energy.

Mitochondrion acts as power house of the cell providing the cell with the required energy.

Correct Statement:-

Muscle cells are richer in Mitochondria, as they require a lot of energy.

[tex] \large{ \underline{ \boxed{ \pink{ \rm{Explanation}}}}}[/tex]

Especially in Skeletal muscles, Mitochondria and glycogen granules are found in abundance. Our limbs that includes our arms and legs shows movement which needs energy. The food is oxidized and energy is released.

More to know:-Mitochondria is popularly known as Power house of the cell or ATP generation site.It is a double-membranous structure with outer membrane smooth and inner membrane surrounds the matrix.The inner membrane have cristae which increase surface area.The cristae bear Oxysomes or F0-F1 particles.Mitocondria is semi-autonomous, it have it's own DNA and ribosomes.

━━━━━━━━━━━━━━━━━━━━

Examine the following diagram. Place the labeled layers in order from youngest to oldest.

Public Domain

A, B, C, D
C, D, B, A
D, A, B, C
C, B, A, D

Answers

Answer:

C, D, B, A

Explanation:

Got it right on the quiz. Also the definite order would be that D HAS to be before A and B and only the second option has that since C is lava which is the most recent.

here are times where you will be provided with BUD dates. When you do not have access to the BUD dates, you will have to determine that date yourself. What is the appropriate BUD date for a water containing oral formulation? Not later than 14 days Not later than 30 days

Answers

Answer:

Explanation: Not later than 14 days.

Beyond Use Date (BUD) is the date after which a compounded sterile preparation may not be stored or transported. This time is calculated from the date of compounding, and it is different from expiration date. This is because the BUDs are assigned with a different approach from those applied to assigning expiration dates to  manufactured drug products. Also, compounded preparations are intended for administration following short-term storage. So, the BUD is the date after which a compounded preparation shall not be  used. A reliable BUD is established to ensure that the preparation  has an accepted quality and purity at least  until the labeled BUD.

BUD is calculated by:

Type of container in which it is packagedHow long the medication will be takenType of drugHow fast is the drug degradatedStorage conditionsDosage of the medicationNature of the drug and its degradation mechanism Potential for microbial proliferation in the preparation

For Nonaqueous Formulation, the BUD is not later than 6 months or the time  remaining until the earliest expiration date of any API (Active pharmaceutical ingredient), whichever is earlier.  

For Water-Containing Oral Formulation, the BUD is not later than 14  days when it is stored at controlled cold temperatures.

For Dermal and Mucosal Liquid, Semisolid Formulations/Water-Containing Topical, the BUD is not later than 30 days.

A group of coordinately regulated structural genes with related metabolic functions, plus the promoter and operator sites that control their transcription, is called a/an ___________.

Answers

Answer:

They are called promoter and regulatory genes.

Explanation:

There are different genes responsible for regulating transcription:

These are the inhibitors, promoters and regulators.

Regulatory genes are in charge of regulating that promoter or inhibitor genes remain intact or do not present mutations.

Promoter genes promote cell replication, hence transcription.

In the case of malignant or benign neoplasms, there must be yes or if the affection of a regulatory gene plus the affection of an inhibitory or promoter gene.

SIOM CSserials
What has a greater influence on protein levels?
(1 point)
Protein degradation has a greater influence because outside factors like antibiotics can
cause it, and it is difficult to recover from.
O
Protein degradation has a greater influence because they are denatured faster than the cell
can produce them.
mRNA destroyer concentration has a greater influence because it is destroying mRNA before
proteins can even be produced.
mRNA destroyer concentration has a greater influence because mRNA is destroyed right
after the proteins are produced.

Answers

Answer:

mRNA destroyer concentration has a greater influence because it is destroying mRNA before  proteins can even be produced.

Explanation:

Proteins are synthesized from mRNA through the process of translation. mRNAs are first synthesized from a coding DNA template through the process of transcription. Hence, if mRNAs are destroyed, it means proteins will not be synthesized at all.

Protein not being synthesized at all means that mRNA destroyer concentration has a greater influence on protein levels than protein degradation. With protein degradation, not all the protein is degraded at once and some quantity of the protein can still be found, but with mRNA destroyer concentration, no protein can be found at all because it was not synthesized in the first place.

I have four brothers
"This is what type of
observation?

Answers

Quantatative data since it is physically counting

Explain how scientific knowledge develops through making observations about the natural world.

Answers

Answer:

Scientific knowledge develops through making observations about the natural world. An observation may generate a scientific question, which may lead to a hypothesis. The hypothesis can be tested through experimentation. The results of experimentation lead to changes in scientific knowledge.

Explanation:

Explain how scientific knowledge develops through making observations about the natural world.  my answers are never wrong trust me

Other Questions
"There is no reason to show you are paying attention (nods, small verbal affirmations, etc) if you are indeed ___________." write the formula used to find length when the breadth height and volume are known........breadth when the length height and volume are known............ height when the breadth length and volume are known ..............Please answer this as fast as possible my homework is due tommorow If the coefficient of correlation is 0.8, the percentage of variation in the dependent variable explained by the variation in the independent variable is If two of the ordered pairs was removed which two data points will cause the correlation to decrease the most? Select Two points1) Data point A2) Data point B3) Data point C4) Data point D Musah stands at the center of a rectangular field.He takes 50 steps north,then 25 steps West and finally 50 on a bearing of 315. Sketch Musah's movement How far west is Musah's final point from the center? How far north is Musah's final point from the center? Which of the following describe an angle with a vertex at A?Check all that apply.OA. ZABCB. ZCABC. ZACBD. ZBAC 50 POINTS!Choose a stanza from any poem, including those in this lesson. Write a paraphrase of those lines. Then compare the original stanza with the paraphrase. What has changed in the transition from poetry to prose? what is (a x b) x c, if a = 11, b = 9, and c = 1? PLEASE HELP!!! need help on this very very easy question plz in triangle ABC A-B= 15 degree, B-C= 30 degree find A,B,C Which statements are true about "evidence"? select all that apply observations which answer questions proof that an idea is true information for or against an idea data to help draw a conclusion Zach keeps his pet chameleon Pinky in a terrarium with the dimensions shown below. There's sand in the bottom of the terrarium that reaches a height of 8 centimeters. Zach gets a new terrarium for Pinky that is larger. The base of the new terrarium is 25 by 64 centimeters. Zach moved the existing sand to the new terrarium. does successfully completing a driver education courseguarantee that you become a safe driver??a. Trueb. False arner HomeClasswork for Alge.VNext >Pretest: Circles with and Without CoordinatesSubmit TestReade18The curved parts of the figure are arcs centered at points A and C. What is the approximate length of boundary ABCD? Use the value = 3and round the answer to one decimal place.5301205 why would you perform a pain assessment on a patient? If x and y are two positive real numbers such that x 2 +4y 2 =17 and xy =2, then find the value of x- 2y. a. 3 b. 4 c. 8 d. 9 The seller told the listing broker that the seller's loan was assumable. Upon reviewing the seller's loan documents the listing broker found the mortgage was not assumable and the seller would have to pay off the mortgage upon sale. What clause did the listing broker discover upon reading the mortgage document Modern farming methods require moreinputs which are manufactured in industry. Do youagree? Barbara Cusumano worked 60 hours last week. Of those hours, 40 hours were paid at the regular-time rate of $12.50 an hour, 18 hours at the time-and-a-half rate, and 2 hours at the double-time rate. What was Barbara's gross pay for the week? How many significant figures does each value contain? 5.6803 kg has significant figures. 0.00047 seconds has significant figures. 0.240 miles has significant figures.