Answer:
The earths crust is composed by a variety of igneous, metamorphic, and sedimentary rocks. The crust is underlain by the mantle. The crust occupies less than 1 percent of the earths volume.
In subduction what plate would be on top and what plate would be on the bottom?
Answer:
oceanic plate would slide under the continental plate
Explanation:
continental is on top, oceanic on bottom
Answer:
When an oceanic lithosphere meets a continental lithosphere in a subduction zone, the oceanic plate always goes under the continental plate. This is the rule because the rock making up an oceanic lithosphere is denser than in a continental lithosphere.२०२० मे
What is molting????????
A dragonfly in its radical final moult, metamorphosing from an aquatic nymph to a winged adult.
In biology, moulting (British English), or molting (American English), also known as sloughing, shedding, or in many invertebrates, ecdysis, is the manner in which an animal routinely casts off a part of its body (often, but not always, an outer layer or covering), either at specific times of the year, or at specific points in its life cycle.
Moulting can involve shedding the epidermis (skin), pelage (hair, feathers, fur, wool), or other external layer. In some groups, other body parts may be shed, for example, wings in some insects or the entire exoskeleton in arthropods.
Rocky's class recently got pet turtles. When putting together the habitat, decomposers were added to
the soil, as well as some smaller organisms that turtles eat. Some students wanted to get "fake" plants
for the terrarium, but Rocky insisted that this would negatively affect the carbon and oxygen cycles.
Which of the following reasons support why Rocky is correct?
Carbon won't be removed from the air.
Photosynthesis won't occur.
The turtles won't be able to breathe.
All of these are correct.
Answer:
D. all of these are correct
Explanation:
I so sorry if I am wrong the answer
In order for a neuron to receive and transmit a message it must be in a polarized state. While in this rest state there are more sodium ions outside the cell membrane while potassium is prevalent inside the cell. This causes the neuron to maintain a neutral charge. Once the action potential arrives at its [ Select ] , a nerve cell will shuttle the message down its own axon and to the next neuron via its [ Select ] . This impulse will cause the cell to become [ Select ] and will effectively change the charge of the neuron to a [ Select ] charge. After sodium rushes into the cell, the potassium will rush out in order to [ Select ] . Once the impulse reaches the axon terminal, it is [ Select ] that stimulates a [ Select ] to continue the message to the next neuron. The neuron then undergoes a [ Select ] when all ions are repositioned with help of the
Answer:
The process of nerve impulse transmission by means of an action potential involves the processes of depolarization, repolarization, hyperpolarization and restoration of resting memebrane potential.
Explanation:
In order for a neuron to receive and transmit a message it must be in a polarized state. While in this rest state there are more sodium ions outside the cell membrane while potassium is prevalent inside the cell. This causes the neuron to maintain a neutral charge. Once the action potential arrives at its dendrites, a nerve cell will shuttle the message down its own axon and to the next neuron via its axon terminal. This impulse will cause the cell to become depolarized and will effectively change the charge of the neuron to a poositive charge. After sodium rushes into the cell, the potassium will rush out in order to restore its resting memebrane potential. Once the impulse reaches the axon terminal, it is used to open voltage- gated calcium channels releasing calcium ions that stimulates a neurotransmitter to continue the message to the next neuron. The neuron then undergoes a repolarisation when all ions are repositioned with help of the voltage-gated ion channels.
why do snails like leaf litters
Answer:
They will eat the biofilm that grows on the leaves. My snails love my oak leaf litter, as do my loaches. They eat the film off them.
Explanation:
Recycling of car batteries can help to do what to lead?
Please help me, I really need help with this.
Fossils and Evolution On Study Island
A team of scientists are studying three different layers of sedimentary rock to learn about a particular reptile species. In the layer of rock that is closest to the Earth's surface, the reptiles' teeth fossils are found to be short and straight. In the layer below, the reptiles' teeth fossils are found to be long and straight. In the layer below that, the reptiles' teeth fossils are found to be long and curved.
Based on this information, the reptiles today most likely have
A.
long, straight teeth.
B.
no teeth.
C.
long, curved teeth.
D.
short, straight teeth.
Answer: short, straight teeth
Explanation: study island
Having trouble with this textbook question. Can anyone help me out?
"You learned that the length of the cell cycle varies between cell types. Predict which of the three phases of the cell cycle varies"
Answer:
Oh well Thx that could really help
The ATP produced by a plant cell is made in the process of CELLULAR RESPIRATION which occurs in the
A. endoplasmic reticulum.
B. ribosomes.
C. mitochondria.
Answer:
Mitochondria
Explanation:
Answer:
C
Explanation:
As mitochondria is the power house of plant cell.
Many research studies have shown that different species may possess some of the exact same genes but show vastly different traits. How can that happen?
Answer:
Mutation can occur or the order in which these genes appear are in different order. Genetic variation can also occur.
necesito hacer una infografia en mi computadora y nose como pueden ayudarme
Answer:
Identify the audience for your infographic.
Collect your content and relevant data.
Choose your desired infographic template.
Download your template to PowerPoint.
Customize your infographic.
Include a footer with your sources and logo.
Add an embed code and Pinterest button, and publish it.
Explanation:
Please help me. Thank you :()
An airplane flies from Minneapolis to Chicago in 62 minutes.
If it is 572,000 meters from Minneapolis to Chicago, what is the plane's average speed?
A. 2,000 m/s
B. 355 m/s
C. 154 m/s
D. 119 m/s
Answer:
154m/s
Explanation:
Average speed= distance(m)/time(sec)
Distance=572,000metres
Time=62×60=3720seconds
As=572000/3720=153.76aproximately154m/s
help asap please!
science
Complete the table below to show the difference between active and passive transport. Put a “X” in boxes that satisfy the statement.
Answer:
Active transport:
requires energymolecules move from low to high concentration sidesNa+ and K+ move by active transportSimple diffusion:
molecules move from high to low concentration sidesmolecules pass between lipids small non-polar and polar moleculesFacilitated diffusion:
molecules move from high to low concentration sidesinvolves channel proteinsmove large moleculesExplanation:
Simple Diffusion is the pathway of only small molecules that freely move through the membrane by momentary openings produced by the lipids' movements. Diffusion is a slow process that requires short distances and pronounced concentration gradients to be efficient. An example of diffusion is osmosis by which water is the transported molecule. Facilitated diffusion is the transport of hydrophilic molecules that can not freely cross the membrane. Channel protein and many carrier proteins are in charge of this transport. When uncharged molecules cross the membrane, they do it according to their concentration gradients, going from the more concentrated side to the lower concentrated one. When ions need to cross the membrane, the process depends on an electrochemical gradient. Glucose is an example of a hydrophilic protein that gets into the cell by facilitated diffusion.Simple diffusion and facilitated diffusion are both passive transport processes because they only depend on electrochemical gradients, so they do not need any energy to occur.
Active transport is the transport of molecules that move against the electrochemical gradient, so it does need energy to happen. Molecules move from the lower concentration side to the higher concentration side of the membrane. Carrier proteins are in charge of active transport. The needed energy might proceed from the ATP molecules or the membrane's electric potential. An example of molecules moved by active transport are the Na and K.In Active transport, molecules or ions move against the concentration gradient by using energy from ATP.
What is Membrane transport?The transfer of molecules across the plasma membrane into or out of the cell.
There are two types of membrane transport,
1. Passive transport:
When molecules move along the gradient. It can be of two types,
Simple diffusion (via phospholipids)Facilitated diffusion (via channel protein)2. Active transport:
When molecules move against the concentration gradient, they require energy. Energy is given by ATP.
Therefore, in Active transport, molecules or ions move against the concentration gradient by using energy from ATP.
Learn more about Membrane transport:
https://brainly.com/question/13220002
How do B cells know when to make antibodies?
A.) They are alerted by Helper T cells.
B.) They are always making antibodies just in case that pathogen is present.
C.) They are alerted by Macrophages.
D.) B cells will simply find the pathogen in the body and immediately begin making
antibodies to fight the pathogen.
Answer:
A) They are alerted by Helper T cells.
What is the function of the DNA
Answer:the function is direction to build life
Explanation: i’m smart
Answer:
DNA is a information molecules.
It stores instructions for making other large molecules called proteins
these instructions are stored inside each of our cell.
distribution among 46 long structure called chromosomes
helpppppp pleaseeeeeee
Which of the following is not a benefit to humans from biodiversity?
A. Many medications are made from living organisms
B. Enjoyment from recreational activities
C. We have a variety of products produced for clothing, food, and other items
D. The weather is more comfortable
For me it's letter A.
Because B and C and D are benefits of biodiversity....So that's why,for me it's letter A.
Well,don't trust me if you don't want to
Choose the mutation that you think has caused Calix’s calico fur coloring. Form a hypothesis to explain your reasoning. You will be able to revise your hypothesis as you collect more data. ( Ya'll i need a hypothesis )
The complete question is as follows:
Hypothesis Cas More Information: Here is a summary of the data, Mass of DNA Cat Res per Coll Mother Father Calix 1520 fg 1495 fg 1535 fg . The mass of an X chromosome is 40 fg. • Point mutations do not change the mass of DNA. • In chromosomal rearrangement, some daughter cells gain parts of chromosomes and some lose parts of chromosomes. • In nondisjunction, daughter cells gain a whole entire chromosome. Obe Exp Нур 는 Exp Point Mutation in Melosis Chromosomal Rearrangement Nondisjunction Choose the mutation that you think has caused Calix's calico fur coloring. Form a hypothesis to explain your reasoning. You will be able to revise your hypothesis as you collect more data.
Answer:
The correct answer is - non-disjunction.
Explanation:
Calix's calico has an X chromosome gene that determines the color of fur. One allele forms orange fur and the other give rise to black. In heterozygous give rise to orange patches on black.
Mother has autosome and 2-X chromosomes.
Mass of 2 X chromosomes will be
= 40*2
= 80fg
So mass of autosomes = 1520-80
= 1440fg
Mass of sex chromosomes in father is = 1495-1440
= 55fg
So the mass of Y=55-40
= 15fg
It is clear that the mass of DNA of Calix is exactly 15 more than DNA of the mother. So we can say that Calix has an entire Y chromosome in extra.
So the answer is non-disjunction.
The right option is - non-disjunction.
Information regarding Calix’s calico:It comprises of X chromosome gene that measured the fur color. In the case of heterozygous, it provides the increment with respect to orange that patches on black.
Since Mother has autosome and 2-X chromosomes.
So,
Mass of 2 X chromosomes should be
= 40*2
= 80fg
Now
The mass of autosomes should be
= 1520 - 80
= 1440fg
Now
Mass of s-ex chromosomes in father should be
= 1495-1440
= 55fg
Now finally the mass of Y is
= 55 - 40
= 15fg
Based on the above calculation, the mass of DNA of Calix should be 15 i.e. more than the DNA of the mother.
Learn more about the mutation here: https://brainly.com/question/8334911
Summarize the differences between early succession, mid-succession, and late succession?
Genetic information is stored and transmitted within.
A. nucleic acids.
B. proteins.
C. amino acids.
D. sugars.
Answer:
A. nucleic acids
Answer:
A. nucleic acids
Explanation:
AAAAAUGACCAAAGUGGAGUAAUGGUAACCC please type first 3 letters of each amino acid separated by a dash.
Answer:
what?
Explanation:
Protein in your diet provide what necessary substances to repair muscles?
The muscle damage initiates a repair process in which certain hormones, along with the macronutrient protein, synthesize new satellite cells, which are used to repair the damaged muscle fibers. In other words, the role of protein is to help repair tissues damaged by exercise.
Which species has the MOST RECENT common ancestor with the ROBIN?
Hagfish
(outgroup)
Salmon
Jaws
Frog
Keratinous
scales
Lizard
Lungs:
Four limbs
Alligator
D
Gizzard
Feathers
Claws
Robin
or nails
G
Rat
Fur;
Mammary
Glands
Gorilla
Time
O Lizard
O Salmon
O Gorilla
Negative feedback loops:
a. decrease rate
b. increase rate
c. reverse change
d. reinforce change
Answer:
the answer would be c
Explanation:
hope it helped
what happens to macromolecules from food during digestion?
what atoms makeup sugar molecules, amino acids, and fatty acids?
what do you notice about the atoms that make up these molecules?
how are these atoms used to make new molecules? what types of molecules are made?
where does the energy come from to produce these new molecules?
Answer:
In chemical digestion, enzymes break down food into the small molecules the body can use. It is important to break down macromolecules into smaller fragments that are of suitable size for absorption across cell membranes.
Amino acids are the monomers that makes up protein
If it's in the table, it's an element! Atoms can join together - they form bonds together - to make MOLECULES. For example, two atoms of hydrogen hook together to form a molecule of hydrogen, H2 for short.
BONDING. When atoms join together to form molecules, they are held together by chemical bonds. These bonds form as a result of the sharing or exchange of electrons between the atoms. ... Different atoms use these electrons to form one of three different types of bond: ionic bonds, covalent bonds, or metallic bonds.
Proteins. ...
Lipids. ...
Carbohydrates. ...
Nucleic Acids.
Respiration, which consists of three phases, occurs in the mitochondria, the cell's “powerhouses.” This metabolic pathway traps the maximum amount of stored chemical energy within a molecule of glucose, generating a total of 30 molecules of ATP in conjunction with glycolysis.
Please give me a brainliest...Thank you
plz help me on science due today
Answer:
A
Explanation:
Wind is caused by inequal heating. As you should have learned, things expand when they get hot and contract when they get cold. So, the high pressure hot air flows into the low pressure cold air via wind.
All you have to do is give me some inspiration and I'll give points cause I would really like some inspiration please
Answer:
ZOOM PLZ COME WE R BORED
MEETING ID 798 4170 2552
PASSWORD:XCNeV3
Explanation:
Why would breeders want to introduce mutations into a population?Single line text.
Short answers please
Answer:
Breeders can increase the genetic variation in a population by inducing mutations, which are the ultimate source of genetic variability
