2. Infer In lines 126-136, Maya tells a story about a student who immigrates

to the United States from Cambodia. How does this story advance, or add

details to, the plot's rising action?

Answers

Answer 1

Explanation:

It adds details to the plot's rising action since Maya is painted as been more intimidated because of her view that she's about to face something scary and embarrassing just as it happened to the student who immigrated to the United States from Cambodia.

Remember, any descriptions of incidents that create suspense, interest, or tensions are referred to as the rising action.

Answer 2

The text indicates that the immigrant may have experienced some inappropriate events. So she is used to feeling that way when she thinks she is in trouble. Although Maya has never undergone the same events as the other immigrant, Maya still feels uneasy and worried about getting in trouble. Maya thinks she has a connection with the immigrant that makes her more frightened that something scary and embarrassing will happen to her, as it did to the immigrant in the story.


Related Questions

Please can someone tell me the chapter 2 summary of Kensuke's kingdom

Answers

Answer:

The answer is

Explanation:

A young boy, Michael, travels with his parents around the world on the yacht Peggy Sue. Michael's parents teach him what he would have normally learnt at school themselves. When he is on lookout one night, steering the boat, Michael and his dog, Stella Artois, are washed overboard. They awake to discover that they are stranded on a desert island in the Pacific Ocean.

While Michael is struggling to survive on the island, food is regularly left for him. To his surprise, he learns that an old man called Kensuke is also living on the island. Kensuke helps Michael to survive. He sets guidelines that Michael thinks are just annoyances. When he is nearly killed by a giant jelly fish, Kensuke tends to Michael, and Michael eventually befriends him.

Michael teaches Kensuke English, and Kensuke in return teaches Michael how to paint, how to fish and where to find the best food and water. He is eventually revealed to be a doctor and survivor of ww 2, and he believes that his family died in nagasaki after the atomic bomb was dropped there on August 9, 1945. Over time Kensuke begins to understand how Michael feels and how he misses his family. They both build a beacon that would be lit to signal to ships, but for a long time they see no sign of any ships. Later, however Michael witnesses a Chinese junk and he consults Kensuke as to whether or not he should light the beacon, but Kensuke recognizes the ship as that of poachers and he and Michael rush to gather all the orangutans into the cave to protect them from the threat that lies in the ship. They nearly succeed but miss out one orangutan, that Kensuke calls Kikanbo, which they could not find. The ship arrives and they both hear gunshots. When the ship leaves they discover that some gibbon monkeys had been killed, but that Kikanbo was still alive. The next time they see a ship it is not the poachers and they both light the fire. The crew on the ship see the fire and change direction, heading towards the island. When the boat is closer, Michael sees that the boat is the Peggy Sue, with his parents on-board. Kensuke decides at that point, despite thinking otherwise earlier, that he would not be sailing home with Michael and tells him to keep everything a secret until 10 years had passed and Kensuke was dead. Michael runs out to the beach where the ship had landed and is reunited with his parents.

Hope this helps....

Have a nice day!!!!

Michael's boating adventure is mentioned in the summary. It also explains how he completes his academic work while on the boat.

What is Summary?

A summary refers to a brief introduction of any topic in your own words to make the reader easily understand the plot and setting of any story and help them to engage effectively.

The adventure Michael had aboard the boat is mentioned in the summary. It also explains his study habits while on the boat. According to Michael, he keeps a diary of the things he observes. Two-thirds of the surface of the earth is covered with water, Michael also informs us.

The summary of chapter 2 entails that Food is frequently left for Michael, who is trying to survive on the island. He discovers an elderly guy named Kensuke also resides on the island. Michael is helped by Kensuke to survive. Michael views the rules he establishes as just irritants.

Learn more about Summary, here:

https://brainly.com/question/28846379

#SPJ3

Select the correct answer. My mom is always repeating the same old joke: if your friends all jumped off a cliff, would you jump, too? Of course not. But I get what she means. She's talking about peer pressure. Teenagers like us live with it every day. Pretty much every kid wants to be liked, to have friends, to be popular. No one wants people to think they aren't cool. While peer pressure is tough, giving in to it and getting in trouble is tougher. But teenagers are still learning to make good decisions. Like this one time my friend Harold wanted to take his dad's prized Jeep Grand Cherokee for a drive. Harold was 13, and he'd never driven a car before. But he figured he knew enough about operating a motor vehicle just by watching his parents drive. When his parents were out of town one weekend, Harold invited me and some of our friends over to his house so he could take us for a drive. I said, "Not me," because I knew it was a stupid thing to do. I told him and everybody else what I thought of the idea. (Driving isn't easy. It took my big brother weeks to get the hang of it.) Harold got mad and told me I was being a chicken. I said, "I'd rather be a chicken than get in an accident and have a broken leg." What is the topic of this passage? A. Harold B. being popular C. peer pressure D. learning to drive

Answers

Answer:

C. Peer Pressure

Explanation:

The answer is C because in the passage, his friend Harold is trying to use peer pressure to force him into driving when they shouldn't.

Answer:

C.  peer pressure

Explanation:

his oratory (worked up/worked out) the feelings of the crowd...

worked up or worked out​​

Answers

Worked out the feeling of the crowd

Answer:

[tex]\boxed{\mathrm{view \: explanation}}[/tex]

Explanation:

His oratory worked up the feelings of the crowd.

“worked up” used in this context can also mean to excite or upset something.

What have you learned about Kafka's life and about the era in which he lived that helps you understand The Metamorphosis better?

Answers

Answer:

Franz Kafka wrote the metamorphosis at first because he felt the need to express the confrontation of man with the oppression of a modern world (At that time it was the outbreak of the First World War), and as such the history of metamorphosis originated as a story about the unbearable weight of responsibility he had to express that feeling.

Explanation:

Franz Kafka was a writer born in Prague, his works and writings were influential in existentialism, the philosophy of the absurd and other literary currents.

He also directly influenced writers who read his works thanks to his crude, unusual and absurd style.

Answer:

Plato Answer

Explanation:

Your answer might include these points:

Kafka's strained relationship with his father is reflected in Gregor Samsa's relationship with his insensitive father.

Gregor's job as a traveling salesman is tiring and monotonous, which echoes Kafka's job and the increase in industrialization during his lifetime.

Kafka lived amongst Czech-speaking people, yet he was more comfortable speaking German. As a nonreligious German Jew, Kafka always felt alienated from those around him. This sense of alienation is reflected in Gregor's isolation.

The novella is an absurdist story, which shows how deeply Kafka was influenced by the literary and artistic movements taking place around him.

Do jobs no you have work experience?

Answers

Some jobs will ask for work experience and some might get it from someone that you have referred them to, as evidence. They may even search up your social media and find out.

Hope that helped!!! k

Answer: no, only if you tell them. Or if it's mentioned in your resume or if they contact any references you provide.

Rewrite the following, eliminating extra words and combining short sentences into longer ones when necessary.

The first person that I met at the party was Cindy. Cindy was a blonde who had bright green eyes.

Answers

At the park I met Cindy first, she was blonde and had bright green eyes. Hope this helps! :)

1. Why do writers make particular choices when composing a text? 2. How does the interaction between a reader and a text create meaning? 3. What does it mean to be a stranger in a village?

Answers

1. Why do writers make particular choices when composing a text?

The creation of a text is not always a straightforward process. Moreover, it is a process that looks different for every individual. Therefore, this process involves making choices in order to include some things in a text, and not others. A writer has to choose the type of words he wants to use, the tone he wants to convey, the characters that he wants to present, etc. The author's main concern is to get an idea across that the audience can understand, while keeping them interested and entertained. In order to do this, it is important that the author tailors his content to a specific type of audience.

2. How does the interaction between a reader and a text create meaning?

When an author finishes a text, he is only aware of what the text appears like to him. However, this is not enough. The text also needs to be understandable and entertaining to a greater audience. When the reader interacts with the text, some aspects of it will resonate with him, while some others will appear to be superfluous or boring. As the reader reads, he interprets the text in a way that is slightly different to that of the author. Through this process, new meanings in the text can be found.

3. What does it mean to be a stranger in a village?

In "Stranger in the Village," James Baldwin describes his experiences in a Swiss village. He tells us that, when he arrived to the village, he was regarded with interest. People had never seen a person of colour before, and they were intrigued. Even as he spent more time in the village, and even after he came back a second time, people still saw him with interest, suspicion, confusion or curiosity. He was never allowed to exist as just another person in the village. Baldwin refers to himself as a "stranger in a village" because the interactions he had with people always kept him as an outsider, and not as just another member of the community.

What is that same disorder called today?

Answers

Answer:

Explanation:

caronavirus

Can someone help me write an essay about *the pros and cons of team sports* (only 1 paragraph) PLEASE HELP ME ASAP

Answers

Answer:

Take this list and translate into paragraph form:

Sports are very important in US culture. Starting as young as 3 years old, US children play football, soccer, gymanastics. But what are the pro and cons of team sport participation?...

Pro

Teaches kids to work with others

Helps improve cardiovascular conditioning and strength

Helps kids to form friendships

Cons

Possibility of injury

Stress related to competition

Explanation:

Just a few thoughts.

Name four of the seven inductees into the Rock and Roll Hall of Fame in 1995

Answers

Answer:Janis Joplin , Al Green, Led Zeppelin, Th Allman Brothers

Explanation:

How does Ernestina interact with her brother Carlos?
O They make dinner together.
O They debate digital quality.
O They look for another library.
O They talk about finding books.

Answers

Answer:

O They talk about finding books

Explanation:

Compare and contrast the BFG with the rest of the giants

Answers

Answer:

The BFG is unlike other giants and believes that giants should not eat humans. He has formed a close friendship with Sophie and wants to help her because he does not want her, or others like her, to get hurt. His affection for humans has only intensified since becoming friends with Sophie.Jul 22, 2020

Explanation:

Answer:

The correct answer is

Explanation:

The BFG was smaller than the the other giants. While other giants were 80 feet tall, the BFG was only 40 feet tall. While every other giant are humans, the BFG drank a special type of juice called frobscottle that has bubbles that go down. He eats a type of cucumber which tastes very salty and he does not like it. He has made friends with a girl called Sophie and wishes that he is able to transport her back to her home.

Hope this helps....

Have a nice day!!!!

What would be the three adjectives and one article for the sentence Wags left big black muddy footprints on the porch

Answers

Answer:

The answer is

Explanation:

Adjectives: big,black,muddy.

Articles: The.

Hope this helps....

Have a nice day!!!!

What is the author’s objective in giving lectures from the book of Five Lectures on Blindness

Answers

Answer:

The lectures were addressed to individuals who could see to highlight and create awareness on the discrimination and withholding of privileges to the blind.

Explanation:

Written by Kate M. Foley, the book, Five Lectures on Blindness was meant to be read at the summer session of the University of California in 1918. The author who was blind herself but was mentally intelligent and smart had been denied jobs due to her disability. She wrote this book to draw the attention of the public to the discrimination being meted out to blind people.

For example, she talked about a very smart lawyer who when he became blind, was now pitied by his colleagues and would not be offered jobs by clients. She appealed to people with sight to show more empathy to the blind and allow them to do work that they were qualified for.

The objective that the author attempts to serve through the book titled "Five Lectures on Blindness" would be:

To outline and develop awareness regarding the biased behavior towards blind people.

"Five Lectures on Blindness"

The book titled "Five Lectures on Blindness" was authored by Kate M. Foley aims to highlight the idea that the benefits of the blind are being ignored.

The author attempts that there is more awareness about their privileges so that it reaches them directly and no discrimination can be done against them.

The author himself had been intellectual but deprived of opportunities due to her blindness and therefore, she doesn't want this to happen to anyone again.

She wishes that people understand the rights and concerns of such people and display empathy towards them and their needs.

Learn more about "Lectures" here:

brainly.com/question/4338084

Shakespeare and Mueller have different perceptions of how this fictional event might have occurred. In a short response of at least five sentences, describe their different perceptions. Include at least one specific reference to each work in your response.

Answers

Answer:

Shakespeare's Romeo and Juliet's balcony sequence depicts the two unfortunate partners far from each other, of Juliet on her rooftop, and Romeo skulling in the woods behind. In a sense, Shakespeare 's interpretation and representation of this scene reflects the enormous distance between the two, or foretells what was about to follow (the two were not meant to be together).

   Mueller 's interpretation and portrayal of the incident, on the other hand, shows a couple locked in a hug. This intuition indicates that they could have a chance together, or at least have shared a little joy around each other.

Victor Mueller was a painter who portrayed the scene of the play, 'Romeo and Juliet,' by Shakespeare. They both differed in how the same scene was portrayed.

Who are Romeo and Juliet?

Romeo and Juliet are the characters of the play by William Shakespeare. In the play, Romeo is seen on the ground and Juliet on her balcony but the painting of Mueller portrays both of them embraced in the hug.

Mueller's painting shows that they both might have a chance to come together, but the play shows the huge distance between the two leads showing they will not be able to be together.

Therefore, the scene of Romeo and Juliet is portrayed differently by Shakespeare and Mueller.

Learn more about Shakespeare and Mueller here:

https://brainly.com/question/16661416

#SPJ5

What were the arrangements made by Jacob to meet Esau?

Answers

Answer:

The answer I prefer is

Explanation:

The arrangements were, a car to meet Esau. A surprise for him.

Hope this helps....

Have a nice day!!!!

Abel
Jefferson aimed to unite the colonists in writing the Declaration of Independence. How does the structure of the document
support his purpose?
He concludes by stating that representatives from all thirteen colonies support the document.
He concludes by clearly defining each colonist's responsibility in the rebellion.
He concludes by listing all of the colonists' grievances against the king.
He concludes by explaining that rebellion will not work unless all of the colonists join the cause.

Answers

Answer:

A. He concludes by stating that representatives from all thirteen colonies support the document.

Explanation:

A. He concludes by stating that representatives from all thirteen colonies support the document.

Question #3: Make a sentence by adding the correct group of words. _______ while the water boiled. A.Mother, stirring and stirring, B.Mother stirred the rice C.Mother

Answers

Answer:

The answer is B.

Mother stirred the rice while the water boiled.

Careful listening skills include: refraining from interrupting the speaker taking quality notes making an effort to understand maintaining eye contact with the speaker please help me with this

Answers

Answer:

Refraining from interrupting the speaker.

Explanation:

I'd say this or second best- make an effort to understand. Because trying not to interrupt is just what i feel people would appreciate most. Also, when you don't interrupt, they keep talking

Id say listening skills during an exam or class that is include: keeping focus,

Understanding what they are listening to,

remembering what they heard,

Or taking notes if possible

The clear water was like a​

Answers

Answer:

a mirror

Explanation:

if the water is clear one can see this or her refle ction just like a mirror

Answer:

The clear water is like mirror.

Explanation:

The smooth surface of the water makes the reflected waves nice and orderly and at the same angle they came in, which is the same thing a mirror does, it produces the same wave that an object would if there was no water and the object were under the surface, so our eyes interpret it as if there is an object there.

Read the excerpt from Sir Gawain and the Green Knight.This King was staying at Camelot at ChristmastimeWith many fair lords and the most beautiful ladiesAnd the whole high brotherhood of the Round TableIn happy festivity and the high revels of the season.What element of medieval court culture is evident in the excerpt?

Answers

Answer:

the camaraderie of nobles and knights

Explanation:

In the excerpt that was provided in the question, the element was the camaraderie of nobles and knights. Camaraderie refers to the spirit of good friendship and loyalty among members of a specific group. In this excerpt, the King was enjoying the festivities with many loyal members of the high brotherhood which were made up of various nobles and knights.

Answer:

C) the camaraderie of nobles and knights

Explanation:

I took the test

the character sketch of madame sofronie

Answers

Answer:

Madame Sofronie owns the hair shop to which Della sells her hair. She’s described as “large, too white, chilly,” and her manner with Della is brusque and to the point. She wastes no time evaluating Della’s hair and setting a price—twenty dollars. Her manner directly contrasts that of Della and Jim, who value their love and sentiment over material value. For Della, her hair is something special and prized. For Madame Sofronie, her hair is worth the dollar value she can get out of it.

Lord of the Flies: Can someone explain what is happening in these quotes?
“There was another noise to attend to now, a deep grumbling noise, as though the forest itself were angry with him, a somber noise across which the ululations were scribbled excruciatingly as on slate.” (Lord of the Flies, Chapter 12)

“To carry he must speak louder; and this would rouse those striped and inimical creatures from their feasting by the fire.” (Lord of the Flies, Chapter 12)

“Truculently they squared up to each other but kept just out of fighting distance.” (Lord of the Flies, Chapter 11)

“No one doubted that the tribe would be found at the Castle Rock and when they came in sight of it they stopped with one accord.” (Lord of the Flies, Chapter 11)

“An oblong of blackness relieved with brilliant spangles hung before them and there was the hollow sound of surf on the reef. Ralph settled himself for his nightly game of supposing. . .” (Lord of the Flies, Chapter 10)

“Sitting on the tremendous rock in the torrid sun, Roger received this news as an illumination.” (Lord of the Flies, Chapter 10)

“Now a great wind blew the rain sideways, cascading the water from the forest trees.”(Lord of the Flies, Chapter 9)

“Here there were wide spaces interspersed with thickets and huge trees and the trend of the ground led him up as the forest opened.”(Lord of the Flies, Chapter 9)

Answers

Hhhhhhhhhhhhhhhhhhhhhhhhh

What did the Alaskan hunters who discovered Chris’s body think about Chris’s knowledge of animals, and on what evidence did they base this? What was the final outcome of these musings?

Answers

Answer:

The Alaskan hunters who discovered Chris body believed he had little knowledge about animals.

Explanation:

Christopher McCandless lived into the wild by killing small animals like small birds, squirrels, porcupines, and one moose. He gathering mushrooms, roots, and berries.

The moose identified as a caribou, but it was a moose. It showed that Chris was not as unprepared and stupid as everyone thought.

Before he decided to go to Alaska,  he took a rifle, a bag of rice and some necessary tools and utensils with him.

His dead body discovered by moose hunters just outside the northern boundary of Denali National Park. The cause of death officially reported as starvation.

What directly causes the Athenians to hide in their homes? A) the return of spring B) the arrival of the Cretan soldiers C) the arrival of Theseu D) the oppressive rule of King Aegeus

Answers

Answer:

B) the arrival of the Cretan soldiers

Explanation:

Cretan soldiers had the ability to promote fear in the hearts of Athenians who knew the aggressive and destructive military tactics that Cretans possessed, in addition to their thirst for victories against the populations they were fighting. Fearing scenarios of violence and the insecurity that settled in Athens, after the arrival of soldiers from Crete, the Athenians hid in their homes, to protect themselves.

What type of text structure is used in this subtitle here. Choices are: narration, description, compare and contrast, cause and effect, classification and division, definition, exemplification, and process.

Answers

Answer:

definition

Explanation:

The text above presents a structure called "description". This can be determined because the text seeks to describe the situation of captive tigers in the country, addressing how these tigers are classified, the characteristics that keep them away from tigers in freedom, in addition to describing where they are, how they are raised and the body responsible for them. In this type of text, the author has the objective of transmitting the observations he has on a certain subject, this objective was fully achieved in the text above.



HELPPPPP RIGHT NOW!

Which excerpt from the story best supports the conclusion that
the narrator has strong problem-solving skills?
I realized the answer was simple Reporter 101:
Who? What? Where? When? Why? and How?"
"I learned a great deal from him about how to cover a
O story well, how to handle my sources, and how to
make a boring story seem interesting."
"Here I was on my first day as an inexperienced
O reporter having to cover an important story with little
guidance."
"... I learned so much about what goes into keeping
O a school's doors open and all the work that goes into
offering students a solid education."

Answers

Answer:

"Here I was on my first day as an inexperienced reporter having to cover an important story with little guidance."

Explanation:

this shows the reporter did not have the materials needed for their job. however, as they continue the narrative, it is clear that they solved this problem and covered the important story.

Answer:   “ . . . I realized the answer was simple Reporter 101: Who? What? Where? When? Why? and How?”

Explanation:

Please make 6 Sentences using

So..... That
Such.... That

Answers

Answer: so that

It was so windy that we couldn't go sailing.

My sister is so shy that she hides behind my mother when there are strangers around.

The dress was so wonderfully designed that I couldn't take my eyes off it.

Answer: such that

It's such a great movie that I've watched it several times.

She is such a charming woman that everybody stares at her.

Hawaii has such amazing beaches that everyone wants to live there.

Plsss mark as brainliest

What are the semicolons doing in this sentence

Answers

Answer: they help to make a list or help to make the sentence make more sense by bringing two alike sentences together.

Explanation:

in this sentence, "It was raining; Mira couldn't play football" has a semi-colon. semi colons act as a sentence holder to bring them together instead of using a full stop. it will get you better grades when writing an essay or a story. hope this helps. :)

Can someone tell me what a documentary essay is and how long it has to be

Answers

Explanation:

A documentary essay is an essay on a true life story of a thing that exists or existed. Forexample, a documentary essay on rhinos or gators or dinosaurs

It is like a documentary written as an essay

It could be about 250 words but it should contain interesting, interesting facts and some fantasies

Other Questions
Last Sunday, the average temperature was 8\%8%8, percent higher than the average temperature two Sundays ago. The average temperature two Sundays ago was TTT degrees Celsius. Which of the following expressions could represent the average temperature last Sunday? Find an equation of the plane through the point(1, 5,-1) and perpendicular to the vector (1, 5, 1). Do this problem in the standard way. Solve for x: 2(10-2x) = 4(3x + 1). Write your answer as a fraction. can u help me ASAP. i need to know how to do it step by step the formula s= I dont know how to type that but I really need helppppp Pasteur's experiments proved that ________. Pasteur's experiments proved that ________. spontaneous generation can only occur if nutrient broth is left open to the environment cells cannot survive in swan-necked flasks preexisting cells present in the air can grow in sterilized nutrient broth sterilizing nutrient broth prevents spontaneous generation in order to grow, cells need to be supplied with oxygen please help !!!!! please note that two images are there................ i am urgently needs this question On a plane trip, baggage over 40 pounds ischarged at the rate per pound of 1% of the one-way fare. The charge for a bag weighing 52pounds on a trip where the one-way fare is $98is:HELP PLEASEE!! QUICK!! When the hydraulic conductivity Ks = 10 mm/hr; effective matrix potential Ns = 20 mm, and rainfall intensity I = 30 mm/hr , determine the amount of runoff generated when the runoff rate reaches 15 mm/hr?( 2.7 mm or 0.21 mm or 18 mm or 0.67 mm) PLS HELP ASAP Solve the inequality and enter your solution as an inequality in the box below 8>4-x>6 difference between photosynthesis and respiration In a survey of adults in a certain country conducted during a period of economic uncertainty, % thought that wages paid to workers in industry were too low. The margin of error was percentage points with % confidence. For parts (a) through (d) below, which represent a reasonable interpretation of the survey results? For those that are not reasonable, explain the flaw. how many are 2 raised to 2 ??? Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG This rectangular patio is tiled using 50 cm by 50 cm square tiles. How many tiles are used? Imagine that you are the supply chain manager for the Magic Widget company and you need to measure your supply chain performance. The chart shows the financial variables that you will need to perform your task. Financial Variables Total Assets (in $ billions) 15.1 Cost of Goods Sold (in $ billions) 14.3 Inventory: Raw Material Inventory (in $ billions) 0.76 Work-in-progress Inventory (in $ billions) 0.12 Finished Goods Inventory (in $ billions) 0.82 Compute the percentage of assets committed to inventory and inventory turnover. What is the quotient of 35,423 15? The plateau phase of population growth is best described as: A. The population stops growing because they moved into the plateau environment at this stage. B. The population pauses in its growth after a natural disaster before growing again. C. The population moves onto a large, raised, flat area called a plateau for protection from predator. D. The population stops growing because the environment has reached its carrying capacity. The Coriolis effect Choose one: A. causes north-flowing currents in the northern hemisphere to curve to the west. B. causes the same direction of deflection in the northern and southern hemispheres. C. is a deflection of wind or water flowing over the Earth's surface. D. is a phenomenon created by the movement of ocean currents. Light passes through a single slit. If the width of the slit is reduced, what happens to the width of the central bright fringe