22 and 21 please help no links or i report

22 And 21 Please Help No Links Or I Report

Answers

Answer 1

Answer:

21) B. (5,45)

22) B. As the temperature decreases, hot chocolate sales increase.


Related Questions

please please help me
(the number in the photo is 20 and then the letter is x)

(also if you can pls go to my profile and answer the question underneath this one)

Answers

Answer:

20°

Step-by-step explanation:

for alternate angles

Answer:

angle x= 20°

I hope it's helps you

If Sally's school is 2.5 km long. How many meters long is Sally's school?

Answers

Answer:

2500 m long

Step-by-step explanation:

Answer:

2,500 meters

Step-by-step explanation:

There are 1000 meters in a kilo meter so just multiply 2.5 x 1000

What is the approximate value of
3

35
?

Answers

Answer:

17.7

Step-by-step explanation:

Use a calculator.  Enter 3 and then √35.  The calculator should return

17.748.  Round this off to 17.7.

Answer:

17. 7 is the answer.

Step-by-step explanation:

#CarryOnLearning

what is 22% of 64.82

Answers

Answer:

14.2604

Step-by-step explanation:

this is because 22% as a decimal would be 0.22, and since this is out of 64.82, you have to multiply 0.22 by 68.82

\\

Hope this helps <33

Answer:

14.2604

Step-by-step explanation:

[tex]64.82*.22=14.2604[/tex]

Determine whether the three side lengths form a triangle. 3,5,7

Answers

Yes. Because the sum of the two small numbers are bigger than the longest side.

3+5 >7

What’s the answer ? Please help

Answers

Answer:

C.

Step-by-step explanation:

f(x) = 3 and g(x) = -2x + 5
Find f(x) * g(x)

Answers

Answer: -6x + 15

Step-by-step explanation:

f (x) = 3

g (x) = -2x + 5

3 (-2x+5)

= -6x +15


I have found the area but I'm not sure how to find the perimeter.

Answers

Answer:

20+20+24+24=88

88/2=44

88+44=132

Step-by-step explanation:

If you split it so there is a rectangle and a triangle, you find the perimeter of the rectangle then divide it in half.

(-x+3) - (x-5) ,.................,.,.,.,.,.,.,.,.......,.,.,.,..

Answers

Answer:

-2x+8

Step-by-step explanation:

(-x+3)-(x-5)

= -x+3-x+5

= -2x+8

Maggie has exactly 20$ to buy decorations for the dance. Streamers cost 2$ per roll and balloons are 1.50$ per package. Which set of purchases is closest to her budget??

Answers

Answer:

675esa  espuesatr

Step-by-step explanation:

Vincent has a box of popsicles. There are 12 cherry, grape 10 orange, and 6 blue raspberry If he reaches in the box and pulls one out at random, what the probability it will be blue raspberry?

Answers

Answer:

6:28 or 3:14

Step-by-step explanation:

if you add all the flavor amounts up, which is 12 + 10 + 6, you get 28. 6 of those 28 popsicles are blue raspberry, so the ratio is 6:28. if it needs to be simplified, its 3:14 because 6/2 is 3 and 28/2 is 14

Answer:

6:28 if you add all Popsicles it gives you 28,so the probability that he will pick raspberry are 6 ,so if you simplyfy further its 3:14

What is the slope of the line?
hurryyyy

Answers

Answer:

slope = 3

Step-by-step explanation:

if each square is equal to 1

The slope has to be 3.

you can see it, because between those 2 point you can count 3 spaces in y-vertex, and 1 space in x-vertex

what that means is that we will move 3 steps up (or down) for each 1 space in x-vertex.

you can see it just right there on the graph

Pls answer this I will give 10 points and brainlest for 4 to 6 answers

Answers

Answer:

wheres the question

Step-by-step explanation:

Please please help this is algebra:(

Answers

Answer:
X1=2,x2=6
Instructions:
Make sure you put the 1 and 2 underneath the x’s

Triangle ABC is similar to triangle WYZ.

Determine whether the following statement is true or false.

sin(B)>sin(Y)

True
False

Answers

9514 1404 393

Answer:

  False

Step-by-step explanation:

Corresponding angles in similar triangles are congruent. The similarity statement tells you angle B corresponds to angle Y, so those angles are congruent. The sines of congruent angles are identical.

  sin(B) > sin(Y) . . . . FALSE

  sin(B) = sin(Y) . . . . true

Answer:

The answer is true.

Step-by-step explanation:

Factor out the Greatest Common Factor (GCF): 36y - 16 ?

Answers

Answer: 4(9y-4)

Step-by-step explanation:

36y - 16

4 x 9 is 36

4(9 is just like 36y.

A line with a slope of 5 passes through the point (1,9). What is its equation in slope-intercept form? Write your answer using integers, proper fractions, and improper fractions in simplest form.​

Answers

Answer:

y = 5x + 4

Step-by-step explanation:

The equation of a line in slope- intercept form is

y = mx + c ( m is the slope and c the y- intercept )

Here m = 5, then

y = 5x + c ← is the partial equation

To find c substitute (1, 9) into the partial equation

9 = 5 + c ⇒ c = 9 - 5 = 4

y = 5x + 4 ← equation of line

un refresco tiene una concentración de 3.8 x 10-4 de iones H+. determina el valor de PH de ese refresco​

Answers

Answer:

El pH del refresco es 3.42.

Step-by-step explanation:

Se puede calcular el pH del refresco usando la siguiente fórmula:

[tex]pH = -log([H^{+}])[/tex]

En donde:

[H⁺]: es la cocentración de los iones H⁺ de la solución

Entonces, el pH es:

[tex]pH = -log([H^{+}]) = -log(3.8\cdot 10^{-4}) = 3.42[/tex]

El resutlado obtenido nos permite concluir que ese refresco es ácido.

Por lo tanto, el pH del refresco es 3.42.

Espero que te sea de utilidad!

Usando su fórmula, se encuentra que el valor de PH de ese refresco​ es dado por 3.42.

Cual es la fórmula para el valor de PH?

Es dada por:

[tex]pH = -\log{H^{+}}[/tex]

Onde [tex]H^+[/tex] es la concentración.

En este problema, hay que la concentración es de [tex]H^+ = 3.8 \times 10^{-4}[/tex], por eso:

[tex]pH = -\log{H^{+}}[/tex]

[tex]pH = -\log{3.8 \times 10^{-4}}[/tex]

[tex]pH = 3.42[/tex]

El valor de PH de ese refresco​ es dado por 3.42.

Puede-se aprender mas sobre el valor de PH en https://brainly.com/question/16146414

What is the answer for, A metal bar 8.15 ounces 93% of the bar is sliver. How many ounces of silver are in the bar? ( round to the nearest thousandth)?

Answers

Answer:

7.580 ounces

Step-by-step explanation:

The question is asking how many ounces of silver are in the bar. We know that 93% of the bar is silver. The bar is 8.15 ounces. This means we need to find 93% of 8.15. Let's set up an equation.

93% of 8.15

93/100 • 8.15

0.93 • 8.15

= 7.5795

Round to the nearest thousandth.

7.580 ounces

Hope this helps!

((−34)5)2 help me I'm confused AAAAAAAAAAAAAAAAAAAA

Answers

Answer:

340

Step-by-step explanation:

((-34)5)2

(-170)2

340

please i really need help. dont spam i just really need help

Answers

Answer:

440 square miles would be the answer :)

Step-by-step explanation:

Which of these can not form a perpendicular bisector?
O A. a line segment
O B. a circle
O C. a pair of parallel lines
O D. a right triangle

Answers

B. Is the correct answer. A circle can not form a perpendicular bisector as it is rounded and not straight.

The solution is : Second option is correct. O B. a circle, can not form a perpendicular bisector.

What is circle?

A circle is a closed two-dimensional figure in which the set of all the points in the plane is equidistant from a given point called “centre”. The perimeter around the circle is known as the circumference.

here, we have,

Since we know that to form perpendicular bisector .

We need atleast two lines which form right angle.

So, right triangle can form perpendicular bisector with base and height.

Parallel lines can also form perpendicular bisector if a line is drawn from mid point of one line to mid point of another line.

A line segment can form perpendicular bisector.

But circle can't as it is curved shape it needs line to make perpendicular bisector.

Hence, Second option is correct. O B. a circle, can not form a perpendicular bisector.

Learn more about circle here:

brainly.com/question/11833983

#SPJ5

Please help so I don’t fail this class

What is the measure of the reference angle for a -287° angle

Answers

The measure of the reference angle for a -287° angle is 17°.

To measure of the reference angle for a -287° angle

1. Determine the quadrant: First, we need to identify the quadrant in which the angle -287° lies.

  - In the standard coordinate plane, angles between 0° and 90° are in the first quadrant, between 90° and 180° are in the second quadrant, between 180° and 270° are in the third quadrant, and between 270° and 360° are in the fourth quadrant.

  - Since -287° falls in the third quadrant, we know that the reference angle will be found in the first quadrant.

2. Find the corresponding acute angle: To find the reference angle, we need to find the acute angle that has the same trigonometric values as the given angle.

  - To do this, we can add 360° to the given angle (-287° + 360° = 73°). This gives us an equivalent positive angle in the same position.

3. Determine the reference angle: Now that we have the positive equivalent angle (73°), we can find the reference angle by subtracting it from 90° (90° - 73° = 17°).

Therefore, the measure of the reference angle for a -287° angle is 17°.

For more Questions on reference angle

https://brainly.com/question/16884420

#SPJ8

I REALLY NEED HELP!!! what is the answer to this one?

Answers

I think the answer is A. I will check if it is wrong

The cost for the raw materials of marble countertops, can be represented by the function , where is the area of the countertops. The retail markup, can be represented by the function. Which function can be used to find the marked-up price of a marble countertop depending on the area?

Answers

Answer:

[tex]m(c(a)) = 4.8875a[/tex]

Step-by-step explanation:

The missing parameters are:

[tex]c(a) = 4.25a[/tex] --- Cost of marble countertops

[tex]m(c) = 1.15c[/tex] --- Cost of retail markup

Required

The cost of marked up price

This implies that we calculate m(c(a))

We have:

[tex]c(a) = 4.25a[/tex]

[tex]m(c) = 1.15c[/tex]

[tex]m(c) = 1.15c[/tex] can be written as:

[tex]m(c(a)) = 1.15*c(a)[/tex]

Substitute: [tex]c(a) = 4.25a[/tex]

[tex]m(c(a)) = 1.15*4.25a[/tex]

[tex]m(c(a)) = 4.8875a[/tex]

Hence, the cost of marked up price is: [tex]m(c(a)) = 4.8875a[/tex]

PLEASE HELP!! ILL MARK BRAINLYEST!!


Which type of graph would you choose to show the number of home runs hit by each player compared to the team total?

A. histogram
B. bar graph
C. circle graph
D. line graph

Answers

Answer:

Bar graph

Step-by-step explanation:

if it helps don't forget to like and mark me down

Answer:

Bar Graph

Step-by-step explanation:

What is the circumstances if the diameter is 68ft

Answers

C= 213.63
C=2• 3.14(pie)•r(radius)

Answer:

Step-by-step explanation:

diameter = 68ft

Radius = 34ft (68/2)

Circumference =213.6283 (68 x pi)

((No links allowed))!~Brainliest IF YOU CAN SIMPLIFY AND SOLVE FOR THE UNKNOWN~!(3 + 5)² + [8 - 11] + Z = 4(Z - 2)

Answers

Z=23

Hope this helps!

Answer:

z=25

Step-by-step explanation:

(3+5)^2+[8-11]+z=4(z-2)

(8)^2 +3+z=4z-8

square 8

add 8 to both sides

mines z from both sides

64+3+8=3z

75=3z

25=z

Evaluate. 5! - 4! = [1]

May any math experts please help thank you

Answers

Answer:

116=1

Step-by-step explanation:

I hope this helps you!

!!!! HELP PLEASE !!!!!

Answers

Answer:

C)  x² + 2x - 6

Step-by-step explanation:

add 2x +1 to x² - 7

Other Questions
A water pipe has a flow of 2 gallons per minute how many 2 qt could fill it in 1/2 hour? April ought some sports drinks and slices of pizza for her friends. She bought 3 more sports drinks than slices of pizza. If her total was $21.25, how many sports drinks did she purchase? (1 sports drink is $1.75, one pizza slice is $2.75){System of Operations} La oracin que representa un smil es: A. . Cerca del Tajo, en soledad amena, B. . Si no regresas pronto a mi lado, morir desangrado C. Los invisibles tomos del aire D. Eres como el viento tibio de los arenale What river connects the Great Lakes to the Atlantic Ocean? PLEASE HELP WILL GIVE BRAINLIEST!! Please please only answer if you know or can help!! I need help know if what i already put is correct or how i can fix it and also the answer to question E. THANK YOU! What is correct regarding trans fatty acids hi can you please help me with my work Add the two functions. f(x) = 3x3 + 7x 26 g(x) = x + 2 Please help! Thank you! HELP mE need math help 20 points no links or imma report HeLP mE Find the area of the white region in the diagram shown. what is the mRNA in TACCGGATGCCAGATCAAATC? a cup of coffee is left to cool inside a room and its cooling can be described by the function y = 85(.75)x/5 + 15 where x is time in minutes and t is the temperature of the coffee in degrees celsius. The height of a cylinder is 8 centimeters. The circumference of the base of the cylinder is 20 centimeters. Which measurement is closest to the volume of the cylinder in cubic centimeters? Help!!! I do not seem to understand this problem well. Dr. Seals borrows $15,000 to remodel her backyard. The interest rate is 3%. The interest is compounded twice a year for two years. HELP! Ill mark you brainliest! Find the area of the irregular figure. who tryna be my babymomma? 4) To drink something all at onceA) To down itB) Take a shotC) To out itD) To swallow it Why would an investor want to choose a certificate of deposit over a corporate bond