40 points please help I don't know what it is

40 Points Please Help I Don't Know What It Is

Answers

Answer 1

That would be C: Personal preferences about food should stay personal and not be inflicted on animals

(that one dude who reported everything somehow got my answer removed, but I still hope this helps ^^)


Related Questions

In the above excerpt Welly is using what literary device?


Answers

where is the picture to show what I’m supposed to be answering

Why are the farm animals meeting late in the evening? Animal Farm Chapter 1.

Answers

Answer:

The animals greet Major’s vision with great enthusiasm. When he dies only three nights after the meeting so they wanted to free themselves

Explanation:

Answer:

Old Major says he has a vision and tells them to meet up late in the evening, so they wouldn't disturb Mr. Jones.

Explanation:

how does a search engine complete online work​

Answers

Explanation:

[tex]\huge{\underbrace{\overbrace{\mathfrak{\pink{answer❣:}}}}}[/tex]

Search engines work by crawling hundreds of billions of pages using their own web crawlers. These web crawlers are commonly referred to as search engine bots or spiders. A search engine navigates the web by downloading web pages and following links on these pages to discover new pages that have been made available

Which detail from The Golem best foreshadows that the Golem may not correctly follow Pearl’s orders?
PEARL
Are you the only one who can command him? RABBI LOW
I don’t know.
PEARL
You’ve taught him tricks? RABBI LOW
Well, I didn’t think of it that way, but I had to make sure he would listen to my commands.
RABBI LOW
Please Pearl, dear Pearl. There’s nothing to worry about.
PEARL
That thing . . . what is it?
PEARL
A mound of clay? Alive? RABBI LOW
I’ll show you. Golem: Come here.

Answers

Answer:

The answer is D on edge

Explanation:

PEARL

A mound of clay? Alive? RABBI LOW

I’ll show you. Golem: Come here.

The detail that best foreshadows the Golem may not correctly follow Pearl’s orders is a mound of clay? Alive? RABBI LOW I’ll show you. Golem: Come here. So, it's D.

What do you mean by Foreshadows?

Foreshadows may be defined as a situation of giving a warning or any sense of indication related to specific events.

Therefore, the correct option for this question is D.

To learn more about Foreshadows, refer to the link:

https://brainly.com/question/96170

#SPJ2

What mode of persuasion does Antony use when he says, "Then make a ring around the corpse of Caesar, and let me show you him that made the will"?


a

Ethos because he’s uniting with his audience to surround Caesar’s body.


b

Pathos because he’s going to show the people how much Caesar loved them.


c

Logos because he will read facts from the will to the people.

Answers

Answer:

a. Ethos because he’s uniting with his audience to surround Caesar’s body.

Explanation:

We can say that Antony made full use of ethos, which reinforces the sense of ethics in a speech. This is because in calling the people to gather around the body of Caesar, he joins the people and asks them to see for themselves, without intermediaries, the man they are causing death, but who made a beneficial will and advantageous.

under line the examples of "conduction"
"heater blowing warm air"
"putting your hand on a hot car"
"steam rising from a coffee mug"
"spoon heating in a soup bowl"
"standing by a fire"
"cooking pancakes in a pan"

Answers

Answer:

putting your hand on a hot car

spoon heating.....

cooking pan cakes....

Explanation:

in conduction heat transfer when surfaces are in contact

Answer:

spoon heating in a soup bowl

To avoid the possibility of
plagiarism as you gather
information,
A. document your sources, and then summarize
and paraphrase the information as you take
notes.
B. write everything down word for word.
C. only write down very ironic ideas and no
dates.
D. don't worry about writing down where you
got your information from.

Answers

Answer:

A

Explanation:

You have to document every source you use to avoid plagiarism. You also need to summarize, never write word for word except in quotation marks with intext citations

What is the following an example of?
Fran Cole, Climbing Mount Hope, 2017, pages 22-40


A. An effective source


B. A research question


C. Plagiarism

D. Bibliographic information

Answers

Answer: D. Bibliographic information

Explanation:

The Bibliography includes the list of the references that were used in the preparation of the academic writing it is in.

The details in a bibliography are written in different formats based on the citation style used such as APA or MLA and the type of work it is. Generally speaking however, it will include the name of the author, their work, the date published and page number just like the text above.

Write a short paragraph that explains the central idea of the article

Answers

Answer:

you down bad if you think someone about to write a paragraph for you

Explanation:

lol

Answer:

Ah yes, the article

Explanation:

Central idea of "The Fish I Didn't Catch"

Answers

Answer:

The meaning of the word trifles helps us to understand the little value grow up people give to the feelings of children. Its meaning get clearer when seeing the comparison to the importance is given to the feelings of grow up people. Although, In the Fish I didn’t Catch, written by John Greenleaf Whittier in 1843, the tone seems different. The narrator regrets that fact of not giving much importance to the feelings of children, because when adults pay attention to them children grow more aware of the world and how things really happen. That is the precise meaning of the Fish I didn’t Catch, that lesson taught him since he was a kid, not to boast before something is done. He thanked his uncle for paying attention to his feelings because that helped him grow.

Explanation:

I hope that this helps u, I kinda just looked it up tho..

Read the excerpt from The Land, Part 4. "I'm not going to have that, you understand? That's all I'm going to say about it, so you mind my words." That said, my daddy walked off from me. I watched him go. I knew my daddy meant what he said, but I didn't heed his words Based on this excerpt, which is a reasonable prediction?

Answers

Read the excerpt from The Land. Part 4

"I'm not going to have that, you understand? That's all I'm going to say about it, so you mind my words."

That said, my daddy walked off from me. I watched him go. I knew my daddy meant what he said, but I didn't heed his words.

Based on this excerpt, which is a reasonable prediction?

A) Paul will ask his father about Sutcliffe's horses

again

B) Paul will change his father's mind about Sutcliffe's

horses

C) Paul will ride Sutcliffe's horses in the future,

D) Paul will refuse to ride any of Sutcliffe's horses

Answer:

C) Paul will ride Sutcliffe's horses in the future,

Explanation:

According to the given excerpt, there is a dialogue between Paul and his father and which they had a disagreement. The dialogue ends as Paul says he knows his dad meant what he says but he won't heed his words.

Therefore, from the excerpt, a reasonable prediction is that Paul will ride Sutcliffe's horses in the future,

Answer:

It is C

Explanation:

Vivian's project manager has asked her to analyze the project requirements before finalizing them. What should she look for and address during her analysis?

Answers

Answer:

It should seek to address duplicate information and inconsistent data and elements, as well as looking for any defective elements in the design.

Explanation:

The main objective of Vivian's analysis is to find and remove possible errors and inconsistencies from the project. This includes removing duplicate, irrelevant, inconsistent, off-topic, incorrect information and any other type of poorly worded information. Thus, it makes the project more consistent, objective and efficient.

What figurative language is used in the sentence below? What does it create?

“The perfume that Shelly had on was making me dizzy. It smelled like a bag of tangerines.”

Answers

Answer:

Similie!!

Explanation:

Similies use "like" or "as" to compare two things that are NOT alike.

Hope this helps!! :D

Using the sentence context, determine the meaning of the word "copious" in the following example.
Given that Arturo has read more than 23 books about volcanoes, his knowledge about the eruption of Mount
Vesuvius is copious.
abundant
limited
impressive

Answers

The answer is limited.
Copious means to be full or abundant. Arturo has enough knowledge about volcanoes which helps him know more about the mount Vesuvius eruption. Looking at our choices, we can cross limited out. He knows a lot and can go further more if he wanted to, so the answer is abundant.

The Crucible: Act IV

What happens to the following characters after the witch hunt madness ended?

Elizabeth Proctor:


Reverend Parris:


Abigail Williams:

Answers

Oh yeah sweetie I’m just a weirdo and I’m sorry

meaning o percepitble

Answers

Answer:

Explanation:

capable of being perceived especially by the senses a perceptible change in her tone a barely perceptible light

mark brainliest

Read the excerpt from The Monsters Are Due on Maple Street.

52. CLOSE SHOT – GOODMAN 52.

As he instinctively backs away.

GOODMAN

She's crazy. Look I can explain that. Please . . . I can really explain that . . . she's making it up anyway.

(then he shouts,)

I tell you she's making it up!

Now he takes a step toward the crowd and they back away from him. He walks down the steps after them and they continue to back away. Now he's suddenly and completely left alone and he looks like a man caught in the middle of a menacing circle as we take a

SLOW FADE TO BLACK:

Based on the clues in this excerpt, what will most likely happen next?

The neighbors will become suspicious of Woman One.
The neighbors will apologize to Goodman and leave.
The neighbors will get their electricity back.
The neighbors will remain suspicious of Goodman.

Answers

Answer:

d edge 2021

Explanation:

100%

Answer:

d edge test

Explanation:

Make the following sentence in the ACTIVE VOICE.
1. The quiz was planed for Friday by the teacher.

Answers

Answer:

The Teacher planned a quiz for Friday.

Explanation:

The quiz was planned for Friday by the teacher.

The Teacher planned a quiz for Friday.

Posted a picture for extra help.

Use the expression 15×3+7(4+1)−52.

Answers

Answer:

21

Explanation:

What does King Lear’s question suggest about his personality?

Answers

In spite of his despair and self-pity, Lear is revealed as a complex man, one whose punishment far exceeds his foolish errors, and thus, Lear is deserving of the audience's sympathy. Eventually, Lear displays regret, remorse, empathy, and compassion for the poor, a population that Lear has not noticed before.

Part A

What is a central idea in the Newsela article "Washed-Up Plastics Become Art with a Vital Message"?

Many people now look for trash to pick up when they are visiting the beach.
Creating artwork can be both beautiful and horrifying.
Children enjoy the art displays of sea creatures.
Increased awareness of the dangers of ocean pollution are creating interest in Pozzi's art.

Question 2

Part B

Which detail from the text best conveys the answer in Part A?

"She now has more than 70 pieces in three exhibitions currently traveling throughout the United States. She also has requests from overseas."
"'It's the only thing he's liked all day,' his grandmother said."
"An army of about 10,000 volunteers in Oregon help her collect, prepare and assemble the beach trash into art."
"All of the art is made from plastic trash that washed ashore, including a great white shark…"

Answers

Answer:

A. Art can be used to send a message about environmental awareness.

B. "She wants people to then take action based on that knowledge. Signs next to each art piece suggest simple ways to reduce the problem."

Explanation: on the quiz

Answer:

the answer is c

Explanation:

i took the test

How have women redefined
traditional gender norms and
demonstrated their strength in
modern society?

Answers

Answer:

Many ways!

Explanation:

For example, we won our Suffrage (right to vote) in 1920, showing that we deserve to have our voices heard. We also have transitioned from being a typical "Mother at home housewife" to becoming the main source of income for the family and having a job. Women no longer have to be the main parent to take care of the children and house, as we have shown we are capable of owning major corporations and businesses. Women rock!

What does the word goaded mean

Answers

Answer:

To goad someone or something is to annoy, provoke encourage or force them or it to do something.

help!
Why is the following sentence an example of personification? “The ocean waves
danced along the beach and tickled the sand.”
help!

Answers

Answer:

It is personification because it is giving an inanimate object (ocean waves) a human characteristic (danced).

Explanation:

Please, gimme brainliest. Please. I hope this helps.

To what degree, if any, are we in control of our own lives? Please help me i give out brainlest

Answers

Answer:

God is

Explanation:

Answer: we have control over pretty much anything

Explanation:

We have control over our own choices, our own selves, and yes, over how we live our life. Sorry if this doesn't help

"Who killed the chicken?" the passive form of the sentence is ................... ? *

1. Who the chicken was killed.
2 .By whom did the chicken killed
3. Who did the chickenkilled
4. Who was the chicken killed by

Answers

Answer and Explanation:

4. Who was the chicken killed by..

What was the first presidents name ?

Answers

Answer:

Dr. Ram Baran Yadav was elected as the first President of the Republic of Nepal by the Constituent Assembly which served concurrently as Parliament

How does the speaker structure this part of the argument? Match each sentence to what it accomplishes. Match Term Definition Picture this: It's Spring Break, and you fly off to some country where there's lush rainforests and beautiful, blue coastlines to explore. A) State the claim of the argument There's also people in need, so you decide to blend your vacation with volunteering. B) Recognize the counterclaim Volunteering as a tourist, or voluntourism, seems like a great way to explore new regions and help people at the same time. C) Establish a problem with the counterclaim However, this D) Get the audience's attention While many teens might view traveling and volunteering abroad as a worthwhile adventure, there are more genuine and effective ways to make a difference. E) Establish the topic

Answers

Answer:

Picture this: E

There’s also people: A

Volunteering as a tourist: D

However, this: B

While many teens might view : C

Explanation:

The speaker's structuring of the text has been indicated below:

D. Get the audience's attention: Picture this: It's Spring Break, and you fly off to some country where there's lush rainforests and beautiful, blue coastlines to explore.

E. Establish the topic:  There's also people in need, so you decide to blend your vacation with volunteering.

A) State the claim: Volunteering as a tourist, or voluntourism seems like a great way to explore new regions and help people at the same time.

B) Recognize the counterclaim: However, this

C) Establish a problem with the counterclaim: While many teens might view traveling and volunteering abroad as a worthwhile adventure, there are more genuine and effective ways to make a difference.

What is a text structure?

Text structure refers to the manner of arranging the flow of ideas in a text.

The speaker in this argument began by getting the audience's attention, establishing a topic, stating a claim, and addressing a counterclaim.

Learn more about text structure here:

https://brainly.com/question/12053427

What is the best way to revise the sentence?
The book Sara is reading is very interesting, and it is
interesting because it is a graphic novel.
A. The book Sara is reading is very interesting
because it is a graphic novel.
B. The book Sara is reading is very interesting it is
also a graphic novel.
C. Very interesting because it is a graphic novel,
Sara is reading the book.
D. No change is needed.

Answers

Answer:

A.

Explanation:

This seems like the best one just based on the other options.


Help plz

Essay

Setting Goals

Project: SMART Goal

Answers

Answer:

What is this about

Explanation:

Other Questions
3) What type of government did the Aztecs have? *A.One kingB. Prime MinisterC.PriestsD. Decentralized government made up of city states, each with their own kingsqueens what is 1256x - 14x + 16x simplified Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) list the difference between sdram and dram What is 2/5 divided 1/3 Kaden, Keith, and Kipp compete in a series of daily 3-way races. For each race, the probability that Kaden wins is 1/6, the probability that Keith wins is 1/2, and the probability that Kipp wins is 1/3. On a day that Kaden doesn't win, what is the probability that Keith beats Kipp? a file that serves as a starting point for a new document Solve for n.(33)^2 = n^6 A biologist is recording the loss of fish in a pond. He notes the number of fish, f, in the pond on June 1. On July 1 there were 63 fish in the pond, which is 52 fewer fish than were in the pond on June 1. What is the number of fish in the pond on June 1?Which equation can be used to find the number of fish in the pond on June 1?63f=52f52=63f52=63f63=52 i need help!!!!!!!!! Which expression is equivalent to 8(5-2a)? Your friend says that enough information is giving to prove that x=12. Is your friend correct? All of the following represent the same function except _____.y = x - 1{(0, 1), (2, 3), (4, 5), (7, 8)}x y1 03 25 48 7 If UW = 9x -9, what is UW in units? Why are the Rocky Mountains larger than the Appalachian Mountains? Ava bought 2 1/4 pounds of ham for $7.65 at ShopRite last week. This week she bought 3 1/2 pounds of the same ham for $12.60 at Stop & Shop. Which store has the better price per pound for ham? How much less expensive is the ham at the store with the better price? what is the worst anime to watch and why is the worst advocated justice for American Indiansmet personally with American Indian leaders promoted trade agreements with the various tribesencouraged American Indians to adopt European agricultural methods advocated punishment for people who violated American Indian rights.Which of the following best describes the information in the text box?OA.William Penn's attempts to persuade American Indians to adopt a new religion.OB. Andrew Jackson's attempts to convince American Indians to give up their land.OC.Thomas Jefferson's attempts to integrate American Indians into white society.D. George Washington's attempts to create an effective American Indian policy. 33) What value for x makes this equation true? 4x + 3 = 23 What is the definition of climate?1) An area's long term weather pattern2)When large air masses of different density, moisture, and temperature mee3)The state of the atmosphere at a given place and time4)Large volume of air that has similar characteristics of temperature and watervapor content