7
x 16
00
What is the correct answer for this problem?

Answers

Answer 1

Answer:

11200

Step-by-step explanation:

is that right


Related Questions

What is the mean of the data set?

Fifth Grade Jump Distance
2 0
3 2 4 6
4 0 2 4 8
5 5
6 5
2 0 = 20 inches
42
40
45
20

Answers

Answer:

42

Step-by-step explanation:

Add all the numbers 20+, 32, 34, 36, 40, 42, 44, 48, 55, 65=416

then divide by total number of digits

(Mean: The mean is the average. It is found by adding all the data values and then dividing by the number of data points.)

41.6 rounded to 42

A company negotiator claims that only 35% of union members will support a strike, but a union rep believes that the true percentage is greater and runs a hypothesis test. What are the hypothesis statements for this situation?


A. H0: p < 0.35; Ha: p = 0.35

B. H0: p = 0.35; Ha: p < 0.35

C. H0: p > 0.35 ; Ha: p = 0.35

D. H0: p = 0.35; Ha: p > 0.35

Answers

Answer:

[tex](d)[/tex] [tex]H_o: p = 0.35[/tex] [tex]H_a: p > 0.35[/tex]

Step-by-step explanation:

Given

[tex]\mu = 35\%[/tex]

Required

The hypothesis statements

First claim: 35% will support a strike.

This represents the null hypothesis

[tex]H_o: p = 0.35[/tex]

Second claim: A greater percentage will support the strike.

This represents the alternate hypothesis

[tex]H_a: p > 0.35[/tex]

Dan is planning an event for which the total cost cannot exceed $400. Dan plans to spend $180 on food and to hire a clown at the rate of $35 per hour. Which inequality correctly shows Dan's spending in terms of h, the number of hours that the clown can be at the party? *

Answers

Answer:

using above inequality equation, we can find the total hours in which the clown can be at the party

The correct inequality for the Dan's spending in terms of h, the number of hours that the clown can be at the party will be;

⇒ $180 + $35h < $400

What is Inequality?

A relation by which we can compare two or more mathematical expression is called an inequality.

Given that;

Dan is planning an event for which the total cost cannot exceed $400.

And, Dan plans to spend $180 on food and to hire a clown at the rate of $35 per hour.

Now,

Let number of hours = h

So, We can formulate;

Total spend money = $180 + $35h

Hence, The correct inequality for the Dan's spending in terms of h, the number of hours that the clown can be at the party will be;

⇒ $180 + $35h < $400

Thus, The correct inequality for the Dan's spending in terms of h, the number of hours that the clown can be at the party will be;

⇒ $180 + $35h < $400

Learn more about the inequality visit:

https://brainly.com/question/25275758

#SPJ5

Mr. barrera has 2 bags of cat food. One bag has 20 ounces and the other has 3 1/2 times as much as the first bag. If Mr. Barrera uses 1/5 of the cat food from the larger bag to feed his cats, how many ounces of cat food did he use?

Answers

Answer: 14 oz

Step-by-step explanation: Trust me it’s right

The number of ounces of cat food that Mr. Barrera used is; 14 Ounces (Oz)

Number of bags with cat food = 2 bagsNumber of ounces in first bag = 20 Oz

Other bag has 3½ times as much as first bag. Thus;

Number of ounces in second bag = 3½ × 20 = 70 Oz

He uses 1/5 of the cat food from the larger bag.

Thus;

He used; 1/5 × 70 = 14 Oz of cat food

Read more about proportions at; https://brainly.com/question/1781657

PLZ GIVE THE CORRECT ANSWER I CANNOT FIGURE IT OUT

Answers

Answer:

It 148.22

Step-by-step explanation:

Trust me boi and good luck!




By what percentages are Sweden's high category and medium category less than the United States' categories (to the nearest percent)?


High category = a0 %


Medium category = a1 %

Answers

REQUIRED CHART :

The required chart has been attached

Answer:

31.8%

30.0%

Step-by-step explanation:

Required :

To obtain the Difference between Sweden and United States high and medium categories to the nearest %

Sweden :

High category = $23.51

Medium category = $15.73

United States :

High category = $34.48

Medium category = $22.46

Percentage Difference :

High category : (34.48 - 23.51) / 34.48 * 100% = 31.8%

Medium category : (22.46 - 15.73) / 22.46 * 100% = 29.96% = 30.0%

*PLEASE ANSWER ASAP!! ILL GIVE BRAINLIEST*
If you drive 1,000 miles each month and get 18.2 MPG, how much would you spend on gas if gas was $2.75 per gallon?

a.) $151

b.) $22.55

c.) $100

Answers

A is the correct answer because...
1000/18.2=54.945
54.945x2.75=151
Sorry for who ever uploaded the disturbing photos :(
Hope this help and have a nice day!
Please report and I will be contacting them as it occurring a;; day today
Here’s a cute dog image to remove the other photo from mind

The total money spent on the gas will be equal to $151. Hence, option (a) is correct.

What are arithmetic Operations?

The four fundamental operations of arithmetic are addition, subtraction, multiplication, and division of two or even more items.

Included in them is the study of integers, especially the order of operations, which is important for all other areas of mathematics, notably algebra, data management, and geometry.

As per the instructions in the question,

Driving each month = 1000 miles

Then,

1000/18.2 = 54.94

The price is $2.75 per gallon.

Then, the money spent on gas will be,

54.94 × 2.75 = $151.

To know more about arithmetic operations:

https://brainly.com/question/25277954

#SPJ2

uh yeahhhhhhhhh you see it​

Answers

Answer:

1296

Step-by-step explanation:

Answer:

what they said. jk i actually don't know if they're correct

Step-by-step explanation:

Factorise fully :
mx + my + nx + mq ​

Answers

★Answer[tex] \red{mx + my + nx + mq }\\ \\ \color{teal} \rightarrow \: mx + nx + my + mq \\ \\ \color{navy} \rightarrow \: x(m + n) + m(y + q)[/tex]

What is the total surface area of this triangular prism in square centimeters

Answers

I can't see anything so I can answer you just picture it.

help me plz 10 points

Answers

Answer:

580 cm

Step-by-step explanation:

To find the surface area you just need to find the area of every side of the box and add them together.

SO- the equation for this would be

SA (Surface Area) = 2(20 x 10) + 2(20 x 3) + 2(10 x 3)

SA = 2(200) + 2(60) + 2(30)

SA = 400 + 120 + 60

SA = 520 + 60

SA = 580

Elena is making chocolates. She starts by melting a block of chocolate

shaped like a rectangular prism. Then she pours the melted chocolate

into molds shaped like rectangular prisms. How many chocolates can

Elena make with the block of chocolate?

Answers

Answer:

well tell us any measurements or any numbers that follow along with this problem.

1. Find the present value of an investment that is worth $19,513.75 after

earning 3% simple interest for 5 & 1/2 (5.5) years.

2. Mr. Clopu buys an 18-month CD that pays 4 3/4% simple interest for $5,000. Find the value of the CD at the end of its term.

Answers

1) To get the present value, we need to get the amount after 5.5years

Amount = Principal + Interest

Interest = PRT/100

Interest = $19,513.75*3*5.5/100

Interest = 321,976.875/100

Interest =  $3219.76875

Amount = $19,513.75+$3219.76875

Amount = 22,733.51875

Hence the present value is $22,733.51875

2) Simple Interest = PRT/100

Simple Interest = 5000*(4 3/4)* 18/12*100

Simple interest = 5 * 19 * 18/4*12

Simple interest = 1710/48

Simple interest =35.625

Amount = 5000 + 35.625

Amount = $5035.625

Hence the present value is $5035.625

What are the coordinates of each point after quadrilateral ABCD is reflected across the y-axis and then translated 2 units down? Drag numbers to complete the coordinates. Numbers may be used once, more than once, or not at all. A coordinate plane with three trapezoids. Trapezoid A B C D has coordinates A 1 comma 1, B 2 comma 3, C 4 comma 3, and D 5 comma 1. –5–4–3–2–112345 A'( , ), B'( , ), C'( , ), D'( , )

Answers

Answer:

[tex]A" =(-1,-1)[/tex]    [tex]B" =(-2,1)[/tex]

[tex]C" =(-4,1)[/tex]    [tex]D" =(-5,-1)[/tex]

Step-by-step explanation:

Given

[tex]A = (1,1)[/tex]        [tex]B =(2,3)[/tex]

[tex]C = (4,3)[/tex]        [tex]D = (5,1)[/tex]

Required

The new coordinates after reflected across y-axis and shifted 2 units down

When a point is reflected across the y-axis, the rule is:

[tex](x,y)=>(-x,y)[/tex]

So:

[tex]A = (1,1)[/tex] [tex]=> A' = (-1,1)[/tex]

[tex]B =(2,3)[/tex] [tex]=> B' = (-2,3)[/tex]

[tex]C = (4,3)[/tex] [tex]=> C' = (-4,3)[/tex]

[tex]D = (5,1)[/tex] [tex]=> D' = (-5,1)[/tex]

When a point is translated 2 units down, the rule is:

[tex](x,y) => (x,y-2)[/tex]

So:

[tex]A = (1,1)[/tex] [tex]=> A' = (-1,1)[/tex] [tex]=> A" =(-1,-1)[/tex]

[tex]B =(2,3)[/tex] [tex]=> B' = (-2,3)[/tex] [tex]=> B" =(-2,1)[/tex]

[tex]C = (4,3)[/tex] [tex]=> C' = (-4,3)[/tex][tex]=> C" =(-4,1)[/tex]

[tex]D = (5,1)[/tex] [tex]=> D' = (-5,1)[/tex] [tex]=> D" =(-5,-1)[/tex]

So, the new coordinates are:

[tex]A" =(-1,-1)[/tex]    [tex]B" =(-2,1)[/tex]

[tex]C" =(-4,1)[/tex]    [tex]D" =(-5,-1)[/tex]

heyyyyyyyyyyyy helpppp

Answers

Answer:

its b

Step-by-step explanation:

Answer: the answer B sorry if its wrong

Step-by-step explanation: have a nice day buddy

Ben has a piece of plywood that measures 1 yard on each side.He cuts the wood into 6 equal pieces.Each piece is 1/3 yard wide and 1/2 yard long.What is the area of each piece that Ben cuts?

Answers

Answer:

The area is "[tex]\bold{\frac{1}{6}}[/tex]".

Step-by-step explanation:

In this question, to understand the problem we use the model, that  Begins with drawing squares from each side which is 1 yard, and divides these as defined throughout the problem. To fix the issue, using the given model, please find the attached file.

Calculating the area of the one-piece:

[tex]=\frac{1}{2} \times \frac{1}{3}\\\\=\frac{1}{2\times 3}\\\\=\frac{1}{6}\\\\[/tex]

In a random sample, 3 of 400 computer chips are defective. Based on
the sample, how many chips out of 100,000 would you expect to be
defective?

Answers

Answer:

750 of 100,000 chips would be expected to be defective.

Step-by-step explanation:

(3/400) and (?/100,000)

100,000 ÷ 400 = 250.

Multiply 250 by 3 to find the number of defective chips.

250 x 3 = 750.

My father invests $5000 in a new bank that has an annual
interest rate of 3.8%. Find the balance
after 10 years if it is compounded yearly. Round your answer to
the nearest whole dollar.
$

Answers

$6900

$5000+3.8%=$5190

$190x10=$1900

$5000+$1900=$6900

Find the value of x in the isosceles triangle shown below.

Answers

Answer:

12

Step-by-step explanation:

x is the height, and we notice that this isosceles triangle is two 5-12-13 triangles put together. Therefore, x = 12

Another method. Use pythagorean theorem. x^2 + (10/2)^2 = 13^2

x^2 + 25 = 169

x^2 = 144

x = 12

Will give brainliest if you can help me better understand this! Determine whether sine, cosine, or tangent is the best choice for finding x.

Answers

Answer: Cos, Cosine

Step-by-step explanation:

You can use SOH CAH TOA to help you find out whether you are using Sine, Cosine or Tangent.

SOH- The 'S' is for Sine, then the 'O' and the 'H' is for Opposite over Hypotenuse.

CAH- The 'C' is for Cosine, the 'A' and the 'H' is for Adjacent over Hypotenuse.

TOA- The 'T' is for Tangent, then the 'O' and the 'A' is for Opposite over Adjacent.

As you have the Adjacent (the side next to the angle you are looking for) and Hypotenuse (the side opposite the right angle), you would be using Cosine.

I haven't answered it because I read this as though you wanted the explanation. If you do want an answer just let me know then I can edit my answer.

Hope this helps :)

Hi could can you please tell me the answer and tell me how you got it so I can understand this? Both 6 A and B

Answers

Answer:

you would do 16000 - 13920 and get 12080 and then dive 12080 by 16000 giving you .755 that would be how much is full and then subtract 1 and .755 to get B

In the early 2016 there were about 80 devils living on Maria island.Of that total, 75% are offspring from the previous two breeding seasons. How many are offspring

Answers

Answer: 60 devils

Step-by-step explanation:

Question wants to know the number of offspring from the two previous breeding seasons.

There are 80 devils on the island. 75% of this 80 are from previous breeding seasons.

We need to find this 75% in whole numbers:

= Percentage of devils from previous seasons * Total number of devils

= 75% * 80 devils

= 60 devils

What is the domain of y = log5^x
all real numbers less than 0
all real numbers greater than 0
all real numbers not equal to 0
all real numbers

Answers

Answer:

The answer is all real numbers

Answer:b

Step-by-step explanation:

Caleb and 3 friends are sharing 1/6 quart of milk equally. What fraction of a quart of milk does each of the 4 friends get? Each friend gets blank of a quart of milk.

Answers

Answer:

the fraction of quart of milk does each of the four friend get is  1 ÷ 24

Step-by-step explanation:

The computation of the fraction of quart of milk does each of the four friend get is shown below:

= Sharing quart of milk × fraction of friends

= 1 ÷ 6 × 1 ÷ 4

= 1 ÷ 24

Hence, the fraction of quart of milk does each of the four friend get is  1 ÷ 24

50 POINTS! By using shadows, Tatiana wants to find the height of a building. At a certain time of day, her shadow is 2.4 feet long and the building’s shadow is 16 feet long. Her height is 5.8 feet. How tall is the building?

Answers

The building is 16 feet tall

What is the area of the parallelogram?

Answers

Area of a parallelogram: A=bh
A = 4(15)
A= 60 inch squared

Hope this helps :)

A race takes 3 hours to complete. If the
bikers were traveling at a constant speed, and
traveled 45 miles, how fast were the bikers
traveling?

Answers

Answer:

Speed is equals to distance divided by time

ie

45 ÷ 3

you get 15 miles per hour

Answer:

15 miles per hour

Step-by-step explanation:

Speed = distance travelled / time taken

= 45 / 3

=15

Solve the following quadratic by using square root property. x2 + 16 = 0

A. X= 16 , x= -16


B x = 4, x= -4


C x= 4i , x= -4i

Answers

correct answer is C 16 will be neg under radical and gives an i

Maria is planting a row of flowers in a bed 103 feet long. The instructions say to space the plants 1 foot apart, allowing room for 103 flowers. The flowers come in flats containing 6 plants per flat. How many flats will she need? How many plants will she have left over?

Answers

Answer:

She will need 17 flats and will have 1 plant left over.

Step-by-step explanation:

six can go into 103 17 times, with a remainder of one.


What is the meaning of the point with an x-coordinate of 2?

Answers

Answer:

A

Step-by-step explanation:

Because the x-coordinate is in seconds. Which eliminates answer B

Also, the Y-coordinate is measured in 40 meters per unit, this eliminates C and D.

Other Questions
What is an example of biotechnology? who is VluspPlease help ASAP!!!!! What is the strongest piece of evidence in the second paragraph of thearticle by Douglass?A)greatness in the ability to organizeB) greatness in the ability to discover truthTheodore Parker's three grades of human greatnessD) greatness in executive and administrative ability PLEASE HELP ME IM GIVING EVERTYTHING FOR THISAll About Me Graffiti Wall PowerPointWorth 25 PointsDue Thursday, April 1, 2021 Can someone help me with this? And no links or random answers please. i dunno TvTSAYS I NEED MORE WORDS OK HERE I AM what does martin luther king jr urge americans to do after police attack protestors on the bridge Please complete the following DNA strands1. AGGTCCAAGCTCAAATTTCCCC2. GAAACCCCTTAAACCTTAATTCC3. GCGCGCGCAAATTTTTCCCATCTPlease complete the following strands using RNA:1. AGGTCCCAAAGGCCCTTTCC2. UAAAGGGCCCAGCCCACC3. CUAAAAGGGGGUUUUAACC Juan wants to buy a doll house that is 45% off. The original price is$74.85.What is amount of discount (nearest hundredth)?Answer this quick pls!! :,) Can someone plzzzz help meeee!!!!! Wayne charges the following for repairing washing machines:28 call-out charge + 16 for each half-hour he spends on the repairIf a repair costs 76, how long did it take? 103+1793=????????what is the answer?? Answer both parts please Helpppp me pleaseee Create a complete sentence from each of the following phrase fragments. Add capitalization and punctuation wherever necessary.EllenExample1. has been a gymnast.managing the store International trade theory attempts to explain why nations trade and to help predict the direction, composition, and volume of goods that will be traded A variety of different theories have been proposed over the past several centuries to help explain the existence of trade between nations and to help predict whether trade will occur, what products or services will be traded, the direction of this trade, and the volume of this trade. Understanding the differences between these theories helps managers and policy makers to understand whether and how to pursue trade opportunities internationally Drag each of the general characteristics listed to the international trade theory that it is most associated with:International Trade Theory General Characteristics Government stimulates trade by means of protectionism Mercantilism Factors that can drive competitive advantage for one economy over another Absolute Advantage Trade influenced by relative income levels Comparative Advantage Trade materials that are abundant Trade most efficiently produced goods Differences in Resource Endowments Overlapping Demand Trade goods and services at a lower opportunity cost than others Diamond Model of National Competitive Advantage imeter, Area, Dimensions - Real World Hacice estions Notes/Examples 1. A triangular garden has sides measuring 14 feet, 17 feet, and 28 feet. If Cody is laying a brick ETER border around the garden, how many feet of brick will he laya uchs Hihe rectangular path Why did the cost of spices decreased so much? Who's the first person to reach the moon how a positive personal lifestyle plan may promote meaningfulness of life