Answer:
Bioluminescence is the production and emission of light by a living organism
Explanation:
Bioluminescence occurs through a chemical reaction that produces light energy within an organism's body. For a reaction to occur, a species must contain luciferin, a molecule that, when it reacts with oxygen, produces light. ... Many organisms also produce the catalyst luciferase, which helps to speed up the reaction.
3. State and explain Chargaff's rules.
Answer: Chargaff's rules state that DNA from any species of any organism should have a 1:1 stoichiometric ratio (base pair rule) of pyrimidine and purine bases and, more specifically, that the amount of guanine should be equal to cytosine and the amount of adenine should be equal to thymine.
Explanation:
How does the waste of the pandemic relate to the biosphere?
Answer:
I think because there aren't a lot of people working, so there is no one to pick up after careless people.
That is the first thing that popped up in my head :\
:D
Mt. Pinatubo, a volcano in the Philippines, erupted in 1991. The eruption resulted in the cooling of Earth's surface
for two years.
What can you deduce from the information given?
O Solar energy seeped through the atmosphere,
O The eruption caused sunspot activity to increase.
O The volcano released a lot of sulfur dioxide and ash,
O Greenhouse gases caused the cooling of Earth's surface.
Answer: this is easy, i think
Explanation:
The volcano released a lot of sulfur dioxide and ash
According to question, "C" which is the volcano released a lot of sulfur dioxide and ash.
What is a volcano and what causes its eruption?When magma builds up in the magma chamber, it forces its way up to the surface and erupts, often causing volcanic eruptions.
In the ocean, volcanoes erupt along cracks that are opened in the ocean floor by the spreading of two plates called a mid-ocean ridge.
Thus, the volcano released a lot of sulfur dioxide and ash is correct.
To learn more about volcanoes click here:
https://brainly.com/question/12945128
‼️PLEASE HELP THIS IS MY LAST HOPE
List 6 amino acids found in turkey meat. Explain how those amino acids could be formed into a protein including an explanation of translation and transcription.
Please help
Question is in photo
Answer:
the first one.
Explanation:
Before cells divide, they must replicate their entire genome. Explain why
replication of the genome prior to cell division is important.
Each time a cell divides into two daughter cells, its full genome is duplicated; for humans and other complex organisms, this duplication occurs in the nucleus. This minimizes the incidence of errors (mutations) that may greatly affect the resulting organism or its offspring. ...
HOPE THIS HELPED <3
Answer:
In order for all of the cells in your body to maintain a full genome, each cell must replicate its DNA before it divides so that a full genome can be allotted to each of its offspring cells. If DNA replication did not take place fully, or at all, the offspring cells would be missing some or all of the genome.
Explanation:
Which image shows karst topography?
Ocean with palm trees at the beach.
A sinkhole.
Overhead view of an oxbow and fields.
Answer:
B
Explanation:
a sinkhole is the answer. I got it on edge 2020
Answer:
its B
Explanation:
_____ are simple sugars.
Monosaccharides
Disaccharides
Polysaccharides
Lipids
Answer: monosaccharides
Explanation:
30) These two equations are related because the BLANK of cellular respiration are the BLANK of photosynthesis. The BLANK of photosynthesis are the BLANK of cellular respiration.
Plz fill the blanks in :(
Answer:
Explanation:These reactions occur in the stroma the fluid filled area of a chloroplast ... Photosynthesis Respiration amp Interdependence Two of the 5 basic habitat resources are food and air. ... Without oxygen a cell can extract a net gain of only _____ molecules of ATP from ... Fill in the blanks in the Photosynthesis equation below 15.
A scientist is studying a radioactive element that has a half-life of 63 years. Choose the correct answers from the drop-down menus to complete each statement about the element.
It will take
blank
years for half of the sample to decay.
In 189 years, blank
of the sample will be left.
Scientists can figure out how old a sample is by multiplying the blank
by the length of the half-life.
Answer:
It will take 63 years
In 189 years, one-eight of the sample will be left
By multiplying the number of half-life cycles
Explanation:
I just completed this assignment.
A scientist is studying a radioactive element that has a half-life of 63 years. It will take 63 years, In 189 years, one-eight of the sample will be left.
what is the meaning of half life ?A radioactive element is defined as the material when it changes its atomic number or weight by emitting energy, the energy may be either Alpha, beta, or gamma forms of radiation.
Alpha is a Helium nucleus, a beta particle is an electron and a gamma is high energy electromagnetic radiation. Half-Life can be defined as the time required by which the radioactive substance to split into a different substance.
The half life was first discovered by Ernest Rutherford and represented by the Ug or t1/2, If the radioactive element has one-hour of half-life, it means one half of the element would decay within an hour and the remaining part would decay in another hour.
Learn more about half life, here:
brainly.com/question/16387602
#SPJ2
HELP ME PLZZ I REALLY NEED HELP WITH THIS AND PLZZ EXPLAIN HOW YOU GOT YOU ANSWER WHEN YOU ARE DONE!!
Answer:
B.
Explanation:
The organ system is composed of multiple organs that work together to carry out a function.
hello I need help!!! did I get this right
Answer:
Yeah it is correct.
Explanation:
Things enter the cell through the cell membrane through either active or passive transport which can tell you that the cell membrane controls what goes in and out.
I believe so. I looked it up and it matched everything I found
Why are animals renewable resources?
Answer:
They are renewable natural resources. They move round and round in cycles and never run out. When an animal like this cow eats a plant, it takes in nutrients. The nutrients are used in the animal's body and then many come out as waste, which returns the nutrients to the soil.
A hiker has become overwhelmed with heat while walking in the Grand Canyon. The hiker's body goes into overdrive to keep cool in the heat. The hiker needs to hydrate his or her cells. What process is used to regulate homeostasis?
A. Balanced equilibrium
B. Passive transport
C. Cellular transport
D. Hydration
There are some similarities between prokaryotic and eukaryotic cells. Which of the following structures is found in both prokaryotic and eukaryotic cells?
Answer:
Plasma membrane, cytoplasm, ribosomes, and DNA.
Explanation:
There are what eukaryotes and prokaryotes have in common.
Need Help Due in 5 min: Earth Science
Answers:
hurricane
snowstorm
tornado
flooding
Answer: a snowstorm would occur
Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC
How carbon is uniquely suited to Form biological macromolecules give 3 reasons why
Answer:
Carbon atoms have four electrons of valance. This enables them to form strong covalent bonds with multiple materials. Carbon can also join with it, allowing it to form long chains or atomic rings on carbon.
hope it helps!
when benedicts solution is added to a sucrose solution and put into a boiling water-bath , no change in color is observed
state why no color change is observed
Answer:
b
Explanation:
Please help me please
How does soil erosion affect streams and rivers?
Explanation:
The effects of soil erosion go beyond the loss of fertile land. It has led to increased pollution and sedimentation in streams and rivers, clogging these waterways and causing declines in fish and other species. And degraded lands are also often less able to hold onto water, which can worsen flooding.
34. Education, Fuel, Food and Clean water are all listed as important factors in limiting….
a. Human Development index
b. Gross Domestic Product
c. Infant Mortality
d. Carrying Capacity
Answer:
A. Human Development index
Explanation:
The Human Development Index is a statistic composite index of life expectancy, education, and per capita income indicators, which are used to rank countries into four tiers of human development.
hope i helped
its not gdp nor infant mortality nor carrying capacity
and much more
Answer: the answer is A
Explanation:
help meeeeeeeeeeeeeeeee plz
Answer:
It would most likely be within the mantle. the mantle is in the interior of the earth;. So inner core.
Explanation:
Please I beg someone to help me
Which most likely accounts for the increase in the number of male butterflies in the five years after the initial parasite problem?
Momentum explains how _____ travels.
A.) sound
B.) heat
C.) both of these
D.) none of these
Answer:
I think D
Explanation:
The destruction of which transport vessel in the plant results in a faster death??
Answer:
All of the following are plant adaptations to life on land except ... D) The genes for the synthesis of transport proteins were destroyed. ... A) Xylem tracheids and vessels fulfill their vital function only after their death. ... 51) Ignoring all other factors, what kind of day would result in the fastest delivery of water and minerals to ...
Explanation: MARK BRAINLIEST
scientist have been measuring increasing levels of greenhouse gases in Earth's atmosphere. How do increasing levels affect the atmosphere?
Well, we have a book to write on this topic but imma explain it briefly plus simply.
Global warming emphasizes the environment with rising temperatures, water shortages, increased fire threats, droughts, weeds and pest attacks, severe storm damage and salt attacks, to name just a few.(In simple words)Now, we'd go briefly and discuss some common affects briefly :
Hotter days - The climate is getting more and more warmer and year 2015 was the hottest year ever record throughout the history. The Earth's temperature had already warmed by 1°C which is really dangerous. Rising sea levels - Rising sea levels due to climate change is the biggest problem causing natural calamities. Increased ocean temperatures are melting glaciers and ice caps all over the world. Melted ice increases the volume of water in our oceans. Warmer temperatures also result in the expansion of the water's mass, which causes sea levels to rise, threatening islands and coastal cities.More frequent and intense extreme weather - Extreme weather events like bushfires, cyclones, droughts and floods are becoming more common and more aggressive as a result of global warming.Hope it helps <3
a cell is placed in a isotonic solution. How does the cell maintain homeostasis in the environment ?
Answer:
If a cell is placed in an isotonic solution, there will be no net flow of water into or out of the cell, and the cell's volume will remain stable. If the solute concentration outside the cell is the same as inside the cell, and the solutes cannot cross the membrane, then that solution is isotonic to the cell.
Explanation:
BIOLOGY, I need help on this one
This is a base deletion
the other liquid waste product in cellular respiration is
Answer: During the process of cellular respiration, carbon dioxide is given off as a waste product. This carbon dioxide can be used by photosynthesizing cells to form new carbohydrates. Also in the process of cellular respiration, oxygen gas is required to serve as an acceptor of electrons.
Explanation: Hope dis helps :)))))
Answer:
the waste products are carbon dioxide and water
