The best conclusion you can make about the life cycle of this cell is that the cell is in the S phase of interphase and will move next to the G2 phase.
S phase (Synthesis Phase) is the phase of the cell cycle in which all of the chromosomes (DNA) are replicated within the nucleus. During this phase, the DNA is effectively doubled as each chromosome contains two sister chromatids. After the S phase, the cell enters the G2 phase where various proteins (such as microtubules) are synthesized.
write the code for RNA from this DNA STRAND :
AAAAAATTTTTTCCCGGGGTTTATATATC
Answer:
UUUUUUAAAAAAGGGCCCCAAAUAUAUAG
Explanation:
All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)
HURRY. Why is transcription said to be unidirectional?
Answer:
Transcription is unidirectional because you are copying only ONE side of the DNA. Remember that DNA is a double stranded helical structure. One strand of DNA is complementary to the other strand.
Explanation:
which describes a eukaryotic cell,but not a prokaryotic cell?
HELP ASAP
Joe is experimenting to determine which liquid will cause bean plants to grow faster. He watered the plants with equal amounts of liquid and measured their height every other day. The plants are in the same pots with different soils and placed in the same location. Will Joe be able to obtain reliable data to write a supported conclusion?
Yes, because he is only observing the height of the plant.
Yes, because he is consistent with watering the plants.
No, because he used different soils.
No, because he uses only one type of plant.
Answer:
No, because he used different soils.
Explanation:
which liquid will cause bean plants to grow faster.
He watered the plants with equal amounts of liquid and measured their height every other day.
The plants are in the same pots with different soils and placed in the same location.
Ok so last statement made the experiment wrong.
As a constant variable the soil should be the same for all plants only the liquid should change
Which statement is true about gold and helium?
A. They both occur as a gas at room temperature.
B. They are both made of subatomic particles.
C. They are both used in balloons.
D. One of made of protons and the other of only electrons.
Answer:
The answer is B
B. They are both made of subatomic particles.
How many chromosomes would you expect to be in the daughter cells of the mosquito after mitosis? When starting with 6
Answer:
i think it would be 12 since during mitosis it creates identical daughter cells which doubles up cells.
Explanation:
Answer:
12
Explanation:
How can agriculture cause soil pollution?
Agriculture pollution
Explanation:
Agriculture is a main source of pollution in lake water. chemical and fertilzer
Answer:
Pesticides and fertilizers used on crops fed to animals are a major contributor to land pollution
Explanation:
hope this helps :)
The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.
What is the best use of an atomic model to explain the charge of the particles in Thomson’s beams?
An atom’s negative particles are surrounded by positive matter, so the positive particles are easier to remove.
An atom’s positive particles are surrounded by negative matter, so the negative particles are easier to remove.
An atom’s smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
An atom’s larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove.
The question to the above information is;
What is the best use of an atomic model to explain the charge of the particles in Thomson's beams?
Answer;
An atom's smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
Explanation;
-Atoms are comprised of a nucleus consisting of protons (red) and neutrons (blue). The number of orbiting electrons is the same as the number of protons and is termed the "atomic number" of the element.
J.J. Thomson discovered the electron. Atoms are neutral overall, therefore in Thomson’s ‘plum pudding model’:
atoms are spheres of positive chargeelectrons are dotted around insideAnswer:
Its C on edge
Explanation:
What is the purpose of the other tube of water?
Explanation:
cant see photo
Answer:
delude the other thing
there is no picture so i have no idea what your asking. ill edit this answer to be more specific when you explain
Explanation:
identify and explain three environmental impacts of current agricultural methods
Explanation:
It is profit making practice but it causes increased level of pathogens.
It has increased the level of chemicals in our land and water.
It has increased levels of greenhouse gases in air.
Most stars seem to move across the night sky because
a. the universe is expanding
b.the universe is getting smaller
c. Earth is orbiting the Sun
d. Earth is spinning on its axis
I think it is C but uh if its not D Hope this helps-
Explanation: because
Why do the cells used for reproduction only have half (½) of the DNA that other cells have?
Answer:
Because each chromosome has a pair, these cells are called "diploid" cells. On the other hand, human sperm and egg cells have only 23 chromosomes, or half the chromosomes of a diploid cell.
Explanation:
write a short paragraph on hydra
Answer:
at the moment i am thinking of 3 different hydra, marvel, mythical creature and creation on sexual reproduction between plants. If you could tell me the subject i could explain it to you. :)
Explanation:
Electron transport from complex I to complex IV pumps more protons than transport from complex II to complex IV.
With this in mind, which will produce more ATP
A. Transport from complex I produces more ATP.
B. Transport from complex II produces more ATP.
C. Both produce the same amount of ATP.
Answer:
A
Explanation:
ATP synthase uses a proton gradient to make ATP. Since transport from complex I creates a larger proton gradient, it also produces more ATP.
Electron transport from complex I produces more ATP.
ELECTRON TRANSPORT CHAIN:
The electron transport chain, ETC, is the third and last stage of aerobic cellular respiration. It produces the highest molecules of ATP in cellular respiration. The ETC involves the transfer of electrons to series of molecules in order to create an electrochemical gradient needed for ATP synthesis. The electron transport chain is made up of four complexes namely: Complex I, II, III and IV. NADH and FADH2 produced in the Krebs cycle are the electron carriers. Complex I pumps more hydrogen ions (H+) from the mitochondrial matrix to the intermembrane space. Since the pumped is directly related to the number of ATP molecules, complex I will produce more ATP molecules.Learn more: https://brainly.com/question/442662?referrer=searchResults
20 points and will mark brainliest! Please explain how you got it though
Answer:
crossing over during meiosis
Explanation:
i just had biology last semester hope this helps
What is the atomic mass of Sulfur that has 18 neutrons?
Answer: 32.066 atomic mass units
B is the correct option.
the biotic factors of each land biome are determined by its ___
climate
organisms
location
size
Answer:
climate
Explanation:
Can you tell me which go where?
Answer:
heredity goes to the first one
phenotype at the second one
Explanation:
which layer of the earth is made out of melted metal?
The outer core. A molten nickle- iron alloy.
How does evolution result in reproductive success?
Answer:
Often when species evolve, they receive a trait that may make them live longer or make it where their survival chances are significantly increased. Which in turn can make their offspring stronger and able to live longer, therefore increasing their population.
17. What causes evaporation?
O Air that is unsaturated with water vapor comes into contact with the surface of the water
O Air that is cooler than the water comes into contact with the surface of the water
O Air that is warmer than water comes into contact with the surface of the water
O Air that is supersaturated with water vapor comes into contact with the surface of the water in
Evaporation occurs when air that is warmer than water comes into contact with the water's surface, hence option A is correct.
What is evaporation?As a liquid transforms into a gas, evaporation, a sort of vaporization, occurs on the liquid's surface. For instance, a high concentration of the evaporating substance in the surrounding gas significantly slows down evaporation when humidity affects the rate of evaporation of water.
It takes in moisture from garden soil as well as the biggest lakes and seas, and the level of the water will decrease when it is heated by the sun.
Therefore, solar energy, or heat from the sun, is what causes the evaporation process to occur, hence option A is correct.
Learn more about evaporation, here:
https://brainly.com/question/5019199
#SPJ5
PLEASE HELPPPPPPP
(Monstro the Goldfish & Epigenetics)
Answer:
mmmmmmmmmmmmdddddd
Explanation:
ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd
PLEASE HURRY I AM TIMED!!!
Are aliens real? Explain your answer.
Answer:
No, not according to any sciences (unless you mean aliens as in immigrants)
Explanation:
There is no way that we are the only living thing in the entire world. There has to be another species out there. They might be wondering if there is another living thing out in space too.
help need answer asap !!
What increases as you move from the surface to the interior of the Earth?
Answer:
Heat/temperature
Explanation:
"There are three main sources of heat in the deep earth: (1) heat from when the planet formed and accreted, which has not yet been lost; (2) frictional heating, caused by denser core material sinking to the center of the planet; and (3) heat from the decay of radioactive elements." These give the core and a few of the outer layers of the earth more and more heat.
Which statement best explains the myth about how Romulus and Remus founded Rome?
Answer: Romulus defeated his brother, then founded Rome on one of the seven hills.
Explanation: Despite there is no answer choices, I'm thinking back on a little quiz I took, and it had the same exact question with the same exact answer choices, and that was the correct answer
o
1. Which criteria are used to classify amphibians into orders?
Answer:
They are classified into three orders: frogs and toads, salamanders and newts, and caecilians.
Which factor makes enzymes well-suited to the role of catalyst in a biochemical reaction?
A)Enzymes do not affect the energy of a reaction.
B)Enzymes slow down reactions so products can form.
C)Enzymes can be reused because they do not permanently bond with substrate.
D)Enzymes can only bind to other enzymes so the same product is formed each time.
Answer: C
Explanation: Once an enzyme binds to a substrate and catalyzes the reaction, the enzyme is released, unchanged, and can be used for another reaction.
Enzymes can be reused because they do not permanently bond with substrate.
What are Enzymes?
A biological catalyst called an enzyme is usually always a protein. It accelerates a certain chemical reaction in the cell. The enzyme is continuously employed during the reaction and is not destroyed. Each enzyme molecule found in a cell is unique and tailored to a particular chemical reaction.
Proteins called enzymes assist our bodies' chemical reactions move forward more quickly. For several processes, including digestion and liver function, enzymes are crucial.
Health issues might result from having too much or too little of a specific enzyme. Healthcare professionals can also use the enzymes in our blood to look for injuries and illnesses.
Therefore, Enzymes can be reused because they do not permanently bond with substrate.
To learn more about Enzyme, refer to the link:
https://brainly.com/question/14953274
#SPJ6
There are many different types of cells with many different types of cellular structures and functions. Which of these structures is found in all types of eukaryotic cells?
A. chloroplast
B. cell wall
C. nucleus
D. centrioles
Answer:
nucleus
Explanation:
chloroplasts and cell walls are only found in plant (and fungi) cells, while centrioles are only in animal cells.
The structure that is found in all types of eukaryotic cells is the nucleus. The correct option is C.
What are eukaryotic cells?Eukaryotic cells are those cells that contain true cell organelle. These cells are present in the higher organism, and they perform complex functions like replication, mitosis, etc.
There are two types of cells. They are prokaryotic and eukaryotic cells. Prokaryotic cells are those that do not contain an organelle and a nucleus. They are present in smaller organisms.
The nucleus is the brain of cells. It controls all functions of cells, and it contains the genetic material of the organisms. In prokaryotic cells, the nucleus is absent and in eukaryotic cells, the nucleus is present. That is the difference between them.
Thus, the correct option is C. nucleus.
To learn more about eukaryotic cells, refer to the link:
https://brainly.com/question/982048
#SPJ6
Helpppppppppppppppppppppppppppppppppp
Answer:
umm i dont understand your question
Explanation:
