Answer:
Smallest type of protein.
Explanation:
Can somebody help with those 3 problems please
Answer:
first one is option A
second one option B
third is26 N
Explanation:
1.the law here is every action has an equal and opposite......
2. only unbalanced forces move objects from rest or of uniform motion
3.net force is the sum of forces ,if forces are in the same direction
hope this helps plz mark me brainliest
A virus is ________ a cell.
A)bigger than
b) the same size as
C)smaller than
d)another word for
Answer:
smaller than
Explanation:
But they're nothing compared to the giants of the cellular world. ... And viruses are smaller again — they're about a hundredth the size of our cells. So we're about 100,000 times bigger than our cells, a million times bigger than bacteria, and 10 million times bigger than your average virus
Hope this helps <3
State the three parts of the cell theory.
Answer:
The three parts of the cell theory are: cells are the smallest unit of life; all cells come from preexisting cells; and living thing is made up of one or more cell.
Which sex cell is produced in males?
Answer:
Sperm
Explanation:
Answer:
Sperm
Explanation:
In guinea pigs, the allele for black fur(B) is dominant over the allele for
brown fur(b), and the allele for short fur (F) is dominant over the allele
for long fur(1). What percent of the offspring of a BbFf x bbff cross will
be heterozygous for both traits?
Select one:
100%
25%
0%
50%
Answer: 50%
Explanation:
The landform pictured above is _____, which has formed out of _____ and _____.
O A. a glacier, snow; ice
B. a glacier; ocean water, snow
O C. a mountain; snow; ice
OD. an iceberg; ocean water, snow
Answer: a glacier; snow; ice
Explanation:
Just did it and it was right
WILL GIVE BRANLIEST!!!! 20 POINTS!!!! BLESS YOUR GRADES!!
3. Which two substances move through an ecosystem in sedimentary cycles?
A) phosphorous and oxygen
B) phosphorous and sulfur
C) sulfur and carbon
When the motion energy of an object changes, there is inevitably some other change in energy at the same time. If
an object is slowing down, where is the energy going? (Check all that apply)
The potential energy could be increasing, like a ball thrown into the air.
The kinetic energy could be lost to friction or airfmsistance.
The ball could be returning to its natural resting state.
Due to the conservation of energy, the kinetic energy must stay the same.
Please help
When the motion energy of an object changes, there is inevitably some other change in energy at the same time. If the object is slowing down, where is the energy going?
1. The potential would increase since when the ball is slowing down, its kinetic energy is being transformed into potential energy and when the ball gets hit or kicked again, it releases the potential energy and it transforms into kinetic energy.
2. The kinetic energy wouldn't exactly be lost to friction or air resistance, it's merely being converted into potential energy when the ball is slowing down due to those factors.
3. The ball returning to its natural resting state is correct since according to Newton's 1st Law in which an object that is at rest or is moving will not change unless there is another force acting upon it. in this case, the ball was kicked and there are other forces acting upon it like friction and air resistance, those factors cause the ball to slow down. Eventually the ball will stop and return to its original resting state.
4. This one is incorrect since kinetic energy is not staying the same as the person or any other force that is exerted on it be increased therefore increasing the kinetic energy.
Which protecas the DNA of a virus?
Answer:
capsid.
Explanation:
The protein layer that protects the nucleic acids is called the capsid.
The pattern of natural selection where BOTH of the extreme versions of a trait are more advantageous than the average, so a population evolves in both directions away from the average.
Answer:
Stabilizing Variation.
Explanation:
This is the type of variation that occurs when genetic diversity decreases as the population of organism in a particular population based on a specific trait.
Organisms with varied or specific traits within the population are selected against by the selection pressure, with little chances of reproduction, while organisms in between, ( with least variation of this particular traits) which are within the narrow range, survive to reproduce.Thus, this gives rise to narrow population of these particular organisms,(stabilizing variation) which are therefore naturally selected.
Therefore, the variation of the organisms in this population is kept close to the centre of the same mean value.
The entire earth is actually a global ecosystem.
True
False
Answer:
true
Explanation:
Answer:
it is true the entire earth is a global system
burning fossil fuels, it makes the Earth colder.
What percent of the atmosphere is carbon dioxide?
A.4%
B.0.4%
C.40%
D.0.04%
Answer:
B i took the test
Explanation:
Answer: D
Explanation: Only 0.04% of the atmosphere is carbon dioxide.
A factory that has not followed pollution control standards has been operating in an area that did not have such a factory before. Plants that used to grow well are not doing well. Fish in a nearby river are dying at a higher rate than usual. Why?
A Pollution from the factory is getting into the rain, which is making the pH levels in the soil and water rise.
B It hasn't rained enough and the plants aren't getting enough water.
C The factory has increased the temperature in the area.
D Pollution from the factory is getting into the rain, which is making the pH levels in the soil and water become lower.
Answer:
D
Explanation:
If the pH levels are becoming low then the water and dirt becomes acidic killing fish and plants
1. Why is the bird on the right more likely to pass on its genes than the bird on the left?
2. Why would some variations/traits be passed on to the next generation and some seem to disappear over time?
3. What type of adaptation/traits do you think would be good to pass on to your children?
Answer:
1because it has a bigger and larger beak
2because of the development of the technology, genes change overtime and more now because of the global warming
3somewhere natural,traits:values,justice,self defense,to take care of the environment, etc
An oak tree can be a home for animals like squirrels, birds, etc. as well as provide oxygen for the environment. This is an example of a _____________: the role an organism plays in the environment.
Answer:
Commensalism
Explanation:
Commensalism is the condition in which one organism is harmed and the other is neither harmed nor benefited. The animals are being benefited but the tree is neither benefited nor harmed.
All living organisms are composed of what?
All living organisms are composed of one or more cells.So, your answer would be Cell.
hope it helps!
What are the differences between parents and offsprings ?
Answer:
Offspring is a person's daughter(s) and or son(s); a person's child. While a parent is one of two persons from whom one is immediately biologically descended; a mother or a father.
Answer:
Parents have offspring
Explanation:
Offspring is the result of sexual or asexual reproduction by parents.
Germination will not happen unless a seed
A. is dispersed far from the plant that produced it.
B. absorbs water.
C. uses its stored food.
D. grows stamens and a pistil.
which two technologies use reflected sound waves
Answer:
one of them is SONAR
Explanation:
Other one is megaphone
Answer: There are 3 of them that are: radar, sonar and lidar.
Explanation: I used google to answer this
Which answer choice correctly lists the flow of food through the GI tract (gastrointestinal tract) of the digestive system?
mouth-- stomach-- small intestine-- large intestine-- rectum
rectum-- large intestine--- small intestine--- stomach--- esophagus-- mouth
mouth-- esophagus-- stomach-- small intestine--- large intestine--- rectum
mouth-- stomach-- small intestine-- esophagus--- large intestine-- rectum
Answer:
mouth--esophagus--stomach--small intestine---large intestine---rectum
Explanation:
Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG
Answer: DNA
Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.
RNA has all of those except for adenine which is replaced with Uracil.
I need to list the order of traits from sponges to mammals in which they appear from an evolutionary standpoint. I don't know how to find the correct order
Answer:
please put a picture of the work you have to do so i can help you
Explanation:
Food contains a sugar called , which is broken down in a process called cellular . This process uses to break down food molecules and provide energy for cells.
Answer:
I think it is glucose.i hope this helps!
Explanation:
Answer:
the correct answers are glocose, respiration, and oxygen
Explanation:
i got it right
DNA is a molecule that stores____information in the cells
Answer: instructions
Explanation: trust me
Answer:
genetic
Explanation:
The water cycle gets its energy from the ___?
Answer:
the sun
Explanation:
What is the role of DNA in an organism ? how is dna related to reproduction
Answer:
DNA plays a role in the growth and reproduction of organisms.The function of DNA is to store all of the genetic information that an organism needs to develop, function, and reproduce.DNA contains the instructions needed for an organism to develop, survive and reproduce.
explain how gas is compressed into liquid in a gas barrel
Explanation:
A gas can be converted into a liquid by increasing the pressure & decreasing temperature. So that the condensation occurs. You must also make the molecules closer so that it is a phase change from a gas to liquid. In liquids, the molecules are very near than that of gases.
Which best describes an adaptation that could be found in a fish that lives in a slow-flowing stream?
the ability to attract prey by glowing
extra gills, for oxygen extraction
O the ability to grow larger
extra fat, for warmth
Answer:
My best guess is B!!! Sorry if im wrong!!!
Explanation:
Hope this help!! <3
A multicellular organism typically begins as a single cell, and then many cell divisions occur to generate the cells of the adult organism. However, these cells are not identical to the original cell, and they are not identical to one another.
What is the most significant cause of cell differentiation in a multicellular organism?
A.
differences in the number of chromosomes per cell
B.
differences in the genetic code used by different cells
C.
differences in the DNA that is copied and distributed among the cells
D.
differences in gene regulation and gene expression among the cells
Answer:
D
Explanation:
Difference in cell regulation and cell expression. This is embedded in chromosomes which is the blue print of the organism. The chromosomes is like the house plan when you building a house.
The most significant cause of cell differentiation in a multicellular organism is: D. differences in gene regulation and gene expression among the cells.
What is cell differentiation?Cell differentiation can be defined as a process through which a young, unspecialized cell undergoes various changes in gene expression, so as to become a specialized that is more specific in terms of function.
In a multicellular organism, which is an organism with multiple cells, the most significant cause of cell differentiation is as a result of differences in gene regulation and gene expression among its cells.
Read more on cell differentiation here: https://brainly.com/question/13846411
What would happen if the distance of a planet from the Sun was doubled?
Answer:
Hey! Here are your answers!
1) The Earth would make a double orbit * in terms of time duration of 365.25 days * meaning there'd be about 730.5 days in a year ( a leap year therefore would be every 2 YEARS )
2) Because SOLAR RADIATION (light and heat) takes about 8 mins to reach Earth, this would be double to 16 mins
3) The planet as a whole would cool down significantly to the extent that life cannot exist!
Explanation:
HOPE THIS HELPS!!
According to Kepler's third law, T2 R3, the cube of the mean distance between the planet and the Sun (R) and the square of the time period (T) are exactly related. As a result, the planet's orbital period lengthens by a factor of two.
How does the distance of a planet from the Sun affect it?The orbital period increases and the gravitational pull decreases with a doubled distance from the sun. Depending on how far away from the Sun a planet is, it will have a different orbital speed.
A planet moves more quickly and experiences a stronger gravitational attraction as it gets nearer to the Sun.
It moves in its orbit more slowly the further it is from the Sun because of the Sun's weaker gravitational attraction.
Therefore, the planet's orbital period lengthens by a factor of two.
Learn more about the Sun, here;
https://brainly.com/question/15074673
#SPJ6
