A house has well-insulated walls. It contains a volume of 105 m3 of air at 305 K.
Consider heating it at constant pressure. Calculate the energy required to increase the temperature of this diatomic ideal gas by 0.7

Answers

Answer 1

Answer: [tex]85.46\ kJ[/tex]

Explanation:

Given

Volume of air [tex]V=105\ m^3[/tex]

Temperature of air [tex]T=305\ K[/tex]

Increase in temperature [tex]\Delta T=0.7^{\circ}C[/tex]

Specific heat for diatomic gas is [tex]C_p=\dfrac{7R}{2}[/tex]

Energy required to increase the temperature is

[tex]\Rightarrow Q=nC_pdT\\\\\Rightarrow Q=n\times \dfrac{7R}{2}\times \Delta T\\\\\Rightarrow Q=\dfrac{7}{2}nR\Delta T\\\\\Rightarrow Q=\dfrac{7}{2}\times \dfrac{PV}{T}\times \Delta T\quad [\text{using PV=nRT}][/tex]

Insert the values

[tex]\Rightarrow Q=\dfrac{7}{2}\times \dfrac{1.01325\times 10^5\times 105}{305}\times 0.7\\ \text{Assuming air pressure to be atmospheric P=}1.01325\times 10^5\ N/m^2\\\\\Rightarrow Q=0.8546\times 10^5\\\Rightarrow Q=85.46\ kJ[/tex]


Related Questions

A 3.25-gram bullet traveling at 345 ms-1 strikes and enters a 2.50-kg crate. The crate slides 0.75 m along a wood floor until it comes to rest.

Required:
a. What is the coefficient of dynamic friction between crate and the floor?
b. What is the average force applied by the crate on the bullet during collision if the bullet penetrates the 1.10cm into the crate?

Answers

Answer:

a)   μ = 0.0136, b)   F = 22.8 N

Explanation:

This exercise must be solved in parts. Let's start by using conservation of moment.

a) We define a system formed by the downward and the box, therefore the forces during the collision are internal and the momentum is conserved

initial instant. Before the crash

        p₀ = m v₀

final instant. After inelastic shock

        p_f = (m + M) v

the moment is preserved

        p₀ = p_f

        m v₀ = (m + M) v

        v = [tex]\frac{m}{m + M} \ v_o[/tex]

We look for the speed of the block with the bullet inside

        v = [tex]\frac{0.00325}{0.00325 + 2.50 } \ 345[/tex]

        v = 0.448 m / s

Now we use the relationship between work and kinetic energy for the block with the bullet

in this journey the force that acts is the friction

         W = ΔK

          W = ½ (m + M) [tex]v_f^2[/tex]  - ½ (m + M) v₀²

the final speed of the block is zero

the work between the friction force and the displacement is negative, because the friction always opposes the displacement

         W = - fr x

we substitute

           - fr x = 0 - ½ (m + M) vo²

           fr = ½ (m + M) v₀² / x

         

the friction force is

          fr = μ N

          μ = fr / N

equilibrium condition

          N - W = 0

          N = W

          N = (m + M) g

we substitute

         μ = ½ v₀² / x g

we calculate

          μ = ½ 0.448 ^ 2 / 0.75 9.8

          μ = 0.0136

b) Let's use the relationship between work and the variation of the kinetic energy of the block

          W = ΔK

initial block velocity is zero vo = 0

         F x₁ = ½ M v² - 0

         F = [tex]\frac{1}{2} M \frac{x}{y} \frac{v^2}{x1}[/tex]

         F = ½ 2.50 0.448² / 0.0110

         F = 22.8 N

The colors that make up white light are called what?​

Answers

Answer:

The ROYGBIV

Explanation:

R - red

O - orange

Y - yellow

G - green

B - blue

I - indigo

V - violet

__5. The study of weather patterns can predict the trajectory and intensity of this
event via satellite imagery.
A. Hurricanes
B. Tornadoes
C. Floods
D. Forest fires

Answers

Answer:

its hurricane

Explanation:

beacuse almost all the time hurricanes cause alot of trajectory in the compasses and weather maps

The study of weather patterns can predict the trajectory and intensity of hurricanes. So, option A.

What is meant by weather ?

The state of the atmosphere, which includes factors such as temperature, air pressure, wind, humidity, precipitation, and cloud cover, is referred to as the weather.

Here,

Weather condition is the local climate over a specific time period, which might range from one to several weeks. Meteorological conditions are those that are characteristic for a certain place or seasons.

The study of weather and atmospheric patterns across time is known as climatology. This branch of science is devoted to observing, examining, and comprehending global weather patterns, as well as the atmospheric circumstances that lead to them.

The atmosphere's current condition can be determined by combining data from weather stations, satellites, and even data collected by aircraft.

Following that, meteorologists use what they know about atmospheric processes to predict how the atmosphere will change, so altering the weather.

Hence,

The study of weather patterns can predict the trajectory and intensity of hurricanes. So, option A.

To learn more about weather, click:

https://brainly.com/question/3789422

#SPJ3

A ceramic tile measuring 50 cm x50cm has been designed to bear a pressure of 40 N/in . Will it with stand a force of 5 N?

Answers

Answer:

Yes the tile can withstand a force 5 N

Explanation:

We'll begin by converting the dimensions from cm to in. This can be obtained as follow:

Dimension = 50 cm x 50cm

Recall

2.54 cm = 1 in

Therefore,

50 cm = 50 cm × 1 in / 2.54 cm

50 cm = 19.685 in

Thus, the dimension becomes:

Dimension = 19.685 in × 19.685 in

Next, we shall determine the area. This can be obtained as follow:

Dimension = 19.685 in × 19.685 in

Area = 19.685 in × 19.685 in

Area = 387.5 in²

Next, we shall determine the force to which the tile can withstand. This can be obtained as follow:

Pressure (P) = 40 N/in²

Area (A) = 387.5 in²

Force (F) =?

P = F/A

40 = F/387.5

Cross multiply

F = 40 × 387.5

F = 15500 N

Thus, the tile can withstand a force up to 15500 N.

Therefore, the answer to the question is:

Yes the tile can withstand a force 5 N

PLEASE HELP ME WITH THIS ONE QUESTION
The half-life of Barium-139 is 4.96 x 10^3 seconds. A sample contains 3.21 x 10^17 nuclei. How much of the sample is left after 1.98 x 10^4 seconds?

a) 8.03 x 10^16 nuclei

b) 4.01 x 10^16 nuclei

c) 2.02 x 10^16 nuclei

d) 1.61 x 10^17 nuclei

Answers

Answer:

c) 2.02 x 10^16 nuclei

Explanation:

The isotope decay of an atom follows the equation:

ln[A] = -kt + ln[A]₀

Where [A] is the amount of the isotope after time t, k is decay constant, [A]₀ is the initial amount of the isotope

[A] = Our incognite

k is constant decay:

k = ln 2 / Half-life

k = ln 2 / 4.96 x 10^3 s

k = 1.40x10⁻⁴s⁻¹

t is time = 1.98 x 10^4 s

[A]₀ = 3.21 x 10^17 nuclei

ln[A] = -1.40x10⁻⁴s⁻¹*1.98 x 10^4 s + ln[3.21 x 10^17 nuclei]

ln[A] = 37.538

[A] = 2.01x10¹⁶ nuclei remain ≈

c) 2.02 x 10^16 nuclei

PLEASE HELP ME WITH THIS ONE QUESTION
What is the rest energy of a proton? (c = 2.9979 x 10^9 m/s, mp = 1.6726 x 10^-27)

A) 8.18 x 10^-14 J

B) 2.73 x 10^-22 J

C) 1.5053 x 10^-10 J

D) 1.5032 x 10^-10 J

Answers

Answer:

djfjci3jsjdjdjdjdjddndn

ds

An astronaut throws a wrench in interstellar space. How much force is required to keep the wrench moving continuously with constant velocity?
A.
a force equal to its weight on Earth
B.
a force equal to zero
C.
a force equal to half of its weight on Earth
D.
a force equal to double its weight on Earth

Answers

Answer:

0 N

Explanation:

This is a trick question, the mass of the wrench would be 0 due to it being in space and has no gravitational pull to weight it down. And since acceleration is defined as the rate and change of velocity with no respect of time and the wrench is moving at a constant velocity, that means the velocity is 0. and since F = m*a it would be F = 0 * 0 = 0 N

An unruly student with a spitwad (a lump of wet paper) of mass 20 g in his pocket finds himself in the school library where there is a ceiling fan overhead. He relieves his boredom by throwing the spitwad up at the ceiling fan where it collides with, and sticks to, the end of one of the blades of the stationary ceiling fan. Its horizontal velocity vector is perpendicular to the long axis of the blade. If the fan is free to rotate (no friction at all) and has moment of inertia I=1.4kgm2 , if the spitwad has horizontal velocity 4 m/s, and if the spitwad sticks to the fan blade at a distance of 0.6 m from the rotation axis of the fan, how much time will it take the fan to move through one complete revolution after the spitwad hits it (closest answer)?

a. 1min
b. 2min
c. 3min
d. 4min
e. 5min
f. 6min

Answers

Answer:

T = 188.5 s, correct is  C

Explanation:

This problem must be worked on using conservation of angular momentum. We define the system as formed by the fan and the paper, as the system is isolated, the moment is conserved

         

initial instant. Before the crash

        L₀ = r m v₀ + I₀ w₀

the angular speed of the fan is zero w₀ = 0

final instant. After the crash

        L_f = I₀ w + m r v

        L₀ = L_f

        m r v₀ = I₀ w + m r v

angular and linear velocity are related

        v = r w

        w = v / r

        m r v₀ = I₀ v / r + m r v

         m r v₀ = (I₀ / r + mr) v

       v = [tex]\frac{m}{\frac{I_o}{r} +mr} \ r v_o[/tex]

let's calculate

       v = [tex]\frac{0.020}{\frac{1.4}{0.6 } + 0.020 \ 0.6 } \ 0.6 \ 4[/tex]

       v = [tex]\frac{0.020}{2.345} \ 2.4[/tex]

       v = 0.02 m / s

         

To calculate the time of a complete revolution we can use the kinematics relations of uniform motion

        v = x / T

         T = x / v

the distance of a circle with radius r = 0.6 m

         x = 2π r

we substitute

         T = 2π r / v

let's calculate

         T = 2π 0.6/0.02

         T = 188.5 s

reduce

         t = 188.5 s ( 1 min/60 s) = 3.13 min

correct is  C

identify the word being referred to choose your answer from the words below​

Answers

Answer:

1:Rotation

2:Axis

3:Aphelion

4:orbit

A small block, with a mass of 0.05 kg compresses a spring with spring constant 350 N/m a distance of 4 cm. It is released from rest, then slides around the loop and up the incline before momentarily comes to rest at point A. The radius of the loop is 0.1 m.

Required:
Find the elastic potential energy.

Answers

Answer:

The elastic potential energy of the spring is 0.28 J

Explanation:

Given;

mass of the block, m = 0.05 kg

spring constant, k = 350 N/m

extension of the spring, x = 4 cm = 0.04 m

The elastic potential energy of the spring is calculated as;

[tex]U_x = \frac{1}{2}kx^2\\\\U_x = \frac{1}{2} \times 350 \times (0.04)^2\\\\U_x = 0.28 \ J[/tex]

Therefore, the elastic potential energy of the spring is 0.28 J

Effects of global warming is

A-decrease in temperature
B-melting of polar ice caps
C-breathing problems

Answers

Answer:

B- the melting of polar ice caps

Explanation:

As the world's temperature increases, polar ice caps will no longer be able to remain solid.

Helppp how a deer gets it’s energy

Answers

Answer:

option C is the correct one

Explanation:

I hope it helps u

Yeah fs c because all living things mostly get there energy from food. So always to try to remember food for questions like these.

Kilometer is a unit of length where as kilogram is a unit of mass

Answers

By George, you've nailed it, Stacy !

That's a fact, uh huh.

Truer words were never written.

Your statement is one of unquestionable veracity.

The pure truthiness of it cannot be denied.

Was there a question you wanted to ask ?

A ball is thrown with an initial velocity of 30.0 m/s and makes an angle of

30.0° with the ground. Find the

A.Horizontal Distance

B.Maximum Height

C.Total Time The Ball is Traveling​

Answers

Statements imply it is thrown with velocity 30cos30° horizontally and 30sin30° vertically.

Vertically:

Total time taken = 2 x time to go up

= 2(v - u)/a

= 0 - 30sin30°)/(-g)

= 30/g

Therefore, it would travel 30/g sec in horizontal direction as well.

Horizontally :

Distance = horizontal speed x time

= 30cos30° (30/g)

= 450√3 /g

If g = 10, distance is 45√3 m.

Vertically,

Distance = vert. speed x (time of flight/2)

= 30sin30° x (30/g)/2

= 90 m.

Time taken = 30/g = 3 sec

A 45.00 kg person in a 43.00 kg cart is coasting with a speed of 19 m/s before it goes up a hill. there is no friction, what is the maximum vertical height the person in the cart can reach?

Answers

Answer:

the maximum vertical height the person in the cart can reach is 18.42 m

Explanation:

Given;

mass of the person in cart, m₁ = 45 kg

mass of the cart, m₂ = 43 kg

acceleration due to gravity, g = 9.8 m/s²

final speed of the cart before it goes up the hill, v = 19 m/s

Apply the principle of conservation of energy;

[tex]mgh_{max} = \frac{1}{2}mv^2_{max}\\\\ gh_{max} = \frac{1}{2}v^2_{max}\\\\h_{max} = \frac{v^2_{max}}{2g} \\\\h_{max} =\frac{(19)^2}{2\times 9.8} \\\\h_{max} = 18.42 \ m[/tex]

Therefore, the maximum vertical height the person in the cart can reach is 18.42 m

calculate the voltage that is being applied across a 10W bulb if a current of 0.2A flows through it​

Answers

Answer:

below

Explanation:

from P= I * V

v = p/I

v = 10/0.2

v = 50 volts

A car of mass 1000 kg is moving at 25 m/s. It collides with a car of mass 1200 kg moving at 30 m/s. When the cars collide, they stick together. What is the total momentum of the system after the collision? What is the total momentum of the system before the collision? What is the velocity of the cars after the collision?

Answers

Answer:

The total momentum of the cars before the collision is 61,000 kg.m/s

The total momentum of the cars after the collision is 61,000 kg.m/s

The velocity of the cars after the collision is 27.727 m/s

Explanation:

Given;

mass of the first car, m₁ = 1000 kg

initial velocity of the car, u₁ = 25 m/s

mass of the second car, m₂ = 1200 kg

initial velocity of the second car, u₂ = 30 m/s

The common velocity of the cars after collision = v

The total momentum of the cars before collision is calculated as;

P₁ = m₁u₁  +  m₂u₂

P₁ = (1000 x 25)  +  (1200 x 30)

P₁ = 61,000 kg.m/s

The total momentum of the cars after collision is calculated as;

P₂ = m₁v + m₂v

where;

v    is the common velocities of the cars after collision since they stick together.

P₂ = v(m₁ + m₂)

To determine "v" apply the principle of conservation of linear momentum for inelastic collision.

m₁u₁  +  m₂u₂  = v(m₁  + m₂)

(1000 x 25)  +  (1200 x 30) = v(1000 + 1200)

61,000 = 2,200v

v = 61,000/2,200

v = 27.727 m/s

The total momentum after collsion = v(m₁ + m₂)

                                                         = 27.727(1000 + 1200)

                                                          = 61,000 kg.m/s

Thus, momentum before and after collsion are equal.

1. A box contains 10 blue chips. 5 red chips, and 15 yellow chips. Find the odds of choosing the
following:
blue chip
b. yellow chip
c. yellow chip

Answers

Answer:

Explanation:

Blue: 10/30

Red: 5/30

Yellow: 15/30

The probability of finding the blue red and yellow chips is 1/3, 1/6 and 1/2

What is the probability?

The extent to which an event is likely to occur, measured by the ratio of the favorable cases to the whole number of cases possible.

Given that

Blue chips =10

Red chips = 5

Yellow chips = 15

Number of the total samples =10+15+5=30

Probability of choosing Blue chips = [tex]\dfrac{10}{30}= \dfrac{1}{3}[/tex]

Probability of Red chips =[tex]\dfrac{5}{30}=\dfrac{1}{6}[/tex]

Probability of Yellow chips =[tex]\dfrac{15}{30}=\dfrac{1}{2}[/tex]

Thus the probability of finding the blue red and yellow chips is 1/3, 1/6 and 1/2

To know more about probability follow

https://brainly.com/question/24756209

A ratio that compares the width and length of a garden is what type of model?

Answers

Answer:

physical

PLEASE MARK ME AS A BRAINLIEST

Answer: Mathematical

Explanation: I took the quiz

make ansentance rkdloebebjekeoejbe​

Answers

Answer:

the man has returned from his trip

Answer:

just did by typing this lol

You send a traveling wave along a particular string by oscillating one end. If you increase the frequency of oscillations, does the speed of the wave increase, decrease, or remain the same?

Answers

Answer:

The speed of the wave remains the same

Explanation:

Since the speed of the wave v = √(T/μ) where T is the tension in the string and μ is the linear density of the string.

We observed that the speed, v is independent of the frequency of the  wave in the string. So, increasing the frequency of the wave has no effect on the speed of the wave in the string, since the speed of the wave in the string is only dependent on the properties of the string.

So, If you increase the frequency of oscillations, the speed of the wave remains the same.

Space debris left from old satellites and their launchers is becoming a hazard to other satellites. (a) Calculate the speed in m/s of a satellite in an orbit 980 km above the Earth's surface.

Answers

Answer:

564

Explanation:

according to the law of conservation of vhange , what must always be true in a nuclear reaction?​

Answers

Answer:

The Sum of mass and energy is always conserved in a nuclear reaction. Mass changes to energy, but the total amount of mass and energy combined remains the same

Explanation:

Every single radioactive decay, every single nuclear collision, every single nuclear reaction will conserve mass number and charge.

The power in an electrical circuit is given by the equation P= RR, where /is the current flowing through the circuit and Ris the resistance of the circuit. What is the current in a circuit that has a resistance of 100 ohms and a power of 15 watts?

[pleas ee helpppp)​

Answers

I= 0.39 A

OPTION B is the correct answer.

Equal masses of two different liquids are put into identical beakers.
Liquid 1 is heated for 100s and liquid 2 is heated for 200s by heaters of the same power.
The temperature of both liquids increases by the same amount.
Which statement is correct?
A Both liquids receive the same amount of energy.
B. Liquid 1 receives more energy than liquid 2.
C. Both liquids have equal thermal capacity.
D. The thermal capacity of liquid 1 is less than the thermal capacity of liquid 2.

Answers

Answer:

C

Explanation:

Because they both received the same temperature

PLEASE HELP ME WITH THIS ONE QUESTION
The half-life of Barium-139 is 4.96 x 10^3 seconds. A sample contains 3.21 x 10^17 nuclei. What is the decay constant for this decay?

A) 1.67 x 10^-4 s^-1

B) 5.43 x 10^-4 s^-1

C) 1.40 x 10^-4 s^-1

D) 2.22 x 10^-4 s^-1

Answers

OPTION C is the correct answer.

an object is 70 um long and 47.66um wide. how long and wide is the object in km?​

Answers

Answer:

length =  7*10^(-8)km

width = 4.666*10^(-8) km

Explanation:

We know that:

1 μm = 1*10^(-6) m

and

1km = 1*10^3 m

or

1m = 1*10^(-3) km

if we replace the meter in the first equation, we get:

1 μm = 1*10^(-6)*1*10^(-3) km

1 μm = 1*10^(-6 - 3)km

1 μm = 1*10^(-9)km

Now with this relationship we can transform our measures:

Length: 70 μm is 70 times 1*10^(-9)km, or:

L = 70*1*10^(-9)km = 7*10^(-8)km

And for width, we have 47.66um, this is 46.66 times 1*10^(-9)km, or:

W = 46.66*1*10^(-9)km = 4.666*10^(-8) km


What is Velocity in physics

Answers

Answer:

hii

Explanation:

i hope this helps you

Answer:

The velocity of an object is the rate of change of its position with respect to a frame of reference, and is a function of time. ... Velocity is a physical vector quantity; both magnitude and direction are needed to define it

Explanation:

hope it helps

pls maek me as brainliest thanks❤

The viscid silk produced by the European garden spider (Araneus diadematus) has a resilience of 0.35. If 10.0 J of work are done on the silk to stretch it out, how many Joules of work are released as thermal energy as it relaxes?

Answers

Answer: The energy released as thermal energy is 6.5 J

Explanation:

Energy stored by the spider when it relaxes is given by:

[tex]E_o=\text{Resilience}\times \text{Work}[/tex]

We are given:

Resilience = 0.35

Work done = 10.0 J

Putting values in above equation, we get:

[tex]E_o=0.35\times 10\\\\E_o=3.5J[/tex]

Energy released at thermal energy is the difference between the work done and the energy it takes to relaxes, which is given by the equation:

[tex]E_T=\text{Work done}-E_o[/tex]

Putting values in above equation, we get:

[tex]E_T=(10-3.5)=6.5J[/tex]

Hence, the energy released as thermal energy is 6.5 J

The energy released as thermal energy when 10 J of work is done to stretch silk will be 6.5 J

What is thermal energy?

Thermal energy refers to the energy contained within a system that is responsible for its temperature. Heat is the flow of thermal energy.

Energy stored by the spider when it relaxes is given by:

[tex]\rm E_o=Resilience \ \times Work[/tex]

We are given:

Resilience = 0.35

Work done = 10.0 J

Putting values in above equation, we get:

[tex]\rm E_o=0.35\times 10[/tex]

[tex]E_o=3.5\ J[/tex]

Energy released at thermal energy is the difference between the work done and the energy it takes to relaxes, which is given by the equation:

[tex]E_T=\rm Work done -E_o[/tex]

Putting values in above equation, we get:

[tex]E_T=(10-3.5)=6.5\ J[/tex]

Hence, the energy released as thermal energy is 6.5 J

To know more about thermal energy follow

https://brainly.com/question/19666326

Two resistors, A and B, are connected in parallel across a 6.0-V battery. The current through B is found to be 2.0 A. When the two resistors are connected in series to the 6.0- V battery, a voltmeter connected across resistor A measures a voltage of 4.0 V. Find the resistances of A and B

Answers

Answer:

The resistance of A is 6 ohms and the resistance of B is 3 ohms

Explanation:

Step 1: For the first connection (parallel connection), the resistance of B will be calculated.

Note: in a parallel connection, the voltage through each resistor is the same.

[tex]V = I_AR_A = I_BR_B\\\\R_B = \frac{V}{I_B} = \frac{6}{2} = 3 \ ohms[/tex]

Step 2: The resistance of A will be calculated from the second connection (series connection)

Note: in series connection, the current flowing in each resistor is the same

[tex]V = V_A + V_B\\\\V = IR_A + IR_B\\\\The \ voltage \ drop \ in \ B; \ V_B = V- V_A\\\\V_B = 6 - 4 = 2 \ V\\\\IR_B = 2\ V\\\\I = \frac{2 \ V}{R_B}= \frac{2}{3} \ A\\\\The \ resistance \ of \ A \ is \ calculated \ as ;\\\\IR_A = 4 \ V\\\\R_A = \frac{4}{I} = \frac{4 \times 3}{2} = 6 \ ohms[/tex]

Other Questions
Consider Hermia's first words when she enters the scene. How do her comments about the setting relate to the action of the scene? In particular, how might Shakespeare intend a double meaning here for her use of the word "sense"? A woman sold an article for 20.00cedis and made a profit of 25%.Find the cost price of the article. What is the sign of -9. (0/-3) If a firm's marginal tax rate is increased, this would, other things held constant, lower the cost of debt used to calculate its WACC. True False When evaluated, which expression has a result that is a rational number? How does convection cause ocean currents?A. During the process of convection, energy is transferred to the atmosphere forming winds. These winds power surface currents.B. During the process of convection, the heating of surface water by the sun results in upwelling.C. During the process of convection, energy in warm water is lost to its surroundings. The water cools, becomes denser, and sinks.D. During the process of convection, more minerals and gases dissolve in warm water. This increases the density of the warm water and causes it to sink. The angle of elevation to a nearby tree from a point on the ground is measured to be31. How tall is the tree if the point on the ground is 62 feet from the tree? Roundyour answer to the nearest tenth of a foot if necessary. Lighting is the movement of? A business manager finds that the building expense each month is completely uncorrelated with revenue levels. What should the business manager assume about this cost? What is 100 5 4 + 43 A. 69B. 144C. 0.3D. 1.2 HELP 18 POINTSJournal prompt to be answered in 2 fully developed paragraphsPrompt: How does physical activity prevent disease and reduce health care costs? Use specific examples from your experience. how can an irreverible step in a metabolic pathway be reversed?A. When both the reactants and products have equal amounts of energyB. When the reactants contain large amounts of energyC. When another chemical reaction with a large amount of energy occurs at same time D. when collision of substances generate the energy neededhow can an irreverible step in a metabolic pathway be reversed?A. When both the reactants and products have equal amounts of energyB. When the reactants contain large amounts of energyC. When another chemical reaction with a large amount of energy occurs at same time D. when collision of substances generate the energy neededOrder the sequence of events in transcription?1- free ribonuleotide triphosphates base-pair with the deoxyribonucleotides in the DNA template 2- RNA polymerase binds to the promoter region of a gene3- primary rna transcript is formed 4- two DNA strands are seperatedWhich organic molecule is not found on the plasma membrane?A. carbohydratesB. cholestrolc. phospholipidsd. proteinsWhat does this statement mean : "Information flow between cells tissues and organs is an essential feature of homeostasis and allows for integration of physiological processes"A. the nervous system is the most prominent body system for integration of physilogical processes B. some substances can affect local processes while others travel to exert their effects on other distant parts of the bodyC. communication between body structures through body fluids is the most important physiological processesD. Neurotransmitters, hormones, paracrine and autocrine substances exert their efferts locally as well as distant body structureswhich statement best describes the orientation the phospholipid molecules in a membrane:A.) the nonpolar fatty acids are oriented towards the cholestrol moleculesB.) the hydrophilic layer is oriented towards the middle of the phosphlipids C.) phospholipids align themselves in the membrane in a bimolecular layerD.) the hydrophobic and hydrophilic structures point away from the cellWhich is NOT a product of glycolysis under aerobic and anaerobic conditions?A.) lactate B.) FADH C.) pyruvate D.) NADH Which reason is why water is an essential nutrient? A.) water needs to move between compartmentsB.)can be obtained through ingestionC.) body cant make enough water for its needsD.) water evaporates from the skin that has the largest surface area among all body structures From the top of the leaning tower of Pisa, a steel ball is thrown vertically downwards with a speed of 3.00 m/s. if the height of the tower is 200 m, how long will it take for the ball to hit the ground? Ignore air resistance. Suppose that the speeds of cars travelling on California freeways are normally distributed with a mean of miles/hour. The highway patrol's policy is to issue tickets for cars with speeds exceeding miles/hour. The records show that exactly of the speeds exceed this limit. Find the standard deviation of the speeds of cars travelling on California freeways. Carry your intermediate computations to at least four decimal places. Round your answer to at least one decimal place. Which guarantees do the Sixth and Eighth Amendments to the Constitution make?the right of all citizens to keep and bear arms and freedom from illegal searches and seizures conducted without search warrantsthe right of arrested persons to remain silent when in custody and the freedom to peacefully assemble and protest the actions of the governmentthe right to be brought before a judge to decide whether ones imprisonment is legal and the freedom to file lawsuits based on federal, state, and local statutesthe right of accused persons to be defended by a lawyer in a speedy public trial and freedom from cruel and unusual punishments and excessive bail Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] Tia and Sam are partners who solely own T and S Florist. As owners, they can:______.a. claim the organization as their legal property. b. can't sell the company. c. claim only limited liability. d. avoid taking any legal responsibility for T and S. e. decide not to pay a dividend to their stockholders. HELP ASAP 30 POINTS WORTH !!!!! OO The slope of a line is 2. The y-intercept of the line is 6. Which statements accurately describe how to graph the function? Locate the ordered pair (0, 6). From that point on the graph, move up 2, right 1 to locate the next ordered pair on the line. Draw a line through the two points. Locate the ordered pair (0, 6). From that point on the graph, move up 2, left 1 to locate the next ordered pair on the line. Draw a line through the two points. Locate the ordered pair (6, 0). From that point on the graph, move up 2, right 1 to locate the next ordered pair on the line. Draw a line through the two points. Locate the ordered pair (6, 0). From that point on the graph, move up 2, left 1 to locate the next ordered pair on the line. Draw a line through the two points. Please help!!!hi,can you please help me with this?thanks can someone answer this please