a is a mountain or hill a vent through which lava erupted from the Earth's?​

Answers

Answer 1

Answer:

A mountain is more likely to have a vent through which lava erupts from the Earth.

Explanation:

By the way, can you follow me on Brainly?

Thanks!


Related Questions

please help please
Which of the following is NOT a basic belief or practice in Chinese Folk Religions?
Yin and Yang
Fasting
Filial Piety
Ancestor Worship

Answers

Answer:

ancestor worship is your answer to your question you have given

ancestor worship is the answer

True or false: The following sentence is correct?
“In thirty years,” Rodriguez claims, “we will all be in driverless cars.”
Select one:

True


False

Answers

Answer:

true

Explanation:

We can't know what will the next innovation of humanity. We managed to fly to other space, who knows if someone can create a driverless car.

Battle in your own words sentences

Answers

Answer: We lost many men in the long-lasting battle but in the end, we won. Our bruises and blood were washed away from the glory of winning. The death of our brothers was not in vain.

He was very nice and talked slow like Miss Kinnian does and he explaned it to me that it was a raw shok. He said pepul see things in the ink. I said show me where. He said think. I told him I think a inkblot but that wasnt rite eather. He said what does it remind you - pretend something. I closd my eyes for a long time to pretend. I told him I pretned a fowtan pen with ink leeking all over a table cloth. Then he got up and went out. —“Flowers for Algernon, Daniel Keyes

what characterizes Charlie in this passage

description of Charlie
what other people say about Charlie
how Charlie thinks ​

Answers

Answer:

C   ;how Charlie thinks ​

Explanation:

Answer:

The person overtop is right

Explanation:

Just to Clarify.

Select the correct text in the passage.
Which statement best shows Brutus's attempt to appeal to his audience?
Julius Caesar
by William Shakespeare

Answers

Answer:

:)

Explanation:

Which of the following expresses a fact?

Question 2 options:

a)

Eating fast food isn't bad if you only eat it once per week.


b)

Burning the American flag should be a crime.


c)

On average, college graduates earn more money in their lifetimes than high school graduates.


d)

Sometimes curly hair can look better than straight hair.

Answers

Answer:

C

Explanation:

C is a fact and it isnt an opinion

Other Questions
2. Which ethic do you think is most important for a journalist to have? Why? Write the relationship between cells, tissue and organs in human body.(plzzzzz answer correctly) At an auto repair shop. 3.5 hours of labour costs $311.50. What is the labourcharge for a 5 hour job? 4. How are the main narrator and Simon Wheeler different? Give as many details aspossible. The writer Angelo Pellegrini has recalled his own family's detention at Ellis Island:We lived there for three days -- Mother and we five children, the youngest of whom was three years old. Because of the rigorous physical examination that we had to submit to, particularly of the eyes, there was this terrible anxiety that one of us might be rejected. And if one of us was, what would the rest of the family do?The purpose of this excerpt is..A. to describe the physical examination experienced by an immigrant family.B. to explain the day-to-day schedule experienced by an immigrant family.C. to describe the fond memories experienced by an immigrant family.D. to explain the feelings of worry experienced by an immigrant family. What fossil helped support Wegener's hypothesis of continental drift?A. GondwanalandB. KannemeyeridC. MesosaurusD. Glossopteris 2What does Don Pepe's lesson to Nayeli in paragraph 13 reveal about theirrelationship?A. He was protective of her and did not want to worry her about life's difficulties.B. He thought she would be able to understand complicated ideas.C. He found her annoying and wanted to limit their conversations.D. He was interested in unusual trivia and wanted to share it with her. In the circular flow model, businesses provide goods and services to whichpart of the economy?A. BusinessesB. Product marketsC. Resource marketsO D. Households Please help! Thank you! what is the mRNA in TACCGGATGCCAGATCAAATC? Help!!! I do not seem to understand this problem well. Why would an investor want to choose a certificate of deposit over a corporate bond Layla is going to invest $5,200 and leave it in an account for 15 years. Assuming the interest is compounded monthly, what interest rate, to the nearest tenth of a percent, would be required in order for Layla to end up with $13,800? Most Americans consume a varied diet. They eat foods that are both plant- and animal-based. Which words are clues to the meaning of the word consume? A. are both B. eat foods C. animal-based D. Most Americans plz no bit.yl stuff, just answers Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?A.It shows that a disease can cause genetic changes.B.It is a reflection of how genetic factors affect health.C.It shows how public health is affected by environmental factors.D.It indicates how a toxin can play a role in the development of disease. why is it important to save energy in our daily lives Red and white blood cells are produced inside the __________ of bones. This is an interaction between the skeletal, circulatory, and immune systems.A. MarrowB. Spongy BoneC. Compact BoneD. Liver This Question: 1 pt20 of 20This QuthThe pH of a fruit juice is 2.9. Find the hydronium ion concentration, [H30 * ), of the juice. Use the formula pH = -log[H30*]The hydronium ion concentration [H30 + ] is approximately moles per liter.(Use scientific notation. Use the multiplication symbol in the math palette as needed. Round to the nearest tenth as needed.) A worldwide organization of academics claims that the mean IQ score of its members is 118, with a standard deviation of 17. A randomly selected group of 40 members of this organization is tested, and the results reveal that the mean IQ score in this sample is 115.8. If the organization's claim is correct, what is the probability of having a sample mean of 115.8 or less for a random sample of this size When riding your bike on a main road you should always follow the rules of the _________.roadbikers guidewalkerstown they are riding in