Answer:
All life on Earth consists of either eukaryotic cells or prokaryotic cells. Prokaryotes were the first form of life. Scientists believe that eukaryotes evolved from prokaryotes around 2.7 billion years ago.
The primary distinction between these two types of organisms is that eukaryotic cells have a membrane-bound nucleus and prokaryotic cells do not. The nucleus is where eukaryotes store their genetic information. In prokaryotes, DNA is bundled together in the nucleoid region, but it is not stored within a membrane-bound nucleus.
The nucleus is only one of many membrane-bound organelles in eukaryotes. Prokaryotes, on the other hand, have no membrane-bound organelles. Another important difference is the DNA structure. Eukaryote DNA consists of multiple molecules of double-stranded linear DNA, while that of prokaryotes is double-stranded and circular.
Explanation:
Which of the following terms describe the Fungi?
-symbionts
-parasites
-predators
-saprobes
Answer:
saprophytesExplanation:
saprophtes not saprobes describe the fungi because they feed on dead organisms.
I hope this helps you
:-)
what do you mean by faunal Diversity
Answer:
animal life especially
Explanation:
i hope it helps
this is my answer
correct me if im wrong
#carryonlearning
Explica qué son los codones y los anticodones La siguiente secuencia de nucleótidos de ADN codifica para una secuencia de aminoácidos que forman una proteína hipotética, encuentre la secuencia de codones, anticodones y aminoácidos que se forman 5 ` A T G A G C A C C C A A A C T T G C TC T T A T T C T A A A A A G A C T 3
Answer and Explanation:
La informacion genetica de ensamblaje de aminoácidos durante la sitntesis proteica, se almacena en unidades llamadas codones.
Un codón es una secuencia corta de tres nucleotidos provenientes de la cadena de ADN o ARN mensajero. Cada codón representa uno de los 20 aminoácidos disponibles para sintetizar la proteina. En total hay 64 codones, de los cuales 61 codifican aminoácidos (mas de un codón puede codificar para el mismo aminoácido), de los cuales uno de ellos a parte es el codon de inicio de sintesis proteica. Los restantes tres codones corresponden a codones de finalización.
El anticodón es la secuencia de nucleótidos presentes en ARN de transferencia, que complementa a cada codón de ARN mensajero. De esta forma el ARNt reconoce el aminoácido correspondiente y lo ensambla en la nueva proteina.
ADN ⇒ 5 ` ATGAGCACCCAAACTTGCTCTTATTCTAAAAAGACT 3
Codones ATG-AGC-ACC-CAA-ACT-TGC-TCT-TAT-TCT-AAA-AAG-ACT
ARNm ⇒ UACUCGUGGGUUUGAACGAGAAUAAGAUUUUUCUGA
Codones UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA
Recordá que para ARNm, la secuencia de nucléotidos debe ser la complementaria para ADN.
Anticodones de ARNt ⇒ Complementarios a los codones de ARNm. Recordá que para los ARN, la timina se reemplaza por uracilo.
AUG-AGC-ACC-CAA-ACU-UGC-UCU-UAU-UCU-AAA-AAG-ACU
La proteina se construye en función de la información del ARNm, es decir que para la selección de aminoácidos, se consideran los codones del ARNm, y no los anticodones de ARNt.
UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA
TYR SER TRP VAL Stop THR ARG ILE ARG PHE PHE Stop
A 43-year-old Caucasian man with a 20-year history of bipolar disorder presents for the first time with long-term polyuria and polydipsia. He previously took lithium for mood stabilization for 15 years before initiating divalproex sodium therapy. He stopped using lithium because of the polyuria, but he felt that the polyuria never fully subsided. His weight is stable, and he has no other urinary complaints. His blood pressure is 115/80 mmHg and his physical exam is normal. His urinalysis shows no blood, cells, protein, glucose, nitrate, casts, or crystals.
What is the most likely cause of his polyuria?
1 Central diabetes insipidus
2 Nephrogenic diabetes insipidus
3 Polyuria secondary to hyperglycemia
4 Polyuria following acute kidney injury
5 Polyuria secondary to polydipsia
Answer:
The correct option is 2 Nephrogenic diabetes insipidus.
Explanation:
Nephrogenic diabetes insipidus (NDI) occurs when the renal tubule response to vasopressin (ADH) is weakened, resulting in the excretion of large volumes of dilute urine.
As the renal tubules do not respond to vasopressin (antidiuretic hormone) and are unable to reabsorb filtered water back into the body, the kidneys create a high volume of dilute urine in nephrogenic diabetes insipidus.
Nephrogenic diabetes insipidus (NDI) can be inherited or develop as a result of disorders that impede the ability of the kidneys to concentrate.
Therefore, the correct option is 2 Nephrogenic diabetes insipidus.
That is, the most likely cause of his polyuria is nephrogenic diabetes insipidus.
Photosynthesis in plants is an example of
Answer: If you are asking if your answer is correct, it is. Photosynthesis is the process of converting sunlight into food and energy, therefore it is an example of nutrition.
Photosynthesis in plants is an example of nutrition
What is photosynthesis?
Photosynthesis is the process by which plants use sunlight, water, and carbon dioxide to create oxygen and energy in the form of sugar.
It is carried out by algae, plants and even some microorganisms.
The sugar produced form photosynthesis is a great source of nutrients for photosynthetic organisms and plants.
Therefore, photosynthesis in plants is an example of nutrition
Learn more about photosynthesis here:
https://brainly.com/question/3529377
#SPJ9
Complete the T-chart by categorizing each environmental factor as something that would most likely increase or decrease genetic variation. Some answers will fit in both columns depending on the situation.
Predator-prey relationships
Competition
Toxins
New habitat
Disasters
Increased food source
A 2-column table has columns with labels Increase variation and decrease variation.
Answer: 1. Decrease 2. Decrease 3. Both 4. Both 5. Decrease 6. Increase
Explanation: I got it right hopefully it helps
Answer:just did it
Explanation:
which sequence demonstrates the increasing complexity of levels of organization in multuticelluar organisms ?
A organelle_cell_tissue_organ_organ system_oraganism
B cell_organelle_tissue_organ_organsystem organisms
C organelle_tissue_cell_organ_organ system organisms
D cell_organism _organ_organ system _tissue_organelle
Answer:
it's A
Explanation:
It's just a simple chain. Many Organelles form cell, many cells form a tissue, many tissues together form an organ, various organs together form an organ system and different organ systems together make a complete organism.
I hope it helps :))
In what part of the plant are substances transported to where they are needed?
A. Roots
B. Stem
C. Leaves
Answer:
B. Stem.
hope it helps
stay safe healthy and happy.Answer:
B. Stem
Explanation:
In the stem part of the plant are substances transported to where they are needed. So, the option (B) is the correct answer.
The number of small tree finches is increasing on an island inhabited by a large population of small ground finches. State one reason why the population of small ground finches has not been affected by the increasing number of small tree finches.
Answer:
yes
Explanation:
Nick has had a very stressful job for more than 10 years. At Nick’s annual doctor’s visit, what effects would the doctor most likely identify in Nick?
Answer:
don't known ask the goggle
Gizmos ( Building DNA )
Activity A :
Question : What is the structure of DNA
Build : follow the steps given in the gizmo to construct a molecule of dna
Answer:
Double Helical Spiral structure
Explanation:
DNA is a helical spiral structure in which two long strands of nucleotide form a double helix structure.
It looks like a structure of ladder in which the phosphate and sugar molecules from the side of the ladder and the base pairs form the rungs.
what is sustainable development?
what is environmental conservation?
Give short answer
Answer:
The long term development which is done by the preservation ,utilization and management of resources which is used by present generation and with preservation for future generation is sustainable development.
the conservation of habitat of living beings and plants is called environment conservation.
what is a good definition of photosynthesis?
A. using glucose to create light
B. putting together lights so we can see
C. using light to put together food (glucose)
Answer:
The best answer is C
Explanation:
Plants use light to create their own food. this is called photosynthesis
Answer:
C
Explanation:
The process of photosynthesis uses light to create food and uses other gas like carbon dioxide.
IS THIS CORRECT?? IF NOT WHATS THE ANSWER PLEASE
What is the main function of the endocrine system?
A. secrete hormones
B. send nerve impulses
C. produce blood cells
D. produce DNA
Answer:
I think the answer to your question is option A , secrete hormones
2. Ang
ay isang genre na gumagamit ng mahika at
iba pang supernatural na penomena bilang punong elemento
ng plota, tema, at/o ganapan.
A. Pabula B. Drama
C. Pantasya D. Mga Tula
Answer:
C. Pantasya
Explanation:
Ang anumang genre ng pantasya ay magkakaroon ng isang uri ng supernatural o magic na tema na isinama dito
Sana nakatulong ito :)
helppppppp plzzzzzzzzzzzzzzzzz
Answer:
A
Explanation:
Im not sure what this is but im pretty sure its A it just seems the most logical but once u get someone good to answer this tell me if u got it right or not im curious bhaaajjajaja
A city installs recycling centers that take wood products. How might the
recycling centers help increase the availability of wood?
O A. Recycling increases the cost of wood.
O B. Recycling increases the consumption of wood.
C. Recycling increases the supply of wood.
D. Recycling increases the demand for wood.
Answer:
C. Recycling increases the supply of wood
Which of the following organelles is properly matched to it's function?
lysosome: storage
endoplasmic reticulum: movement
lysosome: digestion
chloroplast: making proteins
The organelle properly matched to it's function is
-(C) lysosome: digestion
Explanation:
Lysosomes : It hold enzymes that were created by the cell. The purpose of the lysosome is to digest things. They might be used to digest food or break down the cell when it dies
Endoplasmic reticulum : to produce proteins for the rest of the cell to function.
Chloroplast : They are responsible to carry out photosynthesis
When considering ecosystem biodiversity, why would it be dangerous to treat each ecosystem as an isolated environment?
1. each ecosystem has a constant and consistent number of predators
2. rainfall is global occurrence that impacts every ecosystem on the planet
3. environmental conditions appearing in one ecosystem may appear in another
4. there are complex interactions that take place between ecosystems
Answer:
1
Explanation:
they can never be mixed
what are alleles mutations in the dna
Answer:
Mutations Are Recessive or Dominant
which process reduces the number of chromosomes by half
Answer:
Meiosis process reduces the number of chromosomes by half.
Explanation:
Meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half and produces four gamete cells.
Answer:
meiosis
Explanation:
meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half and produces four gamete cells
What are the products (comes out) of cellular respiration? (select all that apply)
A. Carbon dioxide
B. oxygen
C. Water
D. Glucose (sugar)
What are the products (comes out) of cellular respiration? (select all that apply)
A. Carbon dioxide
B. oxygen
C. Water
D. Glucose (sugar)
Well Well Hello again XD, trust me when i say i'm not stalking you UvU...i'm just really into biology XDAnyway the answer to your question is:
Carbon dioxide and Water!!I apologize if i'm wrong//You're welcome if i'm correct((-Side Note-)): glad i could help lol
I hope you have a great day ^v^"How are the early stages of embryonic development different from the later stages of development?
Needed substances are carried to the body cells by:
A)enzymes
B)blood
C)water
D)food
The direction of force of Earth's magnetic field is from the geographic South
Pole to the geographic North Pole. Where is Earth's magnetic north pole?
O A. Near Earth's center
O B. Near Earth's equator
O C. Near Earth's North Pole
O D. Near Earth's South Pole
Bacteria and fungi fulfill which role in an ecosystem?
A. Consumer
B. Decomposer
D. Producer
Answer:
B. Decomposer
Explanation:
Bacteria and fungi fulfill the role of decomposers in an ecosystem. Hence, option (B) is the correct answer.
What is likely to happen to a healthy population that is experiencing exponential growth ?
What is the smallest LIVING part of an organism?
A. Molecules
B. Cells
Answer:
Hi, there the answer is a cell
Explanation:
The smallest living part of an organism is a cell. The cell is the smallest structural and functional unit of living organisms, which can exist on its own.
Answer:
B. Cells
Explanation:
The cells are the smallest living part of an organism.
Four friends were talking about the food they ate. Here is what they were discussing. • Kaustubh: ' It gives us energy to walk, run and lift things." • Shailaja: "It becomes a part of our body." • Jayasree: "It helps to fight diseases." • Aarti: "It is needed for the functioning of organs like the heart, brain and lungs." Who is correct?
