A major failing of the United States Government under the Articles of Confederation was its

Answers

Answer 1
They did not charge taxes which was a major fail and they also could not raise a military and they could also not enforce laws

Related Questions

state the duties faction and the responsibilities or the role of the three branches of the government

plss pa help naman po dito ​

Answers

Answer and Explanation:

The executive branch is responsible for the application of federal, state and local laws in society, as well as the application of repressive measures for those who disobey them. In summary, we can affirm that the executive power has as main responsibility the administration of the territory, proposing action plans, managing public interests and applying the laws. In addition, it is the responsibility of the executive to oversee legislative and judicial powers.

Legislative power is responsible, as its name already says, for legislating, that is, it is responsible for creating and approving the laws in force in the country. In addition, it is the responsibility of that governmental sphere to manage the administrative political and financial budgetary control of the region. It is also responsible for overseeing the judicial and executive powers.

The judiciary is responsible for interpreting the laws passed in the country and making judgments applying those laws to reach concrete conclusions on legal cases. In addition, it is responsible for overseeing the executive and legislative powers.

It was the year Muhammad became the spiritual and political leader of mo
Which of the following are teachings contained in the Qur'an? Select
three correct answers,
Muslims cannot own slaves.
People cannot convert to Islam.
Muslims cannot eat pork or drink alcohol.
Muslims must wash themselves before praying
People will not be punished for disobeying God.
Women have the right to own property, earn money, and get an education.

Answers

Answer:

Muslims cannot own slaves.

Muslims cannot eat pork or drink alcohol.

Muslims must wash themselves before praying .

Women have the right to own property, earn money, and get an education.

Explanation:

As we can see there are four correct answers, as Muslims cannot own slaves. If they have them, they must release them. It is forbidden to drink alcohol or to eat pork.

Washing before praying is necessary to be pure in front of the God.

Woman have many rights including those above.

Which would allow humans to access groundwater?

a well drilled into an aquifer
a well drilled above the water table
an aquifer capped by thick granite
layers of soil and rock above the water table

Answers

Answer:

A well drilled into an aquifer.

A well drilled into an aquifer would allow humans to access groundwater

What is groundwater?

The water below the ground is called groundwater. It comes from underground cracks and spaces in the soil.

Access to ground water can be gained if we dig a well or use any source that can provide us an access below the water table.

Hence, the objects that allow humans to access ground water are:

A springA well drilled into an aquiferA well drilled below the water table

Learn more about groundwater here : https://brainly.com/question/11765281

The ancient Indians can boast of few significant achievements.


Please select the best answer from the choices provided

T
F

Answers

Answer:

False

my ancestors were and we have many stories that are passed generation through generation.

Which activity describes an application of topographic maps? Check all that apply.
O recreation, such as camping and hiking
Oengineering, such as the construction of roads and buildings
O science, such as mapping stars in the sky
Obusiness, such as analyzing population centers
Oscience, such as analyzing surface features

Answers

Answer: Edge 20-21

(1) recreation, such as camping and hiking

(2)engineering, such as the construction of roads and buildings

(5)science, such as analyzing surface features

Explanation:

Got it right

How is the three-branch system of government reflected at the local, state, and federal levels?

Answers

Answer:

they are quit close the only difference is that with the state you can appeal and then go to the government level. hope this helps.

Explanation:

1.What are Europe’s six climate regions?

Semiarid



2.what are the six climate regions by shading in the rectangles next to each region you have listed above. Use a different shade for each region. Shade in your map to show the location of each region.



3.What are the four land regions that form Europe. Then label those regions on the map.



4. Label the Italian, Scandinavian, and Iberian peninsulas.



5. Label the Atlantic Ocean, Mediterranean Sea, Black Sea, and North Sea.

Answers

Answer:

5. label the atlantic ocean, mediterranean sea, black sea, and North sea

eating food what must be done before the action​

Answers

Answer:

washing your hands? if it's correct mark me brainliest :)

Explanation:

Why has Christkind traditionally been depicted as a female? Do you agree or disagree that this role should only be played by a female? Be sure to support your opinion with evidence.

Answers

Answer:

ok I'll do according to my opinions knowledge

Explanation:

im always told that female kind understand the biblical matter more than men do because of their capability and will and that almost anything that has to do with Christ they are stronger in biblical matters

(hope I kinda helped even a bit thanks)

Answer:

I think that the Christkind is a sprite-like child, because usually depicted with blond hair and angelic wings but, eventually the Christ Child began to be represented as a beautiful young female angel bringing the presents

Explanation:

Because Martin Luther intended it to be a reference to the incarnation of Jesus as an infant, but eventually the Christ Child began.

Kings say the dream of America is “as yet unfulfilled.” Do his words still hold true today?

Answers

Answer:

yes, because the world has not seen it's end we can only assume this is just the beginning. Not only are we still developing technology but we are creating a new path for ourselves and others. His speech was about how differences don't matter or they shouldn't but as it quotes "We hold these truths to be self-evident, that all men are created equal, that they are endowed by their Creator with certain unalienable rights, that among these are life, liberty, and pursuit of happiness." This is the dream. The first things we notice in this dream is an amazing universalism. It does not say some men, but it says all men. It does not say all white men, but it says all men, which includes black men. It does not say all Gentiles, but it says all men, which includes Jews.  It does not say all Protestants, but it says all men, which includes Catholics.

Explanation:

hope this helps

In light of the situation in Washington, D.C. on yesterday and the aftermath today;
respond to the following questions using complete sentences.
TAI
11.

Answers

Answer:

What question all there is is a 11

Explanation:

Which statement is the best counterargument to the statement "Younger drivers are more likely to be involved in an accident”?

Teens are more likely to be distracted when driving.
The government has a responsibility to keep all drivers safe.
Teen drivers are three times more likely to be involved in a fatal crash than drivers over age 20.
People are less experienced drivers at age 18, so accidents will still occur.

Answers

Answer:

c

Explanation:

because reports of crashes have been around the ages of 18 year old drivers

Answer:

its d

Explanation:

the other person is wrong i took da test

Given what culture means, given an examples of what might count as a cultural achievement.

Answers

Answer:

In general, cultural achievements are those taught informally within a culture, through socialization, as opposed to achievements mastered formally through schooling. ... Some examples of cultural skills expected in most of the United States today include speaking English, handling money, and using a telephone.

hope this helps! :)

Explanation:

Answer:Rubbish question no use u are in the wrong way

Explanation:

6. Why does DNA need to be organized into chromosomes before cell division?
The DNA would be too difficult to separate without this organization.
The DNA would take up too little space without this organization.
The DNA would be pulled apart rapidly without this organization.
The DNA would be broken without this organization.

Answers

Answer:

Explanation:

During mitosis, the chromosomes condense so that each chromosome is a distinct unit. Prior to mitosis, the cell copies its DNA so that it contains two copies of each chromosome. ... Condensing the DNA into tightly packed chromosomes makes the process of chromosome alignment and separation during mitosis more efficient.

why is the proclamation of 1763 anger colonist​

Answers

The proclamation of 1763 angered the colonist because it didn’t allow them to cross pass the Appalachian mountains. Which they could not claim land legally past it too have a nice day (:

Need someone to make me laugh I’ll mark brainlist

Answers

Hey wanna see something funny just look at a funny horse videos
21. A guy goes into a lawyer’s office and asks the lawyer: “Excuse me, how much do you charge?”

The lawyer responds: “I charge £1,000 to answer three questions.”

“Bloody hell – That’s a bit expensive isn’t it?”

“Yes. What’s your third question?”

A farmer has developed a new type of fertilizer. This new fertilizer costs 20
percent more to produce than the old fertilizer but has better results: The
same land now produces 25 percent more crops each year.
Which statement best describes one way the farm will be affected by using
this new fertilizer?
O A. The farm's marginal cost for fertilizer will increase.
B. The farm's opportunity cost for using fertilizer will decrease.
O C. The farm's opportunity cost for using fertilizer will increase.
O D. The farm's marginal cost for fertilizer will decrease

Answers

The farm's marginal cost for fertilizer will decrease because with new fertilizer the productivity of the land increases. So farmers need less fertilizer to increase production.  So, The farm's marginal cost for fertilizer will decrease.

The term "marginal cost" describes the rise in manufacturing costs brought on by the creation of more product units. A different name for it is the marginal cost of production. Businesses may evaluate how the volume produced affects the cost and eventually profits by calculating the marginal cost. The additional cost to produce a new well is known as the marginal cost. Say, for illustration, that it costs $100 to produce 100 vehicle tires. It would cost $80 to produce one more tire. The cost to produce one extra unit of a good or service is then known as the marginal cost. The marginal cost is determined by the production expenses.

Marginal costing is an excellent method for making decisions. It aids management in making decisions regarding pricing, contrasting various production techniques, setting production activity levels, shutting down production lines, and selecting which of a variety of prospective products to produce.

Learn more about Marginal Cost here: https://brainly.com/question/17230008

#SPJ1

Which best compares Henry Clay and Andrew Jackson?
Both Clay and Jackson belonged to the Democratic Party.
Both Clay and Jackson belonged to the Whig Party.
Both Clay and Jackson served in public office in the 1800s.
Both Clay and Jackson promoted the American System.

this is timed pls help now

Answers

A is correct, have a good day!

Answer: A

Explanation: I hope this helps

How do sellers in the weekly market try to earn maximum profit? ​

Answers

Answer:

Sellers sell goods by travelling in urban and rulers areas..

Do you know Jesus?

If not:
Do you agree the world is broken?
What can you do to fix it?

... Change first starts with yourself. Then, one person at a time, it changes the world.

Answer if you are ready to make a meaningful decision. Please include your first or last name if you would like.

Answers

Answer:

I know Jesus.

Explanation:

Answer:

I know Jesus.

Explanation:

This is a very good question :)

How is the nation responsible for its citizen?What does it expect from them in return? Mention four point​

Answers

Answer:

Obeying the law. Every U.S. citizen must obey federal, state and local laws, and pay the penalties that can be incurred when a law is broken.

Paying taxes. ...

Serving on a jury when summoned. ...

Registering with the Selective Service

Explanation:

States have the legal obligation to protect and promote human rights, including the right to social security, and ensure that people can realize their rights without discrimination.

In the 1800s, middle-class women in America had
few job opportunities.
many job opportunities.
many educational opportunities.
few chances to stay at home.

Answers

Answer:

few job opportunities

Explanation:

they didn't hade the same opportunities as men

Answer:

a

Explanation:

Out of these what should I NOT! name my blue Budgie Pt. 2
Blueberry
Amara
Cotton candy (candy for short)
jelly bean (really like this one)
lollipop
Im doing order of elimination until I get the one!! Let me know if you have more ideas!

Answers

Answer:

yea

Explanation:im learning about the same thing

Definitely not Amara

what it meant by valence electrons​

Answers

Answer: the electrons on the outer shell of the atom

Explanation:

does that make sense? do I need to clarify further?

The storage of water in pore space beneath the ground what

Answers

Answer: Groundwater Storage

Explanation: I think this is the answer

help me plz


he Temples at Abu Simbel
If you ever travel to Egypt, be sure to visit the two temples at Abu Simbel, a town on the banks of the Nile River south of Aswan. The history of their construction spans both ancient and modem times.

Then
Built around 1250 B.C.E., the Great Temple of Ramses II and the smaller Temple of Hathor next to it were carved out of a mountainside. This was no easy job. Four 67-foot-high statues of Ramses flank the entrance to the Great Temple. Inside, three inner chambers extend two hundred feet into the rock. The ancient Egyptians excavated these rooms and their massive columns using, of course, only hand tools. They also used detailed calculations to carefully align the temple. As a result, at dawn on two days of the year, sunlight reaches into the third chamber. This room was a sacred sanctuary, containing the statues of four gods. The sun's rays light up the statues and symbolically awake them to life.

Now
In the 1960s, Egypt built the High Dam to control the annual Nile floods. The lake that formed behind the dam would have covered the temples at Abu Simbel. Archeologists from Egypt and many other countries were alarmed, so they raised funds to move the mountainside. And that is what was done. Workers using handsaws cut the two temples into more than a thousand blocks. Each block weighed from 10 to 40 tons. The blocks were carried to safe ground 195 feet higher. Engineers then rebuilt the two temples inside a man-made concrete mountain. They were careful to place the Great Temple in the exact orientation of the original so that the gods of the sacred sanctuary are still awakened twice a year. This reconstruction was nearly as huge a feat as that of digging the temples from the rock in the first place.


Select the correct answer.
According to the author, why should a tourist go to Abu Simbel?
A.
The temples are a feat of ancient engineering.
B.
The temples are a feat of modern engineering.
C.
The temples are a feat of both ancient and modern engineering.

Answers

C.

The temples are a feat of both ancient and modern engineering.

In what way are subcultures and countercultures alike?
A. They both exist inside a larger culture.
B. They both want to destroy the larger culture.
C. They are both needed by the larger culture.
D. They both want to change a larger pulture.

Answers

Answer:

A

Explanation:

.............................

The subcultures and countercultures are similar in such a way that they both present inside a larger culture.

Option A is the correct answer.

What is culture?

Culture comprises the values and belief systems of individuals of a particular community that are used in dealing with the problems that arise in day-to-day lives.

A subculture is a component of larger culture but is actually present in a dominant culture. A counterculture is that part of a larger culture that totally goes against the societal norms of a country and also opposes the dominant culture and its norms.

Therefore, both the cultures, that is, subculture and counterculture belong to the larger culture.

Learn more about the culture in the related link;

https://brainly.com/question/8906148

#SPJ2

Who was Muhamad? What was he responsible for?​

Answers

Answer:

Who was Muhammad? Muhammad was the founder of Islam and the proclaimer of the Qurʾān, Islam's sacred scripture. He spent his entire life in what is now the country of Saudi Arabia, from his birth about 570 CE in Mecca to his death in 632 in Medina.

What is perspective ?


A . Painting Technique

B . Farming Method

C . Battle Strategy

D . Religious Meditation

Answers

Answer:

the answer would be d hope it helps

What can you infer about Georgia's capitals based on the map above?

Answers

Answer:

Events of the Civil War prevented coastal cities from industrializing. As coastal flooding worsened, the population of Georgia moved inland.

Explanation:

As new territories opened up, the population of Georgia shifted west.

Answer:

The population shifted westward, so the capitals did as well.

Explanation:

Other Questions
Calculate the volume of 1280 kilograms of aluminium if the density is 2700kg/m3 can you please help me:) What is a central idea in the Newsela article "Washed-Up Plastics Become Art with a Vital Message"?Children enjoy the art displays of sea creatures.Many people now look for trash to pick up when they are visiting the beach.Creating artwork can be both beautiful and horrifying.Increased awareness of the dangers of ocean pollution are creating interest in Pozzi's art.Question 2Part BWhich detail from the text best conveys the answer in Part A?"'It's the only thing he's liked all day,' his grandmother said.""An army of about 10,000 volunteers in Oregon help her collect, prepare and assemble the beach trash into art.""All of the art is made from plastic trash that washed ashore, including a great white shark""She now has more than 70 pieces in three exhibitions currently traveling throughout the United States. She also has requests from overseas." Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... paid rent of Rs.25000 by cheque. make journal entry Use a number line to order the numbers from least to greatest. HELLLPPPP!!!!! write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC RIP grandsonhow does earths crust change earths surface [2.1 + (9.2 x 3.3)] x 0.8 PLEASE HELPPFill in the blanks in the following sentences with the logical word(s). Pay attention to the pronunciation.Spell out the following numbers in french: 1. 200:2. 256:3. 987:4. 875:5. 435:Based on the context, fill in the blanks in the following sentences with either the logical word or the appropriate forms of voir or croire. Say the whole sentence aloud.6. Est-ce que tu crois________Paul va aller au cinma ce soir?7. Elles_________les pommes sur la table.8.________vous aux fantmes?Oui! Vous_________ce fantme, l! Mais non, je ne le___________pas! i need help lol i forgot how to do this y32c-4-3 -2 -1-1+1 2 3 4-2+-3+-4+41What is the slope of the line? Since she tried blueberry ice cream Black Canary hasrefused to eat any other flavor. Explain why the Hitler youth had only mixed success among the young German people. You may use the following in your answer comradeship (friendship), compulsory membership. hi...need help....thank you.. A restaurant customer left $1.35 as a tip...Plz help me Judah is unhappy with the color and exposure in some of his recent photographs.What might the RAW converter in his camera use to rectify this issue? Which number is a reasonable estimate for 637x35? SPANISH 2 SABER VS CONOCER *WILL MARK BRAINLIEST*1. la chica ____ nader bienA. sabe B. conoce 2. ___ a mi hermano?A. sabes B. conoces 3. Ud. ____ que hora es?A. sabeB. conoce4.Somos de Providence. Nosotros ___ la ciudad muy bien.A. sabemos B. conocemos 5. Yo no ____ a la profesora de historianA. se B. conozco Square ABCD has diagonals AC and BD . What is mABDA180B90C45D360