A person was modeling a declining population with a decay factor of 0.5 using pennies. They started with 100 pennies and flipped all 100 pennies. Any pennies that landed on tails were removed. Then, the remaining pennies are flipped again and again the ones landing on tails were removed. The process is repeated until no pennies are left. How many flips is the most reasonable expectation for when this model should reach 0 pennies?
4 flips

8 flips

12 flips

16 flips

A Person Was Modeling A Declining Population With A Decay Factor Of 0.5 Using Pennies. They Started With

Answers

Answer 1

Answer: 8 flips

Step-by-step explanation:


Related Questions

Another way to find slope is with the slope formula (y2-y1/x2-x1 find the slope of (3,2) (7,4)

Answers

Answer: 2/4=1/2

Step-by-step explanation: 4-2=2. 7-3=4

Answer:

1/2

Step-by-step explanation:

4-2=2

7-3=4

2/4


Gabriel lives and works in Michigan, which has a flat state income tax of
4.25%. If his annual salary is $69,255 and he gets paid once a month, how
much is withheld from his gross income for state income tax each pay
period?

Answers

Answer:4,050

Step-by-step explanation:

Withholding Rate: 4.25% | Personal Exemption: $4,400 | 2019 Michigan Income Tax Withholding Tables. Withholding Rate: 4.25% | Personal Exemption: $4,050 | 2019 Michigan Income Tax Withholding Tables.

A figure has been dilated from the origin by a scale factor of one seventh. if another dilation from the origin maps the dilated image back
onto the original figure, what is its scale factor?

Answers

Answer:

its scale factor is 3

Step-by-step explanation:

plz mark brainliest

To map the dilated image back  onto the original figure, the scale factor needed is 7.

Transformation is the movement of a point from its initial location to a new location. Types of transformation are rotation, reflection, translation and dilation.

Dilation is the increase or decrease in the size of a figure by a factor.

If a figure is dilated from the origin by a scale factor of one seventh, it is given by:

(x, y) ⇒ [(1/7)x, (1/7)y]

To map the dilated image back  onto the original figure, the scale factor needed is 7. Hence:

[(1/7)x, (1/7)y] ⇒ (x, y)

Find out more at: https://brainly.com/question/11707700

30 POINTS WOWWWWWW plz answer :)

Answers

Answer:                                                                                                                                      

Step-by-step explanation:

A consumer agency wants to determine which of two laundry detergents, A or B, cleans better. Fifty pieces of fabric are subjected to the same kinds of stains (grass, mud, coffee). Then 25 pieces are randomly assigned to be cleaned with detergent A, and the remaining 25 pieces are cleaned with detergent B. After being laundered, the pieces of fabric are rated on a scale of 1–10, with 1 being the least clean to 10 being the most clean. The mean rating for detergent A is found to be significantly less than the mean rating for detergent B.

Answers

Answer:

B is the better detergent

Step-by-step explanation:

If A has a lower number on the 1-10 scale, that means on average it was closer to the lower end, or the least clean end. This means that A cleans worse than B., and B is better.

The two laundry detergents B cleans better.

Although the questions seems to be tricky at the begging because of a lot of numbers, but actually it is not.

Given to us in the question that, 25 pieces are randomly assigned to be cleaned with detergent A, and the remaining 25 pieces are cleaned with detergent B.

Thus, we can say that the sample size for both detergent A and detergent B is same. Also, the sample is distributed randomly meaning the sample is unbiased (fair).

Also, as given the mean rating for detergent A is found to be significantly less than the mean rating for detergent B. And we know that the mean is the average of a set of given numbers.

Therefore, we can conclude that if detergent A has a lower mean meaning, it has cleaned the clothes with less effectiveness as compared to detergent B.

Hence, Out of the two laundry detergents, B cleans better.

To know more visit:

https://brainly.com/question/16967035

5/6 / 1/3 equals what ​

Answers

Answer:

[tex]\frac{5}{2}[/tex]

Step-by-step explanation:

Division of Fractions

Dividing fractions can be done in several forms. We'll use here the reciprocal of the denominator method.

Given the fractions:

[tex]\frac{a}{b}[/tex]

[tex]\frac{c}{d}[/tex]

The division:

[tex]\displaystyle \frac{ \frac{a}{b}}{ \frac{c}{d}}[/tex]

can be done by multiplying by the reciprocal of the denominator:

[tex]\displaystyle \frac{ \frac{a}{b}}{ \frac{c}{d}}=\frac{a}{b}\cdot\frac{d}{c}[/tex]

We are given the fractions 5/6 and 1/3. Their division is:

[tex]\displaystyle \frac{ \frac{5}{6}}{ \frac{1}{3}}=\frac{5}{6}\cdot\frac{3}{1}[/tex]

Simplifying:

[tex]\frac{5}{6}\cdot\frac{3}{1}=\frac{5}{2}[/tex]

Answer: [tex]\mathbf{\frac{5}{2}}[/tex]

5-4x=23
What's the value of x and please show your work. ​

Answers

Answer:

x = 9/2 or 4.5

Step-by-step explanation:

5-4x=23 |-5

5-4x-5=23-5

-4x=18 |*(-1)

4x=18 | /2

2x=9 |/2

x=9/2 or 4.5

Answer:

x = 4.5

Step-by-step explanation:

Subtract 5 from BOTH sides to start with:

5-5 = 0 (5 cancels out on left side) 23-5 = 18

New Equation: -4x = 18

Divide BOTH sides by -4

4 cancels out (x is left) 18/4 = 4.5

New: x = 4.5

need help right now due today I will get brainiest with all the answers

Answers

Answer:

9. 9 1/2

10. 1 1/2

11. 15 3/4

12. 1 1/3

13. 12 stores sell shoes.

14. the area of the floor is 7,606.625 ft²

15. 3 1/3

16. 4 skateboards

hope this helps. have a good day

If each of the numbers in the following data set were multiplied by 17, what
would be the median of the data set?
28, 58, 20, 14, 18, 71, 36
A. 986
B. 1207
C. 476
D. 612

Answers

Answer:

B

Step-by-step explanation:

3x-2y=1x+4y=33 elimination process ​

Answers

Answer:

x = 5 ; y = 7

Step-by-step explanation:

3x - 2y = 1       --------------------(I)

 x + 4y  = 33 ------------(II)

Multiply equation (II) by (-3) and then add. So, x will be eliminated and we can find the value of y

(I)            3x - 2y = 1

(II)*(-3)   -3x -12y = -99         {Now add}

                 - 14y = -98

                        y = -98/14

y = 7

Plugin y = 7  in equation (I)

3x - 2*7 = 1

  3x - 14 = 1

         3x = 1 + 14

         3x = 15

           x = 15/3

x = 5

For questions 1 – 6, find the area of the circle to the nearest hundredth.
Any help appriciated!

Answers

Step-by-step explanation:

The area of a circle is given by :

A = πr²

r is the radius of the circle

(4) Diameter = 22 cm

Since, radius = diameter/2

r = 11 cm

Now, area of the circle,

[tex]A=\pi \times (11)^2\\\\A=380.13\ cm^2[/tex]

(5) Diameter = 30 cm

Since, radius = diameter/2

r = 15 cm

Now, area of the circle,

[tex]A=\pi \times (15)^2\\\\A=706.85\ cm^2[/tex]

(6) Diameter = 4cm

Since, radius = diameter/2

r = 2 cm

Now, area of the circle,

[tex]A=\pi \times (2)^2\\\\A=12.56\ cm^2[/tex]

So, the area of circles 4,5 and 6 are 380.13², 706.85² and 12.56² respectively.

Write the slope intercept form of the equation of the line through the given points

Answers

Answer:

9) y = -3x - 4

10) y = -1/3x + 14/3

11) y = x - 1

12) y = -7/5x - 18/5

13) y = 3/5x + 9/5

14) y = -2x - 3

Step-by-step explanation:

For this explanation, let's use the last problem as the example. You would use the formula y=mx+b. The first thing you would need to find would be the slope, or m. So, you would find the slope and conclude the answer is -2. After that, you would solve for b and get the answer. Hope this helped!

plz help me i really beg of you!

Answers

Answer:

v = -122.5

Step-by-step explanation:

1: 2.3 + v/7 = -15.2

2: v/7 = -17.5

3: v = -122.5

Step 1: This is the given equation

Step 2: Here, 2.3 was subtracted from both sides of the equation to isolate v

Step 3: both sides of the equation were multiplied by 7 to get v = -122.5

Answer:

245 over 2

Step-by-step explanation:

just use a calculator and you should be able to get the question right

Determine whether the figures are similar.

Answers

Answer:

you don't have enough information, you would need one of the long lengths on the smaller parallelogram to determine similarity

Step-by-step explanation:

probably not enough info, have a good day!! stay safe

plz hellp me plzzzzzzzzzz​

Answers

Answer:

3n+6

Step-by-step explanation:

the length of a living room is 12 fert and its width is 10 1/2 feet. the length of the room is being expanded by x feet. select all the expressions that represent the area of the living room in square feet

Answers

Answer:

vbhjnkmlnkbjvhcgfdxgcvhbjnncnng

Step-by-step explanation:

cxvcxbvcbcvbvcbcvbvcvbb

Answer:

thanks

Step-by-step explanation:

2010
can
Regina had 30 meters of ribbon. She gave 2.7 meters of the ribbon to each
of her four friends and used the rest to tie some presents for her birthday
party. Each present required 75 centimeters of ribbon to tie. Find the
maximum number of presents Regina could tie.

Answers

Answer:

25 presents.

Step-by-step explanation:

First subtract 2.7(4) from 30.

30 - 2.7(4) = 19.2 meters

Now, convert 19.2 into centimeters.

There's 100cm in 1m, so 19.2 meters can be found by doing:

19.2 x 100 = 1920 cm.

Now, do 1920 divided by 75:

1920/75 = 25.6

Since you can't tie 0.6 of a present, you disregard that. So, she can tie 25 presents.

Which sequence of transformations takes A to its image A'?
A. a translation 1 unit down followed by a reflection in the x-axis
B. a reflection in the x-axis, followed by a translation 1 unit down
C. a translation 3 units to the left, followed by a clockwise rotation 180 about the origin
D. a reflection in the y-axis, followed by a clockwise rotation 180 about the origin

Answers

Answer:

a

Step-by-step explanation:

hope this help mark me brainlist plz

The correct sequence of transformations takes A to its image A' is,

⇒ A translation 1 unit down followed by a reflection in the x-axis.

What is mean by Translation?

A transformation that occurs when a figure is moved from one location to another location without changing its size or shape is called translation.

We have to given that;

The sequence of transformations takes A to its image A'.

Now, We have;

The coordinate of A are (4, 5)

And, The coordinate of A' are (4, - 4)

Hence, The correct sequence of transformations takes A to its image A' is,

⇒ A translation 1 unit down followed by a reflection in the x-axis.

Learn more about the transformation visit:

https://brainly.com/question/30097107

#SPJ3

s
is inversely proportional to
t
.
When
s
=
0.3
,
t
=
8

Work out
s
when
t
=
0.4

Answers

Answer:

s inversely proportional 1/t

s=0.3, t=8

s=k/t

0.3=k/8

k=0.3×8

k=2.4

find s when t=0.4

s=2.4/0.4

s=6.0 or 6

4. A rectangle has a diagonal of 8 cm. The diagonal creates a 60° angle at the base of the rectangle.
[2]
a. Draw a picture of the rectangle
[4]
b. Write an EXACT expression for the base and the height of the rectangle.
[2]
C. Use your expressions to find the EXACT area of the rectangle.

Answers

9514 1404 393

Answer:

  a) see attachment

  b) base: 4, height: 4√3

  c) area: 16√3

Step-by-step explanation:

a) The figure is drawn in the attachment

__

b) The side lengths of a 30-60-90 right triangle have the ratio ...

  1 : √3 : 2

Multiplying these by 4 gives the side lengths of each triangle created by the diagonal. The base (short leg) is 4 units; the height (long leg) is 4√3 units.

__

c) The area is the product of base and height:

  A = bh

  A = 4(4√3) = 16√3 . . . . square units

PLEASE HELP ASAP WILL GIVE BRAINLEIST!!
What is the circumference of this circle?

Answers

Answer:

37.7

Step-by-step explanation:

C = 2 pi r

C= πd

12× 22/7

= 264/7

= 37.71cm

A=
B=
Blank 1:
Blank2:

Answers

Answer:

a=3,b=1

Step-by-step explanation:

In a parallelogram opposite sides are equal/congruent.

Using this, we know that 3a-4=a+2 and b+1=2b

1st equation:

3a-4=a+2

-a       -a

2a-4=2

   +4 +4

2a=6

a=3

2nd equation:

b+1=2b

-b     -b

b=1

a=3, b=1

Solve for “z.”

Please help!

Answers

Answer: Z=5

Step-by-step explanation:

Solve the rational equation by combining expression and isolating the variable z

Liza types 180 words in 3 minutes. At
that rate, how many minutes does it
take her to type 1,260 words?

Answers

180 divided by 3 = 1 minute = 60 words
1260 divided by 60= 21
21minutes

The equation y = 3.5x represents the total cost y in dollars of buying x pounds of cheddar cheese at Art’s Deli. The graph below shows the total cost y in dollars of buying x pounds of cheddar cheese at Jon’s Deli. What conclusion can you draw about the cost of cheddar cheese at these delis? Cheddar cheese costs $4 more per pound at Jon’s Deli than Art’s Deli. Cheddar cheese costs $0.50 more per pound at Jon’s Deli than Art’s Deli. Cheddar cheese costs $3.50 less per pound at Art’s Deli than Jon’s Deli. You pay the same price per pound for cheddar cheese at both delis.

Answers

Step-by-step explanation:

i think its X=2.75

Please help me asap this is due in 10 min Ill also mark brainliest

Answers

As we know that formula of area of circle is πr²

So let's apply formula

π×8.6×8.6

=232.2

=200 is the nearest hundredth.

You have to do rest of all through this method.

1) 232.35 2) 52.81 3) 373.25

In a basketball game Jamarcus made 15 out of 25 shots and tyrell made 32 out of 50 shots who’s the better shooter

Answers

Answer:

Jamarcus is the better shooter

Step-by-step explanation:

Jamarcus is better because he needs 10 more shots to reach 25 while tyrell needs 18 More shots to make 50

Answer:

Tyrell

Step-by-step explanation

Well this is simple you take Jamarcus shots made and divide it into the total shots which is 15/25=0.6 or 60%. So Jamarcus made 60% of the shots attempted. Tyrell made 32 out of 50 shots so that will be 32/50=0.64 or 64%. Since 64%>60% Tyrell is the better shooter

Andre purchased 1 quart of lemonade
from a concession stand for $1.50.
Which shows the rate for 6 quarts of
lemonade?

Answers

Answer:

7

Step-by-step explanation:

The price of an item has been reduced by 15%. The original price was  $87.​

Answers

Answer:

The new cost is $73.95

The discount was $13. 05

Step-by-step explanation:

Turn the % into a decimal so it would be 0.15.

Then multiply it to the total, 87 x 0.15 = 13. 05

so the discount subtracted $13.05 off of the original price.

87 - 13. 05 = 73.95

2x2 + 8x - 7 = 0
How to solve

Answers

x =(8-√120)/4=2-1/2√ 30 = -0.739

Step-by-step explanation: calculator

Answer:

2 x 2 +8x -7= 0

4+8x-7=0

-3+8x=0

8x=0+3

8x/8=3/8

x=3/8

x=0.375

Step-by-step explanation:

1.Multiply 2x2 to get 4

2.Calculate the difference between 4-7

3.Move the constant to the right side

4.Divide both sides of the equation by 8

Other Questions
Carolina, t ___________________ un lpiz?a. tieneb. tengoc. tienesd. tenis witch issue is a greater challenge bc of population growth in the west?a. inadequate water recoursesb. more frequent earthquakesc. removal of trade barriersd. heavy rainfall 20 pointsI need help asappp what is the temperature in the fahrenheit? 10-2+3x19-8= first to answer will get brainlyest Write an equation to find x by substituting.3. What does it mean to substitute here?5x - 2 = 3x +4 A rocket is launched from a tower. The height of the rocket, y in feet, is related to the time after launch, x in seconds, by the given equation. Using this equation, find the time that the rocket will hit the ground, to the nearest 100th of second.y=-16x^2+116x+75 Use the right triangle shown to answer the question.2632*not drawn to scaleWhat is the approximate value of x? A 7-pack of tickets to the zoo costs $78.61. What is the unit price? can someone help me understand this better on what she means by this with procedures The table represents a function.What is f(-2)?0 -3-6-2f(x)314-2O-1O 1O 3 In 1965 King and his wife, Coretta Scott King, led demonstrators on ahistoric 54-mile march that took five days, from where to where? HELPPPPPPPPPPPPPPP!!!!!!!!!!! BRAINLIEST IS ON THE LINE!!!!!!!!!!!!!!!!!Write a summary for Macbeth Act 1 Scene 2. What is the answer to question 7, NH4C2H3O2 what country has not experienced balkanization? 3(2(8-2x4)+25divided by 5 )-(2(8 divided by 4x2)-7(7-2x3) can you please help me:) write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC y32c-4-3 -2 -1-1+1 2 3 4-2+-3+-4+41What is the slope of the line? A restaurant customer left $1.35 as a tip...Plz help me