A physical change is...
—
1. when a substance changes its appearance or form, but not its identity.

2. when a substance changes into a new substance.

3. when a substance catches on fire.

4. when a substance reacts with another substance.

Answer:

Explanation: If resources are limited in nature than only the organisms that adapt to their surroundings will survive- Darwin's studies proved these theories.

Answer:2nd Answer Choice: It creates genetic variation within the organisms

Explanation:

I am in ap biology so I know this.

Answer:

Food Chain

Explanation:

Food chains show where the energy starts and where the energy can end up from all of the consumers´ eating their prey.

Answer:

Food chains and food webs are usually used to display the order of predation and the flow of energy in an environment. The answer is Food Chain

Answer:

3

Explanation:

carbohydrates are energy giving food such as rice

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

Answer:

O2 contains only one type of atom.

Explanation:

Answer:

2 elements chemically joined together. An emample is Ironoxie

Explanation:

Answer:

A compound is a mixture of elements.

Explanation:

examples:

Calcium carbonate

Potassium nitrate

Hydrogen peroxide

Water

Answer:

B

Explanation:

I took the test 1 hours ago

Answer:

the answer is the first one

dicot have not vexation and they have two cotyledons while the monocot have one cotyledons.

example of monocot can be maize,wheat in total all cereal are monocot while all legumes are dicot

HOPE IT HELPED

Answer:

MONOCOT, DICOT, DICOT, MONOCOT

Explanation:

Answer:

The correct answer is -  D) Glucose – a sugar found in blood that can be broken down to produce ATP

Explanation:

Insulin is a hormone produced by the beta cells of pancrease that takes up the glucose from the bloodstram and make gucose available to the cells of the body to produce energy by the process of cellular respiartion. Glucose is breaken down to its smaller units and produced high amount of energy in the form of ATP. Glycogen is form of sugar that is stores in the muscle and othe cell for the energy in abscence or low glucose level in blood stream. ADP is a molecule know as adesnosine pyrophosphate or diphosphate which is play role in flow of energy. ADP molecules requires energy to form ATP molecule and when ATP splits into ADP and Pi releases high amount of energy.

Answer:

D glucose – a sugar found in blood that can be broken down to produce ATP

Explanation:

I took it on eng

Answer:

The ATP molecule can store energy in the form of a high energy phosphate bond joining the terminal phosphate group to the rest of the molecule. In this form, energy can be stored at one location, then moved from one part of the cell to another, where it can be released to drive other biochemical reactions.

In a process called cellular respiration, chemical energy in food is converted into chemical energy that the cell can use, and stores it in molecules of ATP. ... When the cell needs energy to do work, ATP loses its 3rd phosphate group, releasing energy stored in the bond that the cell can use to do work.

Answer:

Mitosis is the cell cycle for somatic cells which are diploid (2n).

Meiosis is the cell cycle for germ cells (gametes) where they are haploid (n) so that is why they have two sets of phases.

Explanation:

Answer:

A

Explanation:

Enzymes are proteins.

Answer:

sugar that is burned off gives an odor and turns brown and then black is a chemical change

answer: The atoms of different elements all have different numbers of protons. Meanwhile, the mass number of an atom consists of the total number of protons and neutrons it contains

Explanation:

Answer:

cellular respiration.

Explanation:

"Cellular respiration is the process by which organisms combine oxygen with foodstuff molecules"

- Brittanica

Answer:

Explanation:

Cellular respiration i belive

Answer:

Melting

Explanation:

Metamorphic because it is characterized as "..rock that has undergone transformation by heat, pressure, or other natural agencies.."

Explanation:

The Holocene extinction, otherwise referred to as the sixth mass extinction or Anthropocene extinction, is an ongoing extinction event of species during the present Holocene epoch (with the more recent time sometimes called Anthropocene) as a result of human activity.[3][4][5] The included extinctions span numerous families of plants[6] and animals, including mammals, birds, reptiles, amphibians, fishes and invertebrates. With widespread degradation of highly biodiverse habitats such as coral reefs and rainforests, as well as other areas, the vast majority of these extinctions are thought to be undocumented, as the species are undiscovered at the time of their extinction, or no one has yet discovered their extinction. The current rate of extinction of species is estimated at 100 to 1,000 times higher than natural background extinction rates.

.

please. follow. me

Answer:

Meiosis is broken down into several stages. Each cell in the process of meiosis involves the cell growing, dividing, splitting, and dividing again in order to produce the four cells at the end of the process. This cellular process is one of the more common processes of biology, but it is also the reason why people have some traits over others.

Explanation:

The difference between mitosis and meiosis is in the process by which each form daughter cells from a parent cell. Mitosis has one round of cellular division and genetic separation whereas meiosis has two rounds.

The key difference between haploid and diploid is that haploid is the state of having half the usual number of chromosomes while diploid is the state of having the usual number of chromosomes in the genome of a cell.

Answer: Photosynthesis

Explanation: I had this question to and it should be correct. I’m sorry if not.

Answer:

Plant cells have a cell wall and chloroplasts and the cell wall gives the cell a rectangular shape unlike animal cells which have a round shape because we only have a cell membrane.

Answer:

plant cells have a cell wall . animals do not have and one structure that looks very different in a plant and animal cell

Explanation:

That would be False

Explanation:

Answer:

False

Explanation:

False because cells can reproduce in two ways. Mitosis, the process of making new body cells or cell division. OR Meiosis where there is genetic information transfered  between cells such as how humans are made.

All cells do not divide and reproduce the same way since there are two methods for cells to divide. So, the given statement is False.

The process by which a parent cell divides into two daughter cells is known as cell division. Cell growth and chromosome replication precede cell division, which often happens as part of a longer cell cycle. Usually, cell division happens as part of a longer cell cycle where the DNA is reproduced as the cell nucleus divides during cell division.

Meiosis and mitosis are the two processes through which cells can reproduce. The process of creating new body cells, or mitosis, differs from meiosis, which is the process by which genetic material is passed between cells, as in the creation of humans. Thus, not all cells divide and reproduce in the same way.

Therefore, the given statement is False.

Learn more about Cell division, here:

https://brainly.com/question/29773280

#SPJ2

Answer: The nucleus contains DNA.

Answer:

1. both

2. Plant cell

3. Plant cell

4. both

5. Plant cell

6. Both

7. Both

Explanation:

Plant cells have a cell wall and a cell membrane, unlike animal cells that only have a cell membrane.

Both have a cytoplasm, vacuole, mitochondria, and a nucleus.

Hope this is correct. Good luck with your studies.

Both plant cell and animal cell have a nucleus, mitochondria, cytoplasm, and cell membrane. Only a plant cell have cell wall, chloroplast and vacuole.

Plant cells are the unit of plants. These cells are present in all green and non-green cells in a plant. However, an animal cell is the fundamental unit of an animal. Different types of animal cells make up an organism.

Plant cell contain an outermost covering called the cell wall. It protects them from shock and provides mechanical strength to the cell. It is absent in the animal cell.

Chloroplast is also present in the plant cells whereas it is absent in the animal cells. It is a double-membranous structure. A chloroplast is responsible for the process of photosynthesis as it contains chlorophyll pigment. A vacuole is also present in the plant cell and absent in an animal cell. The vacuole is responsible for the storage of reserved food materials in the form of complex sugars.

Learn more about Plant cell here:

https://brainly.com/question/1493437

#SPJ2

Answer:

c

Explanation:

I ..........

Answer:

seismic waves caused earthquakes and caused the plates to shift

Explanation:

Answer:

FALSE

Explanation:

commen sense