A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include

Answers

Answer 1

Answer:  Identify the promoter and the stop signal (terminator).

Explanation:

DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.

The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.

DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).

Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.

To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.


Related Questions

what animal eats fiddler crabs?

Answers

Gulls, crows and herons are all opportunists. They'll eat just about anything that they can get their beaks on. That includes fiddler crabs.

Answer:

Predators that feed on fiddler crabs include herons, egrets and raccoons. At one to two years, the fiddler crab reaches sexual maturity.

Explanation:

1. Identify the 4 major body systems shown below
A.————
B.————
C.————
D.————

Answers

A. Circulatory system
B. Nervous system
C.respiratory system
D. Digestive system
Hope this helped

Select the correct answer. A roasted chicken multigrain sandwich contains 42 g protein, 7 g fat, and 34 g carbohydrates. How much energy does the sandwich provide? A. 747 calories B. 542 calories C. 502 calories D. 367 calories E. 332 calories

Answers

Answer:

D. 367

Explanation:

If a roasted chicken multigrain sandwich contains 42 g protein, 7 g fat, and 34 g carbohydrates, it contains 367 calories of energy, hence option D is correct.

What is food energy?

Animals obtain the chemical energy known as "food energy" from their food in order to maintain their metabolism, which includes their muscular activity.

The majority of animals get most of their energy via aerobic respiration, which involves mixing carbs, lipids, and proteins with air or water-based oxygen.

To find the total calories, multiply the given biomolecules grams with their calorie count.

= 42 × 4 + 7 × 9 + 34 × 4

= 168 + 63 + 136

= 367 calories

Therefore, the sandwich provides 367 calories of energy, if it contains 42 g protein, 7 g fat, and 34 g carbohydrates.

Learn more about energy, here:

https://brainly.com/question/839331

#SPJ5

3. Which of the following statements best explains how the cell membrane 1 point
is selectively permeable? *
The movement of specific substances into and out of the cell is controlled by the cell
membrane
The movement of waste substances into, but not out of the cell is controlled by the
cell membrane
The cell membrane is inflexible and cannot control the movement of substances into
and out of the cell
The cell membrane does not surround the cell so it plays no role in the movement of
substances

Answers

Answer:

The movement of specific substances into and out of the cell is controlled by the cell membrane.

Explanation:

The cell membrane is permeable, so it allows for the passage of substances both into and out of the cell. It is also selective, so only specific substances can enter and exit the cell.

Please Help I will Mark Branliest for first answer Please

Answers

Answer:

to break down waste and worn-out cell parts

Explanation:

What occurs when someone exhales? A. The rib cage contracts, but the diaphragm relaxes. B. Both the rib cage and the diaphragm relax C. Both the rib cage and the diaphragm contract. D. The rib cage relaxes, but the diaphragm contracts

Answers

Answer:

Answer is A ............

Edit: its actually D... i just verified

Answer:

The answer be D if you doubt you can try out the practical yourself.

A team of science researchers is trying to decide which type of microscope to purchase for their laboratory. Compared to electron microscopes, a light microscope provides which of these drawbacks or disadvantages?
A. uses electricity
B. specimens cannot be alive
C. lower magnification power
D. more expensive to purchase and operate​

Answers

Answer:

d

Explanation:

The drawback or disadvantage associated with the use of light microscopes over electron microscope is its lower magnification power.

LIGHT MICROSCOPE:

Light microscope is a type of microscope in which photons of light is used to view specimens.

The light microscope is distinct from the electron microscope being that electron microscope uses beam of electrons instead.

One advantage of light microscope is that it can view specimens alive while electron microscope can only view dead specimens.

However, one disadvantage associated with the use of light microscope is that it possesses a lower magnification compared to electron microscopes.

Learn more at: https://brainly.com/question/4442916

What are the functions of the digestive system?

Answers

Answer:

The function of the digestive system is digestion and absorption.

Explanation:

Digestion is the breakdown of food into small molecules, which are then absorbed into the body.

What evidence does the author provide to support the claim that biomass can help companies save money?

A Biomass can be converted to other useable forms of energy, such as methane gas, or transportation fuels, such as ethanol and biodiesel."

B About 80% of the wood and wood waste fuel used in the United States is consumed by industry, electric power producers, and commercial businesses."

C Many manufacturing plants in the wood and paper products industry use wood waste to produce their own steam and electricity."

D There are about 76 waste-to-energy plants in the United States that nenerate electricity or produce steam."

Answers

Answer:

C

Explanation:I took the test and I got 100% hope it helps

A type of circuit that has only one path is called a —

Group of answer choices

series circuit

parallel circuit

open circuit

closed circuit

Answers

The answer is series circuit.

what are the three age categories labels between childhood and adulthood

Answers

Answer: Early adolescence, middle adolescence, and late adolescence.

brainliest or a thank you please :)) <33

Is this person male or female? Why? :l

Answers

Answer:

I think Female because hey aren't any Y chromosomes

hope this helps

have a good day :)

Explanation:

when are chromosomes (dna) copied?​

Answers

Answer:

Interphase begins with G1 (G stands for gap) phase. During this phase, the cell makes a variety of proteins that are needed for DNA replication. During S phase, which follows G1 phase, all of the chromosomes are replicated. Following replication, each chromosome now consists of two sister chromatids.

Have a good day. :)

Answer:

Chromosome replication

Explanation:

Chromosome replication is a key event during the cell cycle that must be completed before a cell divides. To reproduce successfully, every cell must replicate its chromosome and distinguish these sister chromosomes from one another.

Which of the following best describes Darwin's (and Wallace's) theory of evolution?

Question 1 options:

Organisms adapt during their individual lifetime and then pass on that adapted trait to their offspring.


The different species appeared on our planet in a random fashion. There are no reasons for why animals are in the locations they are in or have the features they have.


Galapagos finches have changed over time to get longer beaks to be able to eat the seeds on the island


The diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection.

Answers

Answer:

4

Explanation:

The diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection according to Darwin's (and Wallace's) theory of evolution.

Natural selectionNatural selection is the process through which populations of living organisms adapt and change.It is a key mechanism of evolution, the change in the heritable traits characteristic of a population over generations.In 1859, Charles Darwin set out his theory of evolution by natural selection as an explanation for adaptation and speciation.

Thus, we can conclude that The diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection.

You can learn more about the natural selection here:

https://brainly.com/question/23929271

#SPJ2

Organisms that are better able to survive are more likely to _______ and pass on their traits.

Answers

Answer: make

Explanation:

HELP right now please! No websites

Answers

Carbon dioxide is the name of the molecule I believe
CO2. Carbon Monoxide

which two layers of the atmosphere are responsible for the majority of solar radiation absorption?

Answers

Answer:

The stratosphere and thermosphere.

Explanation:

the stratosphere and the thermosphere

If some bacteria are resistant to tetracycline and some are not resistant, what happens when a patient is given tetracycline for an infection?

Answers

Answer:

Antibiotic resistance happens when germs like bacteria and fungi develop the ability to defeat the drugs designed to kill them. That means the germs are not killed and continue to grow. Infections caused by antibiotic-resistant germs are difficult, and sometimes impossible, to treat.

Explanation:

hope this helps:)

the process which takes place in guard cells but not in other epidermal cells is?​

Answers

Answer:

guard cells chloroplasts , involved in the photosynthesis where epidermal cells are living cells covering the outside surface of the herbaceous plants they contain a thick covering of cutting which reduces the water loss from Plants epidermal cells in roots are specialized for water and ion absorption don't know if it helped but good luck

Photosynthesis

The process by which green plants and some other organisms use sunlight to synthesize foods from carbon dioxide and water. The upper and lower epidermal cells do not have chloroplasts, thus photosynthesis does not occur there.

Difference in guard and epidermal Cells:

Two guard cells form a stoma, controlling the gas exchange of the plant by regulating the size of the stoma whereas epidermal cells provide a protection to the plant from the external environment.

Photosynthesis does not take place in epidermal cell because:

The epidermal cells that make up this skin are transparent. As most epidermal cells lack chloroplasts, they can't perform photosynthesis, or the use of sunlight to convert carbon dioxide and water into glucose and oxygen.

Learn more:

brainly.com/question/9498584

THIS IS EARTH SCIENCE
PLEADE ASNWER THE Two QUESTIONS IN THE PICTURE

How do ocean currents affect the coastal regions of S.America at 20 degrees south latitude

When a lake freezes over. How does the energy content of the lake change?

Answers

Answer:

Explanation:The remaining air (air that does not descend at 30 degrees North or South latitude) continues toward the poles and is known as the westerly winds, or westerlies

Question: How do ocean currents affect the coastal regions of S.America at 20 degrees south latitudeAnswer: Warm and cold ocean currents can affect the climate of an area along the coast if the winds blow in from the ocean. Warm ocean currents heat the air above the water and carry the warm air to the land, increasing the temperature of the coastal regionQuestion: When a lake freezes over. How does the energy content of the lake change? Answer: Liquid water has more energy than frozen water. When water freezes it gives up some of the water's energy. This energy that is given up is the latent heat of freezing. When the water was freezing latent heat of freezing energy was being released(WATER IS THE LAKE)Bonus: I know that during melting, there is no temperature change as the heat energy is used to do work against potential bond energy but why doesn't temperature change when freezing? Freezing is the opposite process of melting. If the temperature does not increase as the ice melts, the temperature will not decrease as water freezes. Melting and freezing are entropy changes. Entropy measure the amount of disorder in a system. A system, like ice, which has less freedom of motion, has less disorder. A system, like liquid water, which has more freedom of motion, has more disorder. So water has more entropy than ice. Ice is a very ordered arrangement of H2O molecules in a crystalline form. As heat energy is added to ice, the energy is used the break the bonds between the H2O molecules in the ice crystals. So, the temperature remains constant. You might say that the energy that is added to the ice is used to increase the entropy of the system, instead of increasing the temperature of the system.-TAY brainly please

What would happen if there is an obstruction in the vas deferens?​

Answers

A transfer of sperm to a female

Two different populations of birds live in the same area and eat the same types of food. Which most likely describes the relationship between these two populations of birds?

A. Competition

B. Mutualism

C. parasitism

D. predator-prey

Answers

Answer:

A. Competition

Explanation:

Both species of bird need to compete for limited resources, in this case they need to compete for both territory and food

Answer:

Competition

Explanation:

Do convection currents exist in Earth's crust?

Answers

Answer:

yes convection currents occur in earth's crust I hope this helps

yes convection exsists on earths crust.

I neeed help plsss hurry

Answers

Answer:

Genotype for AB: IA and IB

Genotype of for O: ii

Write a scientific explanation as to “What is the main cause of global warming?"

Answers

Answer:

It is the aspect of climate change

Explanation:

Referring to the long term rise of planet's temperatures,it is caused by increased concentrations of greenhouse gases in atmosphere

Answer:

Excess C02 in the atmosphere caused by coal burning, exhaust, factory smokestacks, and deforestation.

Explanation: i am sorry if this is wrong

Trees in a temperate deciduous forest compete for all of the following EXCEPT -
A sunlight.
B shelter.
C soil.
D water.

Answers

Answer:

B

Explanation:

Trees needs sun, soil (nutrients), and water to grow and become strong.

I hope this helps ^-^

The answer is b hope this helps trees need soil water and sunlight to grow

Select the correct answer.
Which activity does NOT contribute to global warming?
OA Driving cars
B. Releasing gases
C. Walking
OD Burning fuel

Answers

Answer:

walking

Explanation:

C. Walking doesn’t cause any harm to the environment or cause any sort of environmental change due to global warming issues. Walking is safe opposed to using fossil fuels.

How can G and cloning be used in medical science

Answers

Answer:

for testing differnt cures on animals

Explanation:

Somebody please help? Thanks​

Answers

Answer:

None

Explanation:

because y is recessive and it needs to be yy to be green so Yy wouldn't wrok

The answer is none


...

What is the difference between mold and cast fossils? A Mold fossils fom from collected minerals and cast fossils do not B. Mold fossils are impressions intock and cast fossils fomm from minerals filling molds cast fossils are impressions Into rock and mold fossils form from minerals filling casts Cast fossils are formed in sedimentary rock but mold fossils are not​

Answers

I believe the answer is B.

when an animal dies and its body decays, it can leave an imprint in the sediment. If this imprint fills in with minerals from sediment and groundwater, it can harden to form a fossil. This fossil is called a cast fossil. The fossilized imprint is called a mold fossil.
Other Questions
Pls only give direct answers By 1968, backlash against a liberal Supreme Court could beseen in...A. antiwar demonstrations against the supreme courts holding the constitutionality of the war in vietnamB. the overturning of the precedent established in Brown v Board of EducationC. congress decision to impeach 3 supreme court judgesD. the 1968 law-and-order campaigns of Richard Nixon and George Wallace Triangle abc and xyz are congruent ,/_A is one half the size of /_B,/_y is 90 ./_c and /_z each have a measure of 45.What is the measure of /_ a? What is the main reason Reverend Thomas Lane Butts finds comfort in To Kill A Mockingbird? solve the variable of x. 3^3^x= 1/243 Sara travels east 6 miles and then goes south 3 miles and then north 8 miles. What is her displacement? Roundyour answer to two significant figures.aOb6.3 miles SW7.8 miles SW0 miles5.7 miles SW7.8 miles NE6.3 miles NEodeOf5.7 miles NEOh9.1 miles sw9.1 miles NE What does riffling love is like a great natural mean to you in sentences Ans: 720cm2The ratio of the number of Malay students to the number of Indian students to thenumber of Chinese students in a school is 5:4:8.There are a total of 468 Indian and Chinese students.What is the total number of students?Ans: x+y Renaissance Humanism stressed theaccomplishments of hey I choose America as my national by am not from America, I didn't find my country's name in the list that's why I chose America. who can me to change it? I am a Gambia. A school district created the following two-way frequency table to show the participation of their students in extracurricular activities.Extracurricular ParticipationBand Athletics DramaClub Chorus DebateTeam TotalRiver High School 131 174 78 58 53 494Bay High School 116 159 38 68 53 434Total 247 333 116 126 106 928What percentage of Bay High School extracurricular participants compete in athletics?A. 35.88% Plzz help will mark brainleast Which of the following statements best describes a major theme of the poem? Mother to Son Poem. What is the area of this trapezoid?b2=2 in.h = 5 in.bi = 6 in. Please helppppp ASAP mark you Brainliest all 8 answer in the picture, where did it go Characteristic of effective citizenship or NOT Characteristic of effective citizenship Shall I use "without doubt" or "without a doubt" to start my sentence in an essay? What 138738262837187173628182636648282727 divided by 718172628382728473e + 7282828368199182727374992826272 divided by 6378191826463 plus -123415192 + 17181827291? PLEASEE HELPP!!! DUE TODAYY!!! One tip to remember is to try to keep the subject you are photographing brighter than the background. True False