A shoe store buys a shipment of nike shoes that cost $70 each to the purchases. They want to markup their prices for the customers by 30%. How much would the customer pay for a pair of nikes

Answers

Answer 1

Given :

A shoe store buys a shipment of Nike shoes that cost $70 each to the purchases.

They want to markup their prices for the customers by 30%.

To Find :

How much would the customer pay for a pair of Nikes.

Solution :

C.P = $70 .

It is given that selling price is 30% more than the S.P.

So, S.P = C.P + C.P×0.30

S.P = C.P×1.30

S.P = 70×1.30

S.P = $91.

Therefore, the customer would pay $91 for a pair.


Related Questions

I don’t get 9.) so if anyone can’t skip it I need help with 10.) too

Answers

Answer:

ok number 9.) i believe its 7 if im wrong im so sorry

Step-by-step explanation:

Answer:

I will help with 10 i don't get 9 sorry so the answer is (a) F(5,4)

Step-by-step explanation:

So you have the midpoint and you put f(x, y) and D(-3,-8)

So

E=(x-3/2, y-8/2) =(1,-2) so

X-3/2 =1 , x-3=2 so x = 5

And y-8/2 = - 2. , so y-8 = - 4. , so y =4

So F =(5, 4)

5h=srt solve for t please help

Answers

Answer:

5h/sr=t

Step-by-step explanation:

To get t alone basically all you do is divide 5h by s and r.

So the new equation would be 5h / sr = t

I'm stuck and I need help quick

Answers

Answer:4

Step-by-step explanation:

The square root of 9 is 3, 3 multiplied by 2 is 6, and 10 - 6 =4.

7x-6y=9
5x+2y=19 Solve the system using elimination.

Answers

Step-by-step explanation:

multiply 5x+2y=19 by 3 youll get 15x+6y=57

eliminate y

7x-6y=9

15x+6y=57 +

22x=66

x=3

substitute x to 5x+2y=19

15+2y=19

2y=4

y=2

Please help! I don't get it cause the person that was teaching it had horrible handwriting ;-;

Answers

Answer: power of a power

Step-by-step explanation:

in the expression (x^4)^9, 4 and 9 are powers. 9 is the power of x^4, so you have to multiply 4 by 9 to get x^36. this means it's a power of a power

–7 y = –28


Answer:
y = ?

Answer the ? Mark pls

Answers

Answer:

y=4

Step-by-step explanation:

-28 divided by -7 equals to 4

Hope this helps!!

Answer: y = 4

Step-by-step explanation:

-7y/-7 = -28/-7 So, Both the -7's cancel out and your left with y= you divide -28 by -7. When you divide both of the numbers you get a positive 4.

Does bin width matter when it comes to histograms? Why or why not?

Answers

Answer:

Avoid histograms with small bin widths that group data into lots of bins. A histogram constructed with small bin widths will show the distribution as a “pancake.” so no it does not help us see the pattern in the data.

Step-by-step explanation:

Alysha’s average speed when walking home from the market was 5 mph, and it takes her 21 minutes longer than when she drives to the market. If she drives along the same route, at an average speed that is 8 times her average walking speed, how many minutes does it take her to drive home from the market?

Answers

9514 1404 393

Answer:

  3 minutes

Step-by-step explanation:

Let x represent Alysha's time to drive home from the market.

Speed and time are inversely proportional to each other (for the same distance), so we have ...

  (walking speed)(walking time) = (driving speed)(driving time)

  5(x +21) = (8·5)(x)

  x +21 = 8x . . . . . . . . . divide by 5

  21 = 7x . . . . . . . . subtract x

  3 = x . . . . . . .divide by 7

It takes Alysha 3 minutes to drive home from the market.

at what rate, how long will it take to go 4.5 miles

Answers

Step-by-step explanation:

they need a car to drive duhhhhh

Answer:

0.36 hours

Step-by-step explanation:

Divide 4.5 with 12.5 mph.

What is true about 3×9, guys can you help I a little confused

Answers

Answer:

27

Step-by-step explanation

have a great day

Answer:

3*9=27

Step-by-step explanation:

The thing that is true about 3*9 is that it is also equal to 9*3.

Hope this helped!! :)

What is an equation in slope-intercept form for the line that passes through the points (1, -3) and (3, 1)?

A. y= 3x + 1
B. y= x-3
C. y= 2x + 5
D. y= 2x-5


° ♡ ₒ ♡ °
thank you!

Answers

D.y=2x-5


I think, i hope this helps
The slope intercept form is y= 2x-5

Can you please mark BRAINLEST

Can i have some help please

Answers

Answer:

bababooey

Step-by-step explanation:

Neil is completing a 10 km run in 4 months’
time. His personal best for 10 km is 55 minutes
and he wants to complete this run in less than
45 minutes.

Identify the components of health-related
fitness that Neil will have to develop to try and
achieve this. Justify your choices.

Answers

Answer:

Hello There!!

Step-by-step explanation:

There are five components of physical fitness:

1. Body composition

2.Flexibility

3. Muscular strength

4. Muscular endurance

5. Cardiorespiratory endurance

I think he will have to develop Flexibility,Muscular Endurance and also Cardiorespiratory Endurance.

hope this helps,have a great day!!

~Pinky~

Sarah had 36 free throw attempts during a game and made at least 75% of the free throws.

What is the greatest number of free throws Sarah could have missed during the game?

Answers

Answer:

9 free-throws

Step-by-step explanation:

75% of 36 = 27

36-27=9

She could have missed up to nine free throws

Answer:

3

Step-by-step explanation:

25% of 12 is 3. Brainliest pls :)

does the graph represent a function?

Answers

Yes it does
..........

If the sales tax rate is 8%, how much tax would Luis pay for a pair of pants for $18 and two shirts for $9.99 each?

Answers

Answer:

$3.04 (rounded to nearest cent)

Step-by-step explanation:

Total cost without tax = $18 + $9.99 × 2

                                    = $37.98

Tax = [tex]\frac{8}{100}[/tex] × $37.98

      = $3.04 (rounded to nearest cent)

What is the solution for x in the equation?

29 + 15x = -x − 3

A. x= 1/2

B. x= -1/2

C. x= 2

D. x= -2

Answers

Answer:

x=-2

Step-by-step explanation:

pls help meeeeee
if you can
I'll give you brainy

Answers

Answer:

x=100°, y=85°

Step-by-step explanation:

I'm pretty sure about it. If you need explanation, I'll give it later. Thank you.

What is the range of the cluster in the scatter plot?

A: Between 4 and 8 years of experience
B: Between 6 and 12 years of experience
C: Between $10,000 and $60,000
D: Between $40,000 and $60,000

Answers

Answer:

b

Step-by-step explanation:

answer :


b


hope this helped

X, Y and Z are three points on a map. Y is 75km and on a bearing of 200° from X. Z is on a bearing of 150°, from Y. Z is due south of X. Calculate the distance between X and Z rounded to 1 DP.

Answers

Answer:

The distance between X and Z is approximately 114.9 km

Step-by-step explanation:

The given parameters are;

The distance of Y from X = 75 km

The bearing of Y from X = 200°

The bearing of Z from Y = 150°

The bearing of Z from X = 180°

In triangle XYZ, we have;

∠YZX = 180° - (130° + 20°) = 30°

By sine rule, we have;

(75 km)/sin(30°) = XZ/(sin(130°))

XZ = sin(130°) × (75 km)/sin(30°) ≈ 114.9 km

The distance between X and Z ≈ 114.9 km. to one decimal place.

use, or to compare the following numbers. -2 or 12 <>

Answers

Answer:

-2 < 12

Step-by-step explanation:

12 is bigger than -2.

Solve the inequality.
-4(2n-6)

Answers

Answer: -8n + 24

Step-by-step explanation:

-4(2n-6)

-8n + 24

Answer:-8n+24

Step-by-step explanation:

yall please help me with this math question :/​

Answers

3 chocolates bc it’s going up by 3 each time it escalates

Calculate these, and write each awnser in Standard Form.

Answers

Step-by-step explanation:

Do you need answers to all of them of some of them?

1. (4.5×10¹²)÷(9×10^10)

(45×10^-1×10¹²)÷(9×10^10)

(45×10¹¹)÷(9×10^10)

(45÷9)×(10¹¹÷10^10)

5×10

if you need help with the others kindly let me know


Group of answer choices

24

25.7

28.1

29.8

Answers

Answer:

b i think

Step-by-step explanation:

Arian has 780 in a savings account that earns 2.5% simple interest annually. How much money will be in her account if she does not make any deposits or withdrawals in 2 years?

Answers

Answer:

819

Step-by-step explanation:

We solve the above question using simple interest

The formula for the total amount in a bank amount when it earn simple interest annually is:

A = P(1 + rt)

When

P = Initial amount in the account = 780

r = Simple Interest rate = 2.5% = 0.025

t = 2 years

A = 780(1 + 0.025 × 2)

A = 780(1 + 0.050)

A = 780(1 .050)

A = 819.00

The amount of money that will be in her account if she does not make any deposits or withdrawals in 2 years is 819.

PLEASE HELP ME BRAINLY IF CORRECT
Two hot air balloons are traveling along the same path away from a town,
beginning from different locations at the same time. Henry's balloon begins
10 miles from the town and is 24 miles from the town after 2 hours. The
distance of Tasha's balloon from the town is represented by the function y=
6x + 15.
Which balloon was farther from the town at the beginning, and which traveled
more quickly?

A. Tasha's balloon was farther from the town at the beginning, but
Henry's balloon traveled more quickly.
B. Henry's balloon was farther from the town at the beginning, but
Tasha's balloon traveled more quickly.
C. Tasha's balloon was farther from the town at the beginning, and it
traveled more quickly.
D. Henry's balloon was farther from the town at the beginning, and it
traveled more quickly.

Answers

Answer:

Henry's balloon was farther from the town at the beginning and Henry's balloon traveled more quickly.

Which expression correctly represents “six more than the quotient of three and a number, decreased by eight”?
6 + StartFraction 3 Over n EndFraction minus 8
6 + StartFraction n Over 3 EndFraction minus 8
6 + StartFraction 3 Over n EndFraction + 8
6 + StartFraction n Over 3 EndFraction + 8

Answers

Answer:

C

Step-by-step explanation:

Because yeahhhh

Answer:

C

Step-by-step explanation:

In function for every input there is exactly one output

Answers

Answer:

It should be true, because without an output or input it would be an alien device that doesn't need any energy to work, making it true, also i dont really know if its true

find the equation of the circle with center at (3 -2) and radius of 3.

Answers

Answer:

(x - 3)² + (y + 2)² = 9

General Formulas and Concepts:

Pre-Calculus

Equation of a Circle: (x - h)² + (y - k)² = r²

(h, k) is centerr is radius

Step-by-step explanation:

Step 1: Define

Center (3, -2)

h = 3k = -2

Radius r = 3

Step 2: Write Equation

Substitute [EC]:                    (x - 3)² + (y + 2)² = 3²Exponents:                           (x - 3)² + (y + 2)² = 9
Other Questions
Carolina, t ___________________ un lpiz?a. tieneb. tengoc. tienesd. tenis witch issue is a greater challenge bc of population growth in the west?a. inadequate water recoursesb. more frequent earthquakesc. removal of trade barriersd. heavy rainfall 20 pointsI need help asappp what is the temperature in the fahrenheit? 10-2+3x19-8= first to answer will get brainlyest Write an equation to find x by substituting.3. What does it mean to substitute here?5x - 2 = 3x +4 A rocket is launched from a tower. The height of the rocket, y in feet, is related to the time after launch, x in seconds, by the given equation. Using this equation, find the time that the rocket will hit the ground, to the nearest 100th of second.y=-16x^2+116x+75 Use the right triangle shown to answer the question.2632*not drawn to scaleWhat is the approximate value of x? A 7-pack of tickets to the zoo costs $78.61. What is the unit price? can someone help me understand this better on what she means by this with procedures The table represents a function.What is f(-2)?0 -3-6-2f(x)314-2O-1O 1O 3 In 1965 King and his wife, Coretta Scott King, led demonstrators on ahistoric 54-mile march that took five days, from where to where? HELPPPPPPPPPPPPPPP!!!!!!!!!!! BRAINLIEST IS ON THE LINE!!!!!!!!!!!!!!!!!Write a summary for Macbeth Act 1 Scene 2. What is the answer to question 7, NH4C2H3O2 what country has not experienced balkanization? 3(2(8-2x4)+25divided by 5 )-(2(8 divided by 4x2)-7(7-2x3) can you please help me:) write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC y32c-4-3 -2 -1-1+1 2 3 4-2+-3+-4+41What is the slope of the line? A restaurant customer left $1.35 as a tip...Plz help me