A standard bathtub holds 60 gallons of water. A full tub drains 12 gallons per minute. Which of the following tables best represents the situation?

A Standard Bathtub Holds 60 Gallons Of Water. A Full Tub Drains 12 Gallons Per Minute. Which Of The Following

Answers

Answer 1

J.

x represents the minutes and y shows how many gallons over that time.

Answer 2

The correct table for best represents the situation is shown in Table J.

What is Equation of line?

The equation of line in point-slope form passing through the points

(x₁ , y₁) and (x₂, y₂) with slope m is defined as;

⇒ y - y₁ = m (x - x₁)

Where, m = (y₂ - y₁) / (x₂ - x₁)

Given that;

A standard bathtub holds 60 gallons of water.

And, A full tub drains 12 gallons per minute.

Now, From table J;

Rate of change is,

⇒ (24 - 12) / (2 - 1)

⇒ 12 / 1

⇒ 12 gallons per minutes

Which is given in situation.

Thus, The correct table for best represents the situation is shown in Table J.

Learn more about the equation of line visit:

https://brainly.com/question/18831322

#SPJ2


Related Questions

For which of the following sample sizes is the sample median most likely to be above $250,000?
A. n = 10
B. n = 50
C n = 100
D. n = 1000
E Impossible to determine without more information

Answers

Answer:

A. n=10

Step-by-step explanation:

your welcome

Answer:

n=100

Step-by-step explanation:

In a residential neighborhood, the median value of a house is $200,000. For which of the following sample sizes is the sample median most likely to be above $250,000?     That was the exact question I had on the quiz. I'm not sure why it is n=100, but I got it correct.

can someone help me on this?

Answers

Answer:

Step-by-step explanation:

Drew has two cats. One cat weighs 17 pounds, and the other one weighs 1212 pounds. Audrey’s dog weighs 33 pounds.
What is the difference in ounces between Audrey’s dog and the combined weights of Drew’s cats?
Enter your answer in the box.

Answers

Answer:

48 ounces.

Step-by-step explanation:

Steps:

Combine the weight of the cats.

12 (assuming it is a typo, 1212 pounds is a pretty big cat!) + 17 = 30 pounds

Convert to ounces.

33 pounds = 528 ounces

30 pounds = 480 ounces

Subtract the two/find the difference.

528 - 480 = 48.

The difference in ounces between Audrey's dog and the combined weights of Drew's cats is 48 ounces.

A worldwide organization of academics claims that the mean IQ score of its members is 118, with a standard deviation of 17. A randomly selected group of 40 members of this organization is tested, and the results reveal that the mean IQ score in this sample is 115.8. If the organization's claim is correct, what is the probability of having a sample mean of 115.8 or less for a random sample of this size

Answers

Answer:

0.2061 = 20.61% probability of having a sample mean of 115.8 or less for a random sample of this size

Step-by-step explanation:

To solve this question, we need to understand the normal probability distribution and the central limit theorem.

Normal Probability Distribution:

Problems of normal distributions can be solved using the z-score formula.

In a set with mean [tex]\mu[/tex] and standard deviation [tex]\sigma[/tex], the z-score of a measure X is given by:

[tex]Z = \frac{X - \mu}{\sigma}[/tex]

The Z-score measures how many standard deviations the measure is from the mean. After finding the Z-score, we look at the z-score table and find the p-value associated with this z-score. This p-value is the probability that the value of the measure is smaller than X, that is, the percentile of X. Subtracting 1 by the p-value, we get the probability that the value of the measure is greater than X.

Central Limit Theorem

The Central Limit Theorem estabilishes that, for a normally distributed random variable X, with mean [tex]\mu[/tex] and standard deviation [tex]\sigma[/tex], the sampling distribution of the sample means with size n can be approximated to a normal distribution with mean [tex]\mu[/tex] and standard deviation [tex]s = \frac{\sigma}{\sqrt{n}}[/tex].

For a skewed variable, the Central Limit Theorem can also be applied, as long as n is at least 30.

A worldwide organization of academics claims that the mean IQ score of its members is 118, with a standard deviation of 17.

This means that [tex]\mu = 118, \sigma = 17[/tex]

A randomly selected group of 40 members

This means that [tex]n = 40, s = \frac{17}{\sqrt{40}} = 2.6879[/tex]

What is the probability of having a sample mean of 115.8 or less for a random sample of this size?

This is the pvalue of Z when X = 115.8.

[tex]Z = \frac{X - \mu}{\sigma}[/tex]

By the Central Limit Theorem

[tex]Z = \frac{X - \mu}{s}[/tex]

[tex]Z = \frac{115.8 - 118}{2.6879}[/tex]

[tex]Z = -0.82[/tex]

[tex]Z = -0.82[/tex] has a pvalue of 0.2061

0.2061 = 20.61% probability of having a sample mean of 115.8 or less for a random sample of this size

5.
3. The Manhattan Island Cruise Company sold 57
tickets for its Circle-the-Island Cruise. Each adult had
to pay $22 for the cruise and each child had to pay
$10. The company's total receipts were $774. How
many children went on the cruise?

Answers

Answer:

40 children went on the cruise.

Step-by-step explanation:

This question can be solved by a system of equations.

I am going to say that:

x is the number of adults on the cruise

y is the number of children on the cruise.

57 tickets were sold:

This means that [tex]x + y = 57[/tex], and since we want the number of children y, [tex]x = 57 - y[/tex]

Each adult had to pay $22 for the cruise and each child had to pay $10. The company's total receipts were $774.

This means that:

[tex]22x + 10y = 774[/tex]

Since [tex]x = 57 - y[/tex]

[tex]22(57 - y) + 10y = 774[/tex]

[tex]1254 - 22y + 10y = 774[/tex]

[tex]12y = 480[/tex]

[tex]y = \frac{480}{12}[/tex]

[tex]y = 40[/tex]

40 children went on the cruise.

Vincent gathered groups of 1 to 8 people and gave every group the same positive salt. He recorded the number of minutes it took each you to solve the puzzle in Porter resort. What is the best description of this relationship

Answers

Answer:

Larger groups take less time

Step-by-step explanation:

Mrs. Bell wrote the expanded form of a number, as shown. 5 × 100 + 4 × 10 + 6 × 1 + 2 × (1___ 10)+ 8 × (1____ 1000)What is the number written in standard form?

Answers

Answer:

the question is worded incorrectly, but I believe the answer is 8566.

Step-by-step explanation:

How do I evaluate:
(-1000)1/3

Answers

9514 1404 393

Answer:

  -10

Step-by-step explanation:

The first step is to write what you mean. We think you mean (-1000)^(1/3).

If you've been paying attention to place-value, and/or cubes of small integers, you already know that 10^3 = 1000. Since we're concerned with an odd power, we also know ...

  -1000 = (-10)^3

Then your expression is ...

  (-1000)^(1/3) = ((-10)^3)^(1/3) = (-10)^(3/3) = (-10)^1 = -10

__

Some calculators can evaluate this for you (see attached).

Some calculators and spreadsheets use logarithms to compute roots or fractional powers, so will give you an error when you try to compute this. You should know that an odd-index root of a negative number (here, 3rd root of -1000) has the same sign as the number: negative. Then you can use your calculator to compute the positive root and add the sign yourself:

  (-1000)^(1/3) = -(1000^(1/3)) = -(10) = -10

_____

Of course, a 1/3 power is the same as a cube root. Your calculator may have a cube root button that works just fine with negative numbers.

look at pic 10 pts will mark brainilest

Answers

Answer:

A) The width is 12 cm; the average time is 3 minutes

Step-by-step explanation:

[tex]\frac{5}{3}= \frac{20}{y}[/tex]

Cross multiply.

5 × y = 3 × 20

5y = 60

5y ÷ 5 = 60 ÷ 5

y = 12

The width is 12 cm. Moving onto the time.

[tex]\frac{12}{4} =\frac{y}{1}[/tex]

Cross multiply.

4 × y = 12 × 1

4y = 12

4y ÷ 4 = 12 ÷ 4

y = 3

The time is 3 minutes.

Answer:

answer is d sorry if I'm wrong

A picture is to be printed onto a sheet of paper with dimensions of 81/2 x 11 inches, A margin of 1 1/2 inches is to be left on all sides of the picture. What is the area of the printed picture?

Answers

Answer:

The area of the printed picture is 172.5 square inches.

Step-by-step explanation:

Since a picture is to be printed onto a sheet of paper with dimensions of 81/2 x 11 inches, and a margin of 1 1/2 inches is to be left on all sides of the picture, to determine what is the area of the printed picture the following calculation must be carried out, knowing that the area of a rectangle is equal to the base multiplied by the height:

81/2 = 40.5

1/2 = 0.5

40.5 - 1.5 x 4 = 34.5

11 - 1.5 x 4 = 5

34.5 x 5 = 172.5

Therefore, the area of the printed picture is 172.5 square inches.

A 45 foot ladder is set against the side of a house so that it reaches up 27 feet. If Latanya grabs the ladder at its base and pulls it 3 feet farther from the house, how far up the side of the house will the ladder reach now? (The answer is not 24 ft.) Round to the nearest tenth of a foot.

Answers

Answer:

22.4

Step-by-step explanation:

delta math

Answer:22.4

Step-by-step explanation:

I need help ASAP i will give brainlist

Answers

Answer:

M

Step-by-step explanation:

Answer:

Point M

Step-by-step explanation:

Each line represents 0.05 so M would best represent 1/3

A loss of $13.50 on a washing machine represents 15% loss on the selling price. what is the selling price?

Answers

Answer:

$90

Step-by-step explanation:

Given data

Given data

Loss= $13.5

Percentage of the loss= 15%

Let the full loss be x

Hence we can find the value of x as

15/100*x= 13.5

0.15x= 13.5

divide both sides by x

x= 13.5/0.15

x= $90

Hence the loss in full is $90

My cousin needs help with this question.

Answers

I believe the answer is 3

Answer:

3 feet per minute

Step-by-step explanation:

Look at an easy to read point on a grid line intersection.

Then find the slope. Slope = constant of proportionality.

For example, look at point (2, 6) which means that when time = 2 minutes, distance = 6 feet.

(6 ft)/(2 sec) = 3 feet per minute

Answer: 3 feet per minute

Find the equation of the line shown. Enter yoir answwr in slope intercept form​

Answers

Answer:

y = x

Step-by-step explanation:

The equation for slope is y = mx +b. If you look at the line you see that it passes through the origin, this is your y-intercept, 0. If you look at two points at the line and use the rise over run method, you get the slope to be 1. If you substituent these values into the equation you get, y = x.

Hope this helps!

-Luna

5. Consider kite HIJK. If HK = 8 and HP = 5, find KP.
H
К.
Р

Answers

Answer:

Step-by-step explanation:

KP²+HP²=KH²

KP²+5²=8²

KP²=64-25=39

KP=√39

How do you write 5.09 104 in standard form?

Answers

509,000
Hope that helped :)

What is the height (h) of the prism?
3ft
6ft

Answers

6ft is the answer!! hope this helps :-)

Answer:

6ft

Step-by-step explanation:

The height is 6ft, because the 3 foot measurements are the width of the prism.

Milo is working on a wall mural using geometric shapes. The mural includes parallelograms and rectangles like the ones below.



Opposite sides are parallel.


Opposite sides are congruent.


Opposite angles are congruent.


Opposite angles are right angles.

Answers

Your answer is going to be opposed sides are parallel

Answer:

Opposite angles are right angles.

Step-by-step explanation:

hi can you please help me with my work​

Answers

the answer is the second one. 2 and 2/3

the function f(x) = -x^2 + 44x -384 models the daily profit in dollars that a shop makes

Answers

the function f(x) = -x^2 + 44x -384 models the daily profit in dollars that a shop makes
The answer is b I believe.

If 18 is 45% what is 100%

need help ASAP any random answers just for points will be reported

Answers

Answer: 45

Step-by-step explanation:

Solution for What is 45 percent of 100:

45 percent * 100 =

(45:100)* 100 =

(45* 100):100 =

4500:100 = 45

Now we have: 45 percent of 100 = 45

Question: What is 45 percent of 100?

Percentage solution with steps:

Step 1: Our output value is 100.

Step 2: We represent the unknown value with $x$x​.

Step 3: From step 1 above,$100=100\%$100=100%​.

Step 4: Similarly, $x=45\%$x=45%​.

Step 5: This results in a pair of simple equations:

$100=100\%(1)$100=100%(1)​.

$x=45\%(2)$x=45%(2)​.

Step 6: By dividing equation 1 by equation 2 and noting that both the RHS (right hand side) of both

equations have the same unit (%); we have

$\frac{100}{x}=\frac{100\%}{45\%}$

100

x​=

100%

45%​​

Step 7: Again, the reciprocal of both sides gives 45

$\frac{x}{100}=\frac{45}{100}$

x

100​=

45

100​​

$\Rightarrow x=45$⇒x=45​

Therefore, $45\%$45%​ of $100$100​ is $45$

Answer:

40

Step-by-step explanation:

I like to find common factors.

45% and 18 are both divisible by 9.

so

45% ÷ 9 = 5%

18 ÷ 9 = 2

2 is equal to 5%

100% ÷ 5% = 20

so

20 × 2 = 40

100% = 40.

The length of a rectangular swimming pool is exactly three times as long
as its width. If the pool has a perimeter of 472m find the width of the pool

Answers

Answer:

59m

Step-by-step explanation:

Length= 3 × ( width)

But perimeter= 2width + 2 Lenght= 472

Let length= X

Width= Y

X= 3Y.........eqn(1)

2X + 2Y= 472........eqn(2)

Substitute X= 3Y in eqn(2)

2(3Y) + 2Y = 472

6Y + 2Y= 472

8Y= 472

Y= 59 m

Hence, the width of the pool is 59 m

Which function is linear?
A) y = x^2 + 4
B) 2y = 4x^2
C) 2y = x + 4
D) x^2=2y

Answers

Answer:

A

Step-by-step explanation:

its a

Answer:

C) 2y = x + 4

Step-by-step explanation:

all other functions include x²

solve For X if 9( x²_1 )= 27 x 2187​

Answers

Answer:

use photomath it'll slove it for you

Step-by-step explanation:


Dr. Seals borrows $15,000 to remodel her backyard. The interest rate is 3%. The interest is compounded twice a year for two years.

Answers

Answer:

what is the question?

Step-by-step explanation:

Given m∠3+m∠8=180° .

Answers

Answer:

5.175117

Step-by-step explanation:

Seamus draws a triangle with angles of measures 40°, 60°, and 80°. Edwina draws a triangle with these same three angle measures. Which statement must be true?
A Edwina's triangle is the same size as Seamus's triangle.
B Edwina's triangle is the same shape as Seamus's triangle.
C The perimeter of Seamus's triangle is greater than the perimeter of Edwina's triangle.
D The area of Edwina's triangle is less than the area of Seamus's triangle.​

Answers

Answer:

It may be D or A hopeit helps

Step-by-step explanation:

Click through the graphs and select the one that could represent the relationship between the cost, c, of a call and the time, t, for the cell phone plan shown below.

Answers

Answer:it the last one i just got it right,  i dont know how to put the pic up but, hope this helps.

Step-by-step explanation:

Relationship between the cost, c, of a call and the time, t, for the cell phone plan in the second graph.

What is Graph?

Graph is a representation of a network and is used to describe the connectivity between lines and points.

The below table represents the relationship between the cost in dollars and time in hours

Time in hours      0        1        2        3

Cost in dollars     10       13      16      19

By observing the values and Graph, we can see that 2nd graph matches with the given values.

Hence second graph matches with the value.

To learn more about graph click:

https://brainly.com/question/17267403

#SPJ2

Find the area of the white region in the diagram shown.

Answers

Answer:

Option 4

Step-by-step explanation:

Area of shaded region = Area of the circle - Area of the shaded triangles

Area of the circle = πr²

r = Radius of the circle

Therefore, area of the circle = π(4)²

                                               = 16π

Area of the given triangles = [tex]2[\frac{1}{2}(\text{Base})(\text{Height})][/tex]

                                             = Base × Height

                                             = (4 × 4)

                                             = 16

Area of the shaded region = 16π - 16

Option 4 will be the correct option.

Other Questions
Which statement below is NOT a statement within the Cell Theory?A. all cells come from other cellsB. all organisms are composed of cellsC. the cell is the basic unit or organization of organismsD. all cells contain DNA (genetic information) What is wrong with the claim statement: "Everyone should use a cell phone." In the circular flow model, businesses provide goods and services to whichpart of the economy?A. BusinessesB. Product marketsC. Resource marketsO D. Households The Mauryan Empire was called India's Silver Age.True or False A water pipe has a flow of 2 gallons per minute how many 2 qt could fill it in 1/2 hour? La oracin que representa un smil es: A. . Cerca del Tajo, en soledad amena, B. . Si no regresas pronto a mi lado, morir desangrado C. Los invisibles tomos del aire D. Eres como el viento tibio de los arenale What river connects the Great Lakes to the Atlantic Ocean? PLEASE HELP WILL GIVE BRAINLIEST!! Please please only answer if you know or can help!! I need help know if what i already put is correct or how i can fix it and also the answer to question E. THANK YOU! hi can you please help me with my work Add the two functions. f(x) = 3x3 + 7x 26 g(x) = x + 2 Please help! Thank you! Find the area of the white region in the diagram shown. what is the mRNA in TACCGGATGCCAGATCAAATC? a cup of coffee is left to cool inside a room and its cooling can be described by the function y = 85(.75)x/5 + 15 where x is time in minutes and t is the temperature of the coffee in degrees celsius. Help!!! I do not seem to understand this problem well. Dr. Seals borrows $15,000 to remodel her backyard. The interest rate is 3%. The interest is compounded twice a year for two years. Why would an investor want to choose a certificate of deposit over a corporate bond Please help help me please ASAP I am begging someone please No links or files describe how the state of Washington and its residents played a huge part in winning World War II? Plzzz help NEED THIS FAST!!! What's the circumference of a circle with a radius of 10 inches