Biology High School

A student claims that the only difference between prokaryotic cells and eukaryotic cells is that
eukaryotic cells have a nucleus, but prokaryotic cells do not. What is wrong with this claim?

The description of the cell types is incorrect.

Prokaryotic cells have a nucleus, and eukaryotic cells do not.

The description of the cell types is incorrect. Both prokaryotic and eukaryotic cells have a nucleus.

There is another difference between the cell types. Eukaryotic cells have membrane-bound organelles, but
prokaryotic cells do not.

There is another difference between the cell types. Eukaryotic cells have a cell membrane, but prokaryotic
cells have a cell wall instead.

Answers

Answer 1

Explanation:

Eukaryotic cells:

• There is a well defined nucleus

• They are membrane bounded cell organelles like chloroplast, golgi bodies, mitochondria.

Prokaryotic cells:

• The nucleus are not well defined

• Cell organelles are not bounded by membrane

A Student Claims That The Only Difference Between Prokaryotic Cells And Eukaryotic Cells Is Thateukaryotic

Related Questions

Can someone please help me on this plz I beg u :(

Answers

Answer:

Coleoptera is correct! Hope this helps.

ANSWER IS Coleoptera

Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)

Answers

The best answer to go with is b you’re welcome

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

why is it important to save energy in our daily lives

Answers

Answer:

So you can be more active and do different things that need energy

Explanation:

Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.

¿Con que otro nombre se le conoce a las placas de espuma de poliuretano altamente contaminante?

Answers

Answer:

La espluma de poliuretano (espluma PU) ye un material plásticu porosu formáu por un agregamientu de burbuyes, conocíu tamién polos nomes coloquiales de gomaespuma n'España o gomapluma en dellos países suramericanos. Contienen sustances d'escasu poder canceríxenu que si representen dalgún peligru, namái sería tres esposiciones intenses y teniendo contautu direutu.Tamién ye denomináu Poliuretano proxectáu, por cuenta de la forma na que se suel aplicar sobre superficies. Explanation:

Number the steps from when a stimulus is received to when the body reacts.
_____ The stimulus is received by sensory receptors.

_____ Motor neurons cause muscles to contract so the body can react to the stimulus.

_____ The brain processes the information through interneurons.

_____ Interneurons transfer response information to motor neurons.

_____ Sensory neurons carry stimulus information to the brain or spinal cord.

Answers

Answer:

The correct answer is -

1 - The stimulus is received by sensory receptors.

2 - Sensory neurons carry stimulus information to the brain or spinal cord.

3 - The brain processes the information through interneurons.

4 - Interneurons transfer response information to motor neurons.

5 - Motor neurons cause muscles to contract so the body can react to the stimulus.

Explanation:

In most of the organism including humans body response according to the stimulus it receives. The stimulus is received by the sensory receptors to the sensory neurons or afferent neurons that are present on the skin, nose tongue ears, or eyes. Many other receptors and pain receptors present on various internal organs as well.

These sensory neurons carry the stimulus to the spinal cord or brain where this information received by the stimulus process through interneurons and transfer the response of the particular stimulus to the motor neurons. These motor neurons result in muscles contracts so the body can react.

B) Now imagine that a hurricane has deposited large patches of light colored sand among the
rocks. Use the axes below to sketch how you think your graph from part A would change under
these new conditions. What type of selection is acting under these new conditions?

Answers

Here's li[tex]^{}[/tex]nk to the answer:

bit.[tex]^{}[/tex]ly/3tZxaCQ

tRNA uses (anticodons/codons) to match to the mRNA.

Answers

Answer:

anticodons

Explanation:

codons are for mRNA

tRNA uses anticodons to match to the mRNA.

Which one does tRNA uses?

tRNA (transfer RNA) molecules are responsible for carrying specific amino acids to the ribosomes during protein synthesis.

They have an anticodon region that consists of three nucleotides that are complementary to the codons on the mRNA (messenger RNA). The codons on the mRNA determine the sequence of amino acids in the growing polypeptide chain.

The anticodon on the tRNA base pairs with the complementary codon on the mRNA, ensuring that the correct amino acid is incorporated into the growing protein chain. The matching between the anticodon and codon is essential for the accurate translation of genetic information into protein synthesis.

Learn more about tRNA at:

https://brainly.com/question/4089622

#SPJ6

plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.

Answers

I think is would be A i hope it helps

Hello! could someone please do a 4 sentence quark poem

Answers

Answer:

Quark is a character in the television series Star Trek: Deep Space Nine.

Quark developed a few strong friendships during his stay on Deep Space Nine.

The Ferengi have business deals throughout the galaxy; Quark is no different.

For vegetarians, soft cheeses like cream cheese and quark do not contain any rennet at all.

Explanation:

Cell differentiation causes embryonic
cells to become which of these cells? A) prokaryotic cells B) specialized cells C) stem cells

Answers

Answer c

Explanation:

How is energy produced by respiration stored

Answers

Answer:

Explanation:

Cellular respiration converts the chemical energy stored in glucose into chemical energy stored in the ATP molecule. The cells break glucose down into carbon dioxide and water while producing energy that they store in ATP molecules.

Answered by the ONE & Only #QUEEN aka #DRIPPQUEENMO

Hope this helped!!!

Explain the lifecycle of mosquito in short

Answers

Answer:

Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)

Which process begins the formation of sedimentary rock?

Answers

Weathering breaks down pre-existing rock into particles, while erosion moves the particles to a site of deposition. These processes begin the formation of sedimentary rock. ... Sediment can be moved by wind, running water, ice, or waves.

what process causes stem cells to become immune system cells,then some immune system cells to become antibodies?

Answers

the answer is hematopoiesis

explain how at least three pieces of evidence support the theory of evolution.

Dont put any link or else I won’t give brainlist, just answer.

Answers

Answer:

1. Fossil evidence

2. Homologous similarities.

3. Molecular evidence

I will mark Brainliest for frist answer

Answers

Answer:C, to contain the information

Explanation:

using the graph, the temperature seasonal force from the other Forest biomes. choose all the apply

A) the temperature seasonal Forest averages 100 to 200 cm rainfall/year

B) the temperature seasonal Forest is cooler and wetter than the tropical rainforest

C) the temperature seasonal Forest has warmer average temperatures than the Boreal forest

D) the temperature seasonal rainforest has similar temperatures but less rain than the temperate rainfores

E) the temperature seasonal rainforest has similar rainfall to the Boreal and tropical seasonal rainforest, but is much warmer than either one

Answers

Answer:

The correct answer is - A and C,

Explanation:

According to the graph, the following conditions are matched correctly with the temperature seasonal forest with other biomes:

The temperature seasonal forest has the precipitation range from 50 cm to 250 cm rainfall per year approximately. The average rainfall from this would be 150 cm/year or between 100 to 200 cm per year.

B. the temperature seasonal forest has a temperature between 15 degrees Celsius to 20 degrees celsius which is warmer than the boreal forest that has a temperature between 0 to 15 degrees Celsius approximately.

Answer:

A, C, D

Explanation:

Carbon dioxide enters a plant through pores (openings) called the
A. stomata.

B. cuticle.

C. veins.

Answers

A. stomata

I hope this helps good luck!! :)

help................

Answers

The top left, would be light energy from the sun, while the top of the circle would be living beings. Think about it just like plants that that gain energy from the sun through photosynthesis. Then the bottom of the circle would be nonliving beings, either decomposed plants or animals that bring nutrients to soil, or dead ones that we eat. This cycles through until the energy is rereleased through heat. Therefore the top right would be heat energy, every living thing on earth creates gradual amounts of heat. Imagine going for a run, you'll probably be hotter afterwards right? I know it's not the most scientific answer but its 100% right.

Hope this helps!

This is a question that has been confusing - In addition to carbon dioxide, what other two ingredients does a plant need for photosynthesis?

Answers

Answer:

Carbon dioxide, water and sunlight

Answer:

water and sunlight

Explanation:

The energy that powers photosynthesis comes from
A. oxygen.

B. water.

C. the sun.

D. chemicals.

Answers

Answer:

sun but am not so sure about it

If a population is evolving, the allele frequency ________

Answers

If a population is evolving, the allele frequency will change.
Answer: Change

The Rio Grande River separates Mexico from Texas.

What most likely created the riverbed?
A.glaciers
B.plate collisions
C.volcanoes
D.water erosion

Answers

Answer:

d I think or b?

Explanation:

water could cause it to form a river and spread over time

what does the respritory system do?

Answers

Answer:

The respiratory system's main job is to move fresh air into your body while also removing waste gases.

Explanation:

Your lungs are part of the respiratory system, a group of organs and tissues that work together to help you breathe.

This moray eel has a small fish cleaning between its teeth. The eel gets a
clean mouth while the cleaner fish gets a nice meal.
A.Mutualism
B.Commensalism
C.Parasitism

Answers

Answer:

A. Mutualism

Explanation:

The moray eel and the small fish are both getting something out of it. Meaning they both benefit from each other.

A.Mutualism. hshshshshs

which involves producers, consumers, and decomposers?

the water cycle

nitrogen fixation

evaporation

the carbon and oxygen cycles

Answers

I would say the carbon and oxygen cycles

What two types of consumers are missing from this pyramid?
Please help I need to turn it in today !!!!

Answers

Answer:

decomposers and omnivores

Explanation:

Decomposers and omnivores

Earth science question. Please help

Answers

Answer:

answer choice 4, more rain and a steeper slope cause it to flow faster

Explanation:

Can someone tell me if it’s correct

Answers

Answer:

yes ur right

Explanation:

Other Questions