Adopting a pet can be exciting, but there are also important responsibilities that prospective pet owners must consider. Which of the following details best supports the topic sentence? A It is easier to care for a pet that lives in a contained area, like a turtle or goldfish, than a dog or cat. B Some people believe that it is unethical to keep animals as pets, even if they have long been domesticated. C Animals are cute, but they also can be expensive, requiring regular visits to the veterinarian and healthy, nutritious food. D Many pet owners report an increased sense of happiness and satisfaction in life, in large part because of the companionship of their furry friends.

Answers

Answer 1

Answer:

c

Explanation: because its telling you that yes animals are cute but they still come with all the many responsibilities

Answer 2

Answer:

C

Explanation:

Animals are cute, but they also can be expensive, requiring regular visits to the veterinarian and healthy, nutritious food.


Related Questions

Book: Immortal Life of Henrietta Lacks One of the important issues raised by Skloot’s book is the ethics of journalism. What constitutes ethical journalism? Compare the differences between irresponsible and responsible reporting on HeLa and the Lacks family. What are some of the intended and unintended consequences of irresponsible journalism?

Answers

Answer:

Following are the answer that is related to the life of Henrietta.

Explanation:

The books were written by Rebecca Skloot. Ethical journalism is essential for discipline in reporting. It implies, that reporters should be objective whenever they cover the news. They have little prejudices to facts and these seek to exploit popular sentiment. It also a problem of the correct and clear queries, because the people could never be misled but also that the data can be manipulated with one personal agenda.

According to the writer, unethical and accountable HeLa or Lacks reporting for her family is a big part of their story, because Henrietta Lacks' samples have been marketed against Henrietta's family's permission. Several of the expected and unintentional effects of reckless reporting are also below.

When mentioned above, reckless reporting skewed the facts. Its news service also has different problems and tends to manipulate facts because the viewers hear just about half the story.This style of news reporting is slanted because it doesn't enable any part of the story to express their views. That's why intelligent people look at their own opinions and sources.

hat is grammatically incorrect with the following sentence? This question is very difficult to workout. a. The suffix "out" is prepositional, and you cannot end a sentence with a preposition. b. There is an incorrect choice of word: "hard" should be used instead of "difficult". c. The phrasal verb "work out" should be two words, not one. d. There is nothing grammatically incorrect with this sentence.

Answers

Answer:

c. the phrasal verb "work out" should be two words, not one.

Explanation:

Here's the rule, for work out. As a verb, use two words: You work out. ... As a noun or adjective, make it one word: You do a workout.

1.)How does the narrator's expression of his genuine desire to help the stranded fishermen affect readers?


It leads readers to admire the narrator and root for him.


It leads readers to believe that the narrator has other, secret motivations.


It portrays the narrator's overconfidence, causing readers to dismiss him and focus on other characters.


It foreshadows a disaster to come and causes readers to fear for the narrator's safety.

Answers

Answer:

its A

Explanation:

just took the test

The narrator's genuine desire to help the stranded fishermen affects readers as It foreshadows a disaster and causes readers to fear for the narrator's safety. Thus, option D is correct.

Who is the reader?

Skilled readers actually engage in the narrative and relate to the people. They follow the story's developments, envision what is unfolding, and predict what will occur next. A competent reader is capable of delving into a story's significance and drawing parallels to their own experiences.

It is clearly given how the disaster has overshadowed the reader's fearful. This suggests that the narrator is very concerned about safety. This is because the narrator has genuine concern towards the fisherman.

And he wants to save all those fishermen who are in need. This was one of the reasons why the narrator was very careful and keen on the desire for safety. Therefore, option D is the correct option.

Learn more about readers, here:

https://brainly.com/question/3759564

#SPJ2

HELP ASAP

Choose one and write a thesis statement

A “Enjoying really bad movies”

B “key to a successful study plan”

Answers

Answer:

Explanation:

enjoying rlly bad movies

obviosly

verb of search in english​

Answers

Answer:

present tense

I/you/we/they search

he/she/it searches

present participle searching

past tense searched

Answer:

The correct ans is

Explanation:

Searched.

Hope this helps....

Have a nice day!!!!

she does not think her mother change into passive voice ​

Answers

Answer:

Her mother is not been thought of by her

Explanation:

Hope u mark as brainliest


The movement of the progress bar may be uneven becouse questions con be worth more or less including zero) depending on your answer
The following sentence contains faulty parallel structure:
Potatoes are my favorite vegetable because they can be eaten in so many delicious ways such as fries, mashed with butter, and baked
with cheese and bacon.
Which revision corrects the structure?

Potatoes are my favorite vegetable because they can be eaten in so many delicious ways such as fried, then mashed with butter, and
finally baked with cheese and bacon.
Potatoes are my favorite vegetable because they can be eaten in so many delicious ways such as fries, mashes with butter, and bakes
with cheese and bacon.

Potatoes are my favorite vegetable because they can be eaten in so many delicious ways including fries, or mashed with butter, or
baked with cheese and bacon.
Potatoes are my favorite vegetable because they can be eaten in so many delicious ways such as fried, mashed with butter, and baked
with cheese and bacon.

Answers

Answer:

the last option: Potatoes are my favorite vegetable because they can be eaten in so many delicious ways such as fried, mashed with butter, and baked with cheese and bacon.

eaten is past tense, so you want the rest of the sentence to be written in past tense: fried, mashed, and baked

to whom would you present a problem-and-solution about proposed changes to a local sales tax?​

Answers

Answer:

The correct answer would be

B. Town Mayor

Explanation:

Rewrite the following direct speech to reported speech. Last week a very drunk man got into a bus and sat near a skinny girl. She looked at him with contempt and said " you are very drunk. It is quite distinguish . What will your mom and dad feel when you arrive home like that?" He replied "does your husband sleeping with a dry stick or what?" ...etc

Answers

Answer: Last week a very drunk man got into a bus and sat near a skinny girl. She looked at him with contempt and told him that he was very drunk and that it was quite distinguished. She asked him what would his mom and dad feel when he arrived home like that. He asked If her husband slept with a dry stick, or what.

Explanation: Reported speech takes a dialogue said by a specific person, and changes it to its past form, to report the information to the listener. When the girl talks to the man, she uses simple present and future, therefore, the reported speech changes the tenses to simple past and would: "She told him that he was very drunk and that it was quite distinguished. She asked him what would his mom and dad feel when he arrived home like that." Then, the man responded with simple present, so it changes to simple past: "He asked If her husband slept with a dry stick, or what."

Write a letter to the campus head of your university and divert the attention towards the unhygienic food being sold in canteen.

Answers

Answer:

                                                                            18 Briton Drive,

                                                                            Boston.

                                                                            August 11, 2020.

22 Winston Lane,

Highbury University.

To the Campus Head,

                                    UNHYGIENIC CANTEEN FOOD

Dear Mr. King, I write to you with a sorrowful heart and disappointment with regard to the quality of food that is sold at the school campus.

I know the school can do better in providing a better quality of food for students in the canteen at this prestigious university. Just this morning, I went to have a quick meal before heading to class, and to my utmost shock and disappointment, not only was the environment dirty and unconducive for eating, the food tasted bland and the workers there were rude. That ruined my whole day as I did not eat there and I attended my first class of the day in a grumpy mood.

I believe a strict check on the canteen would be a welcome development because a lot of students have been suffering in silence.

Thanks for your time.

                                                                                            Yours faithfully,

                                                                                            Jake Bright.

speech is to communication as democracy is to

Answers

Answer: government

Explanation:

Answer:

Human Rights

Explanation:

Which two examples would be categorized as a tragicomedy? a dramatic work with a happy ending a dramatic work with a tragic ending a tragedy with humorous qualities a tragedy with a dramatic ending a comedy with humorous qualities

Answers

Answer:

tragedy with humorous qualitiestragedy with a dramatic ending

Explanation:

Tragicomedy is a genre of plays and is characterized by efficiently mixing elements such as comedy, tragedy, farce and melodrama in the same work. For this reason, we can say that a tragedy with humorous qualities and a tragedy with a dramatic ending are good examples of this genre.

This genre was very popular in the Elizabethan theater and has examples such as Shakespeare's "The Tempest" and "King Lear".

The examples that would be categorized as a tragicomedy include:

a dramatic work with a tragic ending.tragedy with humorous qualities.

It should be noted that tragicomedy simply means a genre of plays and is characterized by efficiently mixing elements such as comedy, tragedy, farce, and melodrama in the same work.

In this case, the examples that would be categorized as a tragicomedy include a dramatic work with a tragic ending and a tragedy with humorous qualities.

Learn more about tragedy on;

https://brainly.com/question/11924464

choose the appropriate pronoun to complete each sentence,using the type of pronoun indicated in parentheses
Question: honey is the only food_ does not spoil.(relative)​

Answers

Answer:

Honey is the only food that does not spoil.

Explanation:

How do the archetypes in these passages support the
universal theme that one's values are worth risking
one's life for?
Both Antigone and Boadicea are warriors who
decide to go to war for what they believe is right.
Both Antigone and Boadicea are heroes who go to
battle against their enemies.
Both Antigone and Boadicea are heroines who
choose their values over their lives, knowing they
may die in the process.
Both Antigone and Boadicea are villains who
transgress the law in order to fight for their values.

Answers

Answer:

Both Antigone and Boadicea are heroines who  choose their values over their lives, knowing they  may die in the process.

Explanation:

Archetypes are those patterns or models from which things are copied or taken after. It is, in a way, the universal symbol of a theme or setting or anything related to a particular idea.

The universal theme of "one's values [is] worth risking one's life for" is relevant for the characters of Antigone and Boadicea in both of these female characters. Antigone chose family ties in choosing to bury her brother over the orders of her king while Boadicea led her people to revolt against the Roman conquerors after the death of her husband.  

Thus, the correct answer is the third option.

Answer: C

Explanation:

Help me filling the blanks using correct preposition.Iam confused in A and B options


a] The children are playing ______the tree.
b] There is a bicycle ______ the children.
c] There are three apples ____the table.
d] There is a dog _______ the table.
e] Some birds are flying ____the sky.

Answers

Answer:a) under

b)behind

c)on

d) below

3)in

Explanation:

Answer:

a. On - The children are playing on the tree

b. Behind - There is a bicycle behind the children.

c. On - There are three apples on the table

d. Under - There is a dog under the table.

e. Above - Some birds are flying above the sky.

Your Environmental Science class is preparing contributions for the school's Go Green Initiative. Your contribution will be an explanatory essay on sunflowers. The audience for your essay will be other students, teachers, and parents. Using more than one of the sources provided, craft a thesis to explain the ways in which sunflower seeds can be used to create biofuel and the economic implications of this process. Then, write a multi-paragraph explanatory essay explaining your thesis. Questions to answer: What is the prompt asking you to do? What information do you need to gather to be able to answer this prompt effectively?

Answers

Answer:

What is the prompt asking you to do?

The prompt is asking you to write an esplanatory essay on sunflowers to your calssmates, teachers, and parents for the Go Green Initiative.

What information do you need to gather to be able to answer this prompt effectively?

Try going to a botany site with information on sunflowers. Make sure its a crediable site like .edu, .gov, or sometimes, .org.

Explanation:

Read the passage. Which three words are academic

Answers

Answer:

no passage

Explanation:

what to do mate

Develop a dialogue between a CS teacher and student regarding a project

Answers

Answer:

Student: Sir, should we make a statistical assessment of the results of the project?

CS teacher: I believe so, but I would like to see the results first and read the summary of your project, to indicate the best evaluation.

Student: If it is not necessary, I believe that we can finalize the project. Perhaps we can present it at the university's next science and technology symposium.

CS teacher: Send me what you've done so far, so I can evaluate it better. In addition, I need you to review the delivery dates for articles from the university magazine, to see if we can publish an article for this project.

Student: I'll see that right now.

CS teacher: Thank you.

Explanation:

The dialogue above was made between a student and a CS teacher about the completion of a project. This dialogue involves the evaluation of results and the publication of possible articles, in addition to the presentation of the same.

The dialogue was done in a fast, direct and clear language, as it should be between students and teachers busy with projects and dates and other bureaucracies in the academic environment.

which city has wetter climate

Answers

Answer:

San Diego

Explanation:

Answer: San Diego

Explanation:

16. Veros are action words and show movement. Name the verb in each sentence below. Yuri rides his bike. Mia smells the food . Claire holds the fork. Taylor sees her mom.

Answers

Answer:

"rides," "smells," "holds," and "sees."

What is most likely to be the subject of an Imagist poem?
O A. An exotic country
B. A difficult relationship
C. A biological process
D. A rusted bicycle

Answers

Answer:

a rusted bicycle

Explanation:

you can convey how it happens

Answer: a rusted bicycle

Explanation: just did on apex <3

Compare the United States with Canada?How are these places alike? Consider each place's geography, weather,food, and language. Write 5 paragraphs, each paragraph with 5 sentences please

Answers

Both Canada and the United States were colonized marjoritly by Great Britain and for that reason it has as its main language and English, which is spoken in almost the whole country, this is perhaps the strongest similarity between the two countries, but it is certainly not the only.

We can also mention that both countries are located on the same continent and in the same hemisphere, next to each other allowing them to share the largest border in the world.

Canada and the United States have different forms of government, but we can mention that both are democratic countries and that they maintain the Senate as the Upper House, even though Canada is not a republic. In addition, both countries have a capitalist economy and are developed countries, which means that both have a large number of immigrants who want to achieve better living standards than those found in their home countries.

Another similarity that can be mentioned is the religious freedom protected by the government of the two countries. Even with this freedom, the two present Christianity as the most popular religion, with more than 50% of the population as adherents.

In addition, we can say that industrial production in both countries is greater than rural production, which means that the majority of the population lives in urban environments and has access to better quality of life, for example, access to quality education. , as both countries have a very low illiteracy rate.

Compare and contrast ancient tales "the brave little parrot " and " if not higher".Explain specific moral,spritual and ethical aspects of human life both these ancient tales emphasize on?

Answers

Answer:

"The brave little parrot" represents Buddha in an animal form.  Behind its nature is the foundation of love.  Inspired to solve immediate problems in its environment, it fruitlessly tried to extinguish the fire burning a whole forest by dripping water from the ocean.  It did not wait for the super savers,  but acted with its little resources to eventually drive the big God to tears, which came down as a rainfall to quench the fire and joyfully restored the environment for the sake of the desperate animals inhabiting it.

On the other hand, "if not higher" depicts the sudden disappearance of the Rabbi during the Penitential service.  The Rabbi did not disappear into heaven during the service but went to the wood to cut firewood for some sick woman who needed the warmth from a fireside.  Truly, the Rabbi ascended into the highest heavens, by allowing himself to be driven by love.  God will answer his prayers readily because he is practical and knows what it means to answer the prayers of needy people.

The moral, spiritual, and ethical teachings in these ancient tales are comparable, with the contrast existing only in the personalities involved in the tales.   Buddha is supposed to a God, but he came in the nature of a parrot.  The Rabbi is a minister of God, who directs the people's prayers to God, but he tries his best to solve people's problems, at least in the name and for the sake of God.

Everyone needs to make a difference in our world with our little resources.  When we try, who knows, God will come to our aid to solve the big problems which we cannot handle.

We can turn our long prayers to little kindness and love here and thereafter.  They are more powerful and move God because He dwells in love.

Explanation:

"The brave little parrot" was written by Martin Rafe, 1998.  Its teaching will help children to understand the important of sharing love.  

Like the "if not higher" short story by I.L. Peretz which depicted the disappearance of the Rabbi during the Penitential service, as an ascent into heaven, these tales have rich moral, spiritual, and ethical lessons for everyone interested in living a "good samaritan" life.

One way to punctuate a compound sentence correctly is to join the two independent clauses with a comma. a semicolon. a comma and a subordinating conjunction. a semicolon and a coordinating conjunction.Which contains an independent clause? Because the tragic fumble was scored by the visiting team in the last minute. When the player, in an extraordinary move, went charging down the field. As the uproar from the delirious fans exploded jubilantly through the stadium. While the team made their play, the frenzied crowd cheered them to victory.

Answers

Answer:

While the team made their play, the frenzies crowd cheered them to victory.

Explanation:

comma between the two clauses.

"the frenzies crowd cheered them to victory" could be a sentence of its own. this makes it an independent clause.


Which two words most suggest that the narrator does not enjoy the game?

Answers

Answer:

The question is ambiguous

What is the “Star Trek effect”?

Answers

Answer:

The "Star Trek" effect is the cultural impact that the television show has had on societies where it has been shown regularly since the 1960s.

Explanation:

Spring is the mischief in me, and I wonder If I could put a notion in his head: "Why do they make good neighbours? Isn't it Where there are cows? But here there are no cows. Before I built a wall I'd ask to know What I was walling in or walling out, And to whom I was like to give offence. Something there is that doesn't love a wall, That wants it down." Now read "The Pasture," also by Robert Frost. I’m going out to clean the pasture spring; I’ll only stop to rake the leaves away (And wait to watch the water clear, I may): I shan’t be gone long.—You come too. I’m going out to fetch the little calf That’s standing by the mother. It’s so young, It totters when she licks it with her tongue. I shan’t be gone long.—You come too. Which best accounts for the different views of spring expressed in the poems?

Answers

Answer:

The poems have different speakers.

Explanation:

This question is incomplete. According to a different source, these are the options that come with this question:

Frost’s opinions changed through time. The poems have different speakers. Frost’s speakers represent his own views. The poems were written at different locations.

In this question, we see two different poems written by the same author, Robert Frost. In the first poem, Frost talks about the building of a wall, and how this is perceived not only by the person building the wall, but by others. In the second case, Frost talks about a calf, and how this symbolizes the beginning of the spring. The views that are expressed about spring are different because the speakers in the poem are different as well. Therefore, they each focus on different elements of spring.

Answer:

B  the poems have different speakers

Describe the subject and one central theme of "A Poem of Changgan" by Li Po. Cite evidence from the poem to support your response

Answers

Answer:

The subject matter of "A Poem of Changsha" is love. One central theme of the poem is steadfastness in love. In the following lines, the speaker describes her love for her husband lasting beyond this life:

But at fifteen I straightened my brows and laughed,

Learning that no dust could ever seal our love,

That even unto death I would await you by my post

And would never lose heart in the tower of silent watching.

Explanation:

Answer:

The subject matter of "A Poem of Changgan" is love. One central theme of the poem is steadfastness in love. In the following lines, the speaker describes her love for her husband lasting beyond this life:

But at fifteen I straightened my brows and laughed,

Learning that no dust could ever seal our love,

That even unto death I would await you by my post

And would never lose heart in the tower of silent watching.

Explanation:

This is the sample answer for plato

I got a test of 21 questions leave your number if you answer them and get 80 percent on I’ll pay you if you get 100 I’ll pay really good

Answers

how much will you pay

appeals to logos were common in colonial era rhetoric because so many people believed in ____.

Answers

Answer:

Rationalism

Explanation: Appeals to logos were very common in colonial era writing because of a widespread belief in Rationalism — people took reason and logic seriously.

Other Questions
the formula s= I dont know how to type that but I really need helppppp Pasteur's experiments proved that ________. Pasteur's experiments proved that ________. spontaneous generation can only occur if nutrient broth is left open to the environment cells cannot survive in swan-necked flasks preexisting cells present in the air can grow in sterilized nutrient broth sterilizing nutrient broth prevents spontaneous generation in order to grow, cells need to be supplied with oxygen please help !!!!! please note that two images are there................ i am urgently needs this question On a plane trip, baggage over 40 pounds ischarged at the rate per pound of 1% of the one-way fare. The charge for a bag weighing 52pounds on a trip where the one-way fare is $98is:HELP PLEASEE!! QUICK!! When the hydraulic conductivity Ks = 10 mm/hr; effective matrix potential Ns = 20 mm, and rainfall intensity I = 30 mm/hr , determine the amount of runoff generated when the runoff rate reaches 15 mm/hr?( 2.7 mm or 0.21 mm or 18 mm or 0.67 mm) PLS HELP ASAP Solve the inequality and enter your solution as an inequality in the box below 8>4-x>6 difference between photosynthesis and respiration In a survey of adults in a certain country conducted during a period of economic uncertainty, % thought that wages paid to workers in industry were too low. The margin of error was percentage points with % confidence. For parts (a) through (d) below, which represent a reasonable interpretation of the survey results? For those that are not reasonable, explain the flaw. how many are 2 raised to 2 ??? Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG This rectangular patio is tiled using 50 cm by 50 cm square tiles. How many tiles are used? Imagine that you are the supply chain manager for the Magic Widget company and you need to measure your supply chain performance. The chart shows the financial variables that you will need to perform your task. Financial Variables Total Assets (in $ billions) 15.1 Cost of Goods Sold (in $ billions) 14.3 Inventory: Raw Material Inventory (in $ billions) 0.76 Work-in-progress Inventory (in $ billions) 0.12 Finished Goods Inventory (in $ billions) 0.82 Compute the percentage of assets committed to inventory and inventory turnover. What is the quotient of 35,423 15? The plateau phase of population growth is best described as: A. The population stops growing because they moved into the plateau environment at this stage. B. The population pauses in its growth after a natural disaster before growing again. C. The population moves onto a large, raised, flat area called a plateau for protection from predator. D. The population stops growing because the environment has reached its carrying capacity. The Coriolis effect Choose one: A. causes north-flowing currents in the northern hemisphere to curve to the west. B. causes the same direction of deflection in the northern and southern hemispheres. C. is a deflection of wind or water flowing over the Earth's surface. D. is a phenomenon created by the movement of ocean currents. Light passes through a single slit. If the width of the slit is reduced, what happens to the width of the central bright fringe Our Senate has finally emerged from weeks of debate with a decided version of the Missouri Compromise. Among its list of provisions, all lands acquired in the Louisiana Purchase that are north of the southern border of Missouri, with the exception of Arkansas, will now d. Write the symbol for the nucleus that completes each nuclear equation. (1 point each) URGENT PLS HELP ASAP! THANK YOU :) What is the x-value of point A?