advantages and disadvantages of group communication​

Answers

Answer 1

Answer:

ADVANTAGES

1) Increased Output  

2) More Resources  

3) Reliability  

4) Unbiased Execution

5) More Productive  

DISADVANTAGES

1) Unequal Participation

2) No Individual thinking  

3) Loss of Creativity

4) Possibility of Unequal Credit

Answer 2

Answer:

Group projects can also help students develop skills specific to collaborative efforts, allowing students to...

Tackle more complex problems than they could on their own.

Delegate roles and responsibilities.

Share diverse perspectives.

Pool knowledge and skills.

Hold one another (and be held) accountable.

Disadvantages of Communication

Poor planning. Effective communication seldom happens by chance. ...

Poorly worded messages. ...

Semantic problems. ...

Status differences between sender and receiver. ...


Related Questions

5) The founders were deeply concerned about the development of political parties and factions in the United States. Why, then, did they develop and how do parties structure American politics

Answers

Answer:

In the early days of America as a nation, the Founding Fathers considered that political parties were unnecessary elements for the normal development of political life in American society. They believed that these organizations were not positive, but instead aimed at generating internal divisions and creating unnecessary conflicts among citizens.

Therefore, the Founding Fathers were concerned to avoid the development of these political parties, but with the course of history the Founding Fathers themselves began to have ideological conflicts and political positioning differences among them, which motivated the development of support groups that would eventually end up becoming those political parties that the Founding Fathers themselves sought to avoid. Especially, the first political parties were the Federalist Party and the Democratic Republican Party: they developed towards the second term of President Washington, based on the differences between the different ideological groups regarding the role of the Federal Government and of each of the states.

Today, the predominant parties are the Democratic Party and the Republican Party, the former being the majority expression of the nation's liberals, while the Republicans are the conservative faction of the United States' society. Thus, the main role of political parties today is to channel opinions and ideologies, giving them an institutional framework that allows them to organize themselves politically to make joint decisions in favor of the nation.

You are conducting a research project about life during the Civil Rights Movement. Which source of information would be the MOST credible and reliable source for the project? Group of answer choices Asking your US History teacher questions History An interview of someone who lived during the Civil Rights Movement Jackie Robinson’s personal diary

Answers

Answer: An interview of someone who lived during the Civil Rights Movement

Explanation:

Since the research project is about life during the Civil Rights Movement, the source of information that would be the most credible and reliable source for the project will be an interview of someone who lived during the Civil Rights Movement.

Unlike the other options such as asking the US History teacher questions, Jackie Robinson’s personal diary or the website, an interview of someone who lived during the Civil Rights Movement will help in giving a first hand account of what happened. This will serve as an authoritative price of information

explain how Human Development Index (HDI) are used as indicator to measure development

Answers

Answer:

plz mark me as brainiest

Explanation:

The Human Development Index (HDI) is a summary measure of average achievement in key dimensions of human development: a long and healthy life, being knowledgeable and have a decent standard of living. ... The HDI uses the logarithm of income, to reflect the diminishing importance of income with increasing GNI                                      

plzzzzzzzzzzzz mark me as brainiest

Can Denel company be regarded as Monopoly​

Answers

Answer:

Denel can at present, without doubt, be regarded as a public monopoly. The absence of competition can thus induce the monopolist to decrease production and so to increase prices.

Answer:

Denel can at present, without doubt, be regarded as a public monopoly.

Explanation:

Did you disagree with a point raised during the discussion? How did you respond to it?

Answers

Answer:

I had disagreed. I responded to it by calmly stating my opinion towards the point that had been raised and made sure that I didn't offend anyone during me doing so.

express your views on how the law the citizens and community can protect and support victims of human rights violation​

Answers

Answer:

plz mark me as brainiest

Explanation:

On the support of victims of human rights violation, the law should clearly state and express the repercussions of violating human rights. ... The community can mobilize and make aware the people of their rights and also allow any victim of human rights violations to face the law and seek justice

Would you have been convinced of the need for relocation of Japanese-Americans if you were living in the United States in 1942?

Answers

Answer:

No, because the Japanese living in America were under the influence of Capitalism while the Japanese living in Japan were under the influence of Imperialism and the emperor while no one was ever convicted of any serious acts of espionage or sabatoge.

Explanation:

Hope this helps, god bless you~

As Allied Powers fought in Italy, they fought mainly Germans because…

Answers

Answer:

A) Mussolini had been overthrown and killed by his own people.

Explanation:

No explanation

In what document do you find information regarding freedom of speech, religion, and press?

A.
the Declaration of Independence


B.
the Articles of Confederation


C.
the Bill of Rights


D.
the Gettysburg Address

Answers

The Bill of Rights would be the answer

HI everybody could anyone can help me in this question

List the mistakes committed by Muhammad bin tuglaq as a sultan and describe any one of which according to was the most serious.Give reason


Please​

Answers

Answer copied in whole from brainly user spsharvesh2008, posted July 2020 on the exact same question here:

https://brainly.in/question/20022562

Answer:

Mohammed bin Tughlaq made many mistakes dring his reign, 1325 to 1351

the biggest mistakes committed by Muhammad Tughlaq are as follows

■Taxation in the doab( fertile region between the Ganga and Yamuna rivers) - He increased the tax in the doab region. But his timing was not right. The doab region was facing a severe famine. Many peasants had to move away from the region. Some of them also revolted. So, the king had to withdraw its orders.

■Shift of Capital - The sultan thought that if he shifted the capital from Delhi to Devagiri, which he remaned Daulatabad, he could control the mepire better. He also thought he could be safe from the Mongol raids. He ordered the entire populationof Delhi to move to Daulatabad. This angered many people, but they had to move. Then after they moved, the Sultan realized that it was impossible to look over the northern frontiers. So he ordered the population to move back to Delhi. This affected the prestige of the empire.

■Token currency - There was a worldwide shortage of silver during his reign, so the Sultan issued brass and copper coins. They had the same value as silver coins. They could be exchanged for silver coins in the royal treasury. The design on these coins were simple and brass and copper were cheap, so the ordinary craftsmen could make them very easily. Money lost its value. The royal treasury flooded with brass and copper coins.

define social media footprint​

Answers

Basically anything you put, post, or share on the internet and online, like videos, pictures, and your browsing history.

The digital footprint that a person or business leaves behind as a result of their interactions and activity on various social media platforms is referred to as their "social media footprint."

It includes one's total digital identity they create on social media, as well as the collective influence and exposure of their online presence, including the material one publish, the comments they make, the relationships they have, and more.

The activities and information published on social media sites, such as posts, images, videos, comments, likes, and shares, leave a digital trail. It depicts a person's or an organization's reputation and image online.

Learn more about social media footprint, here:

https://brainly.com/question/27834450

#SPJ5

disadvantage of electronic media as part of a campaign for human rights violation​

Answers

Explanation:

Human rights violations are diverse in nature, stemming from willful transgressions against—or neglect of—basic principles stated in the International Bill of Human Rights and subsequent instruments. Evidence of human rights violations, correspondingly, comes in many forms and is created for many purposes.

Human Rights electronic evidence is any information created or stored in digital form that is relevant to establishing the occurrence of a human rights event. It is collected on an increasingly diverse array of devices including computers, cell phones, video recorders, and cameras. It may consist of first-person (primary source) recordings of events; testimonials and statements after the event has occurred; news articles and videos; forensic evidence collected with the intention of establishing facts of what occurred; and any manner of additional materials collected through real-time monitoring or subsequent investigation. The types of documentation created may include, but are not limited to:

digitally generated images and digitally encoded audio and video

networked communications, such as e-mail and text messages

information created and disseminated via web-based technologies (web pages, blogs, Twitter posts, and other social media)

human- or computer-generated files in “born-digital” format (text files, wordprocessing documents, spreadsheets, data files, indices, logs)

database records, indices, reports, and supporting management systems

records of transactions (including communication logs and financial transactions)

court records, testimonies, and supporting documentation gathered as a result of judicial processes, and

digitally converted evidence from content previously contained in analog formats (scanned images of a physical document, digitized audio or video,

What was a MAJOR difference between the Articles of Confederation and the Constitution?

A.
The government lacked an executive branch under the Articles.


B.
The right to treat slaves as property was not recognized under the Constitution.


C.
Citizens participated more directly in making laws under the Articles.


D.
The power of individual states was greater under the Constitution.

Answers

A is the answer to this question
government lacked executive branch

which of the following is not the result of soil erosion​

Answers

Can you Post the following. So I can maybe help.

according to South African press code how news supposed to be reported​

Answers

Answer: U have to be more detailed with this question

Explanation:

IS there anymore information

What is the best representation of this political cartoon

Answers

Answer:

The Plumb-pudding in Danger

James Gillray's The Plumb-pudding in Danger (1805). The world being carved up into spheres of influence between Pitt and Napoleon. According to Martin Rowson, it is "probably the most famous political cartoon of all time—it has been stolen over and over and over again by cartoonists ever since."

What extent does Government support communities affected by Gender based violence​

Answers

Answer:

The Department of Social Development is funding 102 shelters for victims of gender-based violence and has also established 19 White Doors (safe houses) to provide safety and shelter services to mostly victims of domestic violence.

Explanation:

how can social pressure be regarded as a stressor for young people in their family relationships

Answers

Answer:

Peer pressure might encourage teens to become more active in athletics or to avoid risky behaviors. Or it could lead them to try alcohol or drugs, skip school or engage in other negative behaviors

Explanation:

Affiliation with friends who engage in risk behaviors has been shown to be a strong predictor of an adolescent's own behavior. Peer pressure can also have positive effects when youth are pressured by their peers toward positive behavior, such as volunteering for charity or excelling in academics.

What's the difference between retribution / retrospective punishment and rehabilitation / prospective punishment?

Answers

It is commonly said that the difference between consequentialist and retributive theories of punishment is that the former is prospective, looking to the good that punishment may accomplish, while the latter is retrospective, seeking to do justice for what a wrongdoer has done

(What is proportional development?)​

Answers

i remember it being development and growth of the brain i’m not sure sorry :/

What are some important counterpoints (arguments against) to sexual assault?

Answers

Answer:

there are none the victim is right

Explanation:

Here are some milestones in the development of technology used by geographers. Put them in the order in which they appeared in history

Answers

Answer:

1. Cartography

2. Navigational compass

3.Photography

4. Internet

Explanation:

Cartography: is a method of designing, creating and studying geographic locations on flat surfaces like maps. This scientific method dates to some thousands of years ago. It dates to pre-historic times as far back as 2300 BCE when the Babylonians represented locations in clay tablets.

Navigational compass: is thought to have originated in the Han Dynasty in China between the 2nd century BC and the 1st century AD. Then it was used for fortune-telling and was called the "South Pointing Fish." It was adapted as a navigational compass in the Song Dynasty in the 11th century.

Photography: This originated in the 19th century precisely the late 1830's when Nicéphore Niépce captured the pewter plate exposed t light and coated with bitumen. In the later part of the century, geographers began adapting it to their work.

Internet: the inventions of computers in the 1950's came along with the internet that has been a useful resource for geographers.

Which of the following is true of sexual patterns in established marriages?
5
Multiple Choice
A.On days when people report high closeness to a spouse, the link between positive affect and lust is stronger.
B.Most married couples report that their sexual relationship is often or always "routine."
C.Contrary to popular belief, having a baby has very little impact on the sexual relationship of the couple.
D.Four years after having a child, parents have a much higher sexual frequency than six months after having a child.

Answers

Answer: B Explanation: most married couples sexual patterns are always a routine they do the same thing every time and never change up things that might cause problems In there marriage

1. What is a
National Library of South Africa? ​

Answers

Answer:

its made by Rocky Ralebipi-Simela

it was called

NLSA

The National Library of South Africa (NLSA) is the custodian and provider of the nation's key knowledge resource

Explanation:

How did the Fourteenth Amendment help former slaves?

A.
It made them citizens of the United States.


B.
It provided ways for them to move to other parts of the country.


C.
It gave them farms of their own.


D.
It outlawed the Ku Klux Klan.

Answers

Answer:

A It made them citizens of the United States

Answer: I believe it’s

A. It made them citizens of the United States.

Explanation: The 14th Amendment to the U.S. Constitution granted citizenship to all people born in the US, even former enslaved people.

I hope this helped you :)

name the religion religion believe in the teacher of roster he lived in Iran about 2500 years ago he talked that our duty is to be good and fight Evil​

Answers

Answer:

Zoroastrianism

Explanation:

Zarathustra was known for his teachings on being religious and was opposed by civilians for what he believed in.

Hope this is right!

What is the name for a group of people who are considered nearly equal in spending habits, regularly socialize among themselves, and share many behavioural traits

Answers

Answer:

Social class

Explanation:

Sociology can be defined as a social science that deals with the study of the socio-cultural interaction of humans with respect to the structure, functioning and development of their society.

The main purpose of sociology is to develop and enhance human knowledge or understanding of important socio-cultural processes through the gathering and analysis of all aspects of the social life of the people living in a society.

A sociologist refers to an individual (scientist) that studies sociology i.e a social scientist.

A social class can be defined as a group of people who have a similar spending habits, community esteem or status, regularly limit socialization among themselves (peers) both informally and formally, and share many behavioural traits or norms in common.

Basically, the following are parameters or factors used for the measurement of a social class; education, income, wealth, occupation, etc. Thus, a social class refers to a division of the society that have similar social, political, cultural, educational, and economic qualities.

what is meant by women education​

Answers

What is meant by women education?

Every form of education aimed at developing the knowledge and skills of women and girls is referred to as women's education. General education in schools and colleges, vocational and technical education, professional education, health education, and so on are all included.

☆彡Hanna

#CarryOnLearning

Why don’t humans turn green

Answers

Answer:

In fact, human blood is always a little bit green. We usally don't notice the green color of blood because there is typically so much more red light being reflected by the blood. ... The deeper you go in the ocean, the less red light there is in the sunlight that reaches you

Explanation:

hope it's help you

human blood is always a little bit green. We usally don't notice the green color of blood because there is typically so much more red light being reflected by the blood. ... The deeper you go in the ocean, the less red light there is in the sunlight that reaches you.

The basic purpose of the bill of rights was to ??

Answers

Answer:

The basic purpose of the bill of rights was to basically spell out American's 10 rights that they had.

Other Questions
After World War I, how did former Ottoman territories differ from formerAustro-Hungarian territories? The volume of a sphere is 904.32 mm3. What is the approximate volume of a cone that has the same height and a circular base with the same diameter? Use 3.14 for and round to the nearest hundredth. Neurons of the diencephalon are known As _____ neurons. A. First-order. B. Lower motor C. Second-order D. Upper motor E. Third-order Which of the following equations correctly represents the distance between points (1, -1) and (-2, 2)? Rewrite the sentence to eliminate ambiguous, remote, or broad reference.If a person has income tax questions, the IRS can help you with it. The two general types of air pollution are _____ and _____.invisibleparticlesgasesliquid Glycolysis takes place in _________________. The cytoplasm The mitochondrial intermembrane space The mitochondrial matrix The endoplasmic reticulum Which sentence correctly uses a comma to join independent clauses? Answer this guys please What is the degree of 1 Which detail is most important to include in a summary? Electric current is the flow of ________ through a substance. Read the excerpt from a report. (1) Stopping trash before it gets to the ocean is way better than having to clean it up in the ocean. (2) The city of Baltimore has a large machine called Mr. Trash Wheel. (3) The machine is powered by the sun and the flow of the river. (4) Floating booms off the front of the machine funnel garbage toward a conveyor belt. (5) The belt takes the garbage from the water and puts it in a dumpster. (6) The trash wheel helps collect garbage in the river after it flows out into the ocean.Which revision improves the professional tone of the text?Change sentence 1 to: Preventing garbage from entering the ocean is more effective than removing waste from the sea.Change sentence 2 to: The city of Baltimore has really cool machine called Mr. Trash Wheel.Change sentence 4 to: Floating booms and a conveyor belt help the machine work its magic.Change sentence 5 to: The belt takes a bunch of the garbage from the water and then tosses it in a dumpster. Please helpExplain two audiences groups that the movie is sustainable for a bank robbery movie? explain in two different paragraphs. 5 to the power -2 * 5x is equal to 1 solve for x If he jumps from the plane with a velocity of +2 ft/s and, after 7 seconds of free fall, he has a velocity of -223ft/s, what is his displacement? Albino Moth - Unknown Allell is listed here. Transcribe it into mRNA andthen translate it into amino acids using the codon table. You only need topost the amino acids. DNA - TGG GGT AAG GAC GAG CGC ATC CAGAGPheUUUUUC)UUAUUGCysUGUUGCUGAUAUUAC)TyUAAStopSerLeuStopUGGTrpUCUUCCUCAUCGCCUCCACCGUAG)CAUTCAC)CUUCUCCUACUGHisLeuProCGUCGCCGACGGArgCAACAG)AAUGinlleSerAUUAUCAUAAUGACUACCACAACGThrAAC) AsnAGUAGC)AGAAGG)Met 13GAUArgGUUGUCValGCUGCCGCAGCGAlaGAC} AspGGUGGCGGAGGGGlyGUAGAAGAGGluGUG If two opposing forces are equal, then the net force is 0 N.true or false? Which is a quadratic function?A y = X-9B y = x +9C y = x + 2x -9 Describe how a jump rope can be used to model a cell membrane of a plant cell