Except viscosity, all the other factors affect the temperature at which magma forms. Therefore, the correct option is D.
What is viscosity?Viscosity can be defined as a measure of the fluid's resistance to flow. Magma can be defined as a very hot molten or semi-molten substance that is formed due to volcanic eruptions. They are responsible for the formation of the igneous rocks.
There are many factors that affect the temperature at which magma forms:
Pressure-increasing pressure can raise the melting temperature of rocks, while decreasing pressure can lower it.Composition of source material: The composition of the rocks in the mantle can vary depending on the location and geological history of the region. Presence of water: Water can lower the melting point of rocks, which can lead to the formation of magma.But viscosity does not play any role in impacting the temperature at which magma forms. Therefore, the correct option is D.
Learn more about viscosity, here:
https://brainly.com/question/30263409
#SPJ6
The question is incomplete, but most probably the complete question is,
All the following affect the temperature at which magma forms EXCEPT
A. pressure
B. composition of source material
C. water
D. viscosity
Starch is a polysaccharide used as a component of cell walls in plants.
True
False
Answer:
false
Explanation:
is type of carbohydrates
False. Starch is a polysaccharide used as an energy storage molecule in plants, but it is not a component of cell walls.
What are structural component of cell wall?Cell walls are structural components found in the outermost layers of cells in plants, fungi, and some bacteria. They provide support and protection for the cell, and are composed of a variety of different biomolecules, including cellulose, pectin, and lignin.
Starch, on the other hand, is a complex carbohydrate that is synthesized and stored in the cells of plants, particularly in the seeds, roots, and tubers. It is made up of long chains of glucose molecules and is used by plants as an energy source, particularly during times when the plant does not have access to light for photosynthesis. Starch is not a component of cell walls.
Learn more about cell wall, here:
https://brainly.com/question/965751
#SPJ2
Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]
Answer:
- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*
- DNA 5' UTR: ATTTTAGCC
- RNA 3' UTR: UAAAAAUAAAAU
Explanation:
Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.
Which process produces genetically identical cells?
A. Meiosis
B. Mitosis
Answer:
mitosis produce genetically identical cells
Answer:
B mitosis i think .......
State two substances which will
diffuse out of a cell:
(I already know Carbon Dioxide)
Water and Oxygen.
Hope this helps; have a great day!
write a short story on the journey of a sperm cell seeking to enter in a egg cell to share life together as a zygote and beyond
(See the attached picture)
Direction: Write a short story on the journey of a sperm cell seeking to enter in a egg cell to share life together as a zygote and beyond.
Answer:The goal of the sperms’ journey to the egg is to fertilize it. To do so, the sperm cell must pass through a long and challenging path. This is one of the reasons why the total number of motile sperm cells is very important, and a key parameter for a man’s potential to reach pregnancy with his partner.
The sperms’ journey to the egg begins with millions of sperm cells that are released into the female reproductive tract during intercourse. The sperm cells gain their full ability to swim when they are ejaculated into the reproductive tract.
Upon ejaculation, the sperm cells are enclosed in a fluid called seminal plasma or semen, which is a mix of fluids from the testes, seminal vesicles, prostate, and the bulbourethral glands. The fluid contains elements which protect the sperm cells during their journey towards the egg. The semen thickens and helps the sperm cells stay inside the woman – as close as possible to the cervix, which is the “gate” to the egg.
Liquid extends from the cervix, allowing the sperm cells from the semen to swim into the cervix. Only the strongest sperm cells will make it this far. Once through the cervix, the sperm cells swim across the uterus and into the fallopian tubes.
I hope it helps!!The sperm cell fertilizes the egg and forms a zygote, which is further divided into multiple cells and becomes a child. The division is the process of mitosis that takes place from the zygote to the child's development.
How is the zygote formed and developed?The sperm and the ovum are produced by the process of meiosis from the male and female, respectively, and when both fertilize, the zygote is formed. The fertilized zygote is a single cell, but later that cell is further divided mitotically and forms a morula, then a blastula, and then the gastrula.
The cells of the gastrula undergo cell differentiation, different organs are developed, and the baby is finally formed. The child then continues to grow in size, and different organs grow and form the mature organ system. After a certain age, the reproductive organs start to mature and are capable of forming the gametes.
Hence, all of these events occurred from the zygote to the child's maturity.
Learn more about the zygote here.
https://brainly.com/question/465851
#SPJ2
Explain how different types of cells help organisms live and grow?
Different types of cells have different jobs that are necessary to keep organisms alive.
Different types of cells are only found in specific types of organisms.
Cells are necessary in order for all organisms to grow big and hunt for their food source.
Cells provide support for all organisms to be able to move.
Answer:
Different types of cells have different jobs that are necessary to keep organisms alive. And cells also give the living animal more support. They also hold the genetic information of that organism in their nucules. This is with most cells but bacteria cells do not contain nucules.
Because it is ______ , fermentation _______ oxygen.
Answers:
aerobic/requires
anaerobic/requires
aerobic/does not require
anaerobic/does not require
Answer:
anaerobic/does not require
Explanation:
anaerobic occurs in the absence of oxygenFarmer toon soon wanted to start breeding his plants so that they are resistant to disease while producing more fruit per plant.Which plants should the farmers cross to get the desired (wanted) combination of traits
Answer:
cultivated plant variety with its wild type variety.
Explanation:
The farmer cross the cultivated plant variety to its wild type which has the characteristics of resistance against diseases. Due to crossing, the offspring produce having resistance against that disease as well as producing high yield. This type of crossing is known as artificial selection in which humans cross two organisms to get the desired characteristics in their offspring so to get a plant with resistance against disease we cross cultivated plant variety to its wild type.
which process produce two genetically distinct haploid cells
Answer: mitosis
Explanation:
99% of the GMOs on the planet are ____
or ____
Answer:
The answer would be pesticide producers and herbicide resisters.
Explanation:
Hope this helped!
If y'all know science can y'all do dis, it's a multiple-choice question
' What is the net force required to give a box of mass 5 kg an acceleration of 4 m/s2 ?'
The answer to the question is
The number 20.
Hope this helps you. Sorry if i am wrong.
Scientists are studying the mating habits of a population of butterfly fish on a Caribbean coral reef. They discover that both the largest and smallest males get the most mates and pass on the largest number of genes to the population's offspring. The largest males get a large number of mates because they can guard the females, preventing most of the smaller males from mating. However, the very smallest males also get a large number of mates because they escape the notice of the larger males and are able to mate with the females quickly. Based on these observations, which selective force appears to be acting on male body size in this population?
Answer:
The correct answer is - Disruptive selection.
Explanation:
Disruptive selection is a mode of natural selection that exhibits that two extreme values of phenotypic traits of the population are favored by this population than the population with their intermediate values. Disruptive selection occurs when there is a fitness advantage of extreme values of phenotypic traits over more intermediate phenotypes.
In this case, the largest males mates more, due to fact that they can guard the females, than smaller males. The smallest fishes also get a high number of mates as are able to mate with the females quickly without coming to the notice of larger males.
The ___ of water molecules and the hydrogen bonds between water molecules explain most of water's life-supporting properties.
The ___ of water molecules to each other helps transport water from the roots to the leaves on plants.
When water warms or cools, ____ either break or form.
Thus, water absorbs or releases a great deal of ____, helping to moderate temperatures.
Water is a versatile ____.
Blood and other biological fluids are aqueous solutions with a diversity of dissolved ______.
Answer:
The polarity of water molecules and the hydrogen bonds between water molecules explain most of water's life-supporting properties.
The cohesion of water molecules to each other helps transport water from the roots to the leaves on plants.
When water warms or cools, hydrogen bonds either break or form.
Thus, water absorbs or releases a great deal of heat, helping to moderate temperatures.
Water is a versatile solvent.
Blood and other biological fluids are aqueous solutions with a diversity of dissolved solutes.
Explanation:
The sentences presented in the question above had their various spaces complemented by the words that best fit the sentence and that were capable of forming true invormations on water.
Water is a very versatile solvent as it is capable of dissolving and mixing with various substances both liquid and solid. Furthermore, water has a great capacity to absorb or release heat, which is very useful for the entire planet, as this allows water to be very efficient in regulating temperature.
Water is formed by H2O molecules, which hold these molecules together are the hydrogen bridges formed between them. Hydrogen bridges are broken through heat, which allows the water to evaporate, but at low temperatures these bridges are strengthened and new bridges can be created, which allows the water to become solid.
The properties of water are extremely important for life on the planet and for most biological processes we know about. Among these properties we can mention polarity and cohesion as one of the most important. Polarity allows water to be a polar substance, while cohesion allows water to create an attractive relationship between molecules.
two types of global food webs show the feeding relationships of organsms. What distinguishes one type of global web from the other?
A whether the producers are located on land or in water
B whether or not the food web includes tertiary consumers
C whether the web includes animals that migrate during the year
D whether the ecosystem described by the web is localized or very broad
Answer:
A. wheter the producers are located on land or in the water.
If earth’s atmosphere is made up of 78% nitrogen, why is nitrogen a limiting factor for producers?
A.
Consumers respire all of the available nitrogen.
B.
Nitrogen is unusable in its liquid form.
C.
There are more plants than gaseous nitrogen.
D.
Nitrogen is unusable in its gaseous form.
Choose the combination of factors that creates snow.
Answer:
Relative Humidity- Low
Air tempurature-cold
Air Pressure-low
Explanation:
High pressure, warm temperatures, and high humidity are factors that creates snow.
What are the factors that create snow?Snow and/or ice formation requires temperatures below freezing, both in the atmosphere and close to the ground.
Something that will induce the moist air to rise, forming clouds and precipitation, moisture, produces precipitation and clouds.
Water that has frozen solidly is snow, and the atmosphere (layer of gases around Earth) contains water in the form of vapor (gas). When there is a lot of vapor present, clouds develop, fill up with water droplets, and eventually begin to rain.
Therefore, when a very cold water droplet freezes onto a pollen or dust particle in the atmosphere, a snowflake starts to form.
Learn more about snow, here:
https://brainly.com/question/29372094
#SPJ2
Questions are in the attachments I’ll give a brainlist
menstruation
it is the shedding of endometrium layer of uterus in females
it is a cycle of 28 days and menstruation occurs in first 5 days of cycle
if female is pregnant then there ia no menstruation
Answer:
mensturation
Explanation:
if the unfertilized egg pass out of the female body then mensturation occurs but if the egg fertilized with the men's sperm the fertilized egg travels through the fallopian tube to implant itself into the uterus.And finally women is considered pregnant.
Each Taxonomy (category) gets less and less specific as they go further down the list.
A. True
B. False
Answer:
B. False
Explanation:
The levels of classification, from broadest to most specific, include: kingdom, phylum, class, order, family, genus, and species.
Answer:
B. False
Explanation:
Taxonomy is the study of the general principles of scientific classification.
The diagram above illustrates the carbon cycle. Which of the Following components of the diagram represent carbon sinks?
A. marine photosynthesis and respiration
B. volcanoes and soil carbon
C. oceans and fossil carbon
D. factories and photosynthesis
Answer:
D) Factories and Photosynthesis
What are the non-living components of an ecosystem?
Summary of human nutrition
Answer:
Human nutrition is the process of which substances are Transformed into tissues and energy which are used up to mental and physical activities!
i need help with this question
The skull and vertebrae are part of the _________ in vertebrates. circulatory system endoskeleton nervous system exoskeleton Science
Answer:
Endoskeleton
Explanation:
Hope this helps!
Answer:
nerveos systum i think is tha anser
PLEASE HELP! WILL MARK BRANLIEST!
The amount of carbon today is the exact amount that has always been on Earth. T or F
Answer:
False
Explanation:
Every time, the amount of carbon increases depending on the population that has grown on our planet. Carbon is a chemical substance that is created by human activities which are wood, coal, natural gas, gasoline, and oil, If it is burned, Carbon dioxide is released and mixing it in the air and continuously adds for as long as they keep doing it.
Thank you! ^^
Which of the following best represents the purpose of fertilizers?
Answer:
Fertilizer, natural or artificial substance containing the chemical elements that improve growth and productiveness of plants. Fertilizers enhance the natural fertility of the soil or replace the chemical elements taken from the soil by previous crops.
Which of the following is a subsystem of an organism?
a.cell
b.organ system
c.tissue
d.all of the above
Answer:
d
Explanation:
this type of cell is found in females and is needed for reproduction
Answer:
egg cell
Explanation:
Gametes are an organism's reproductive cells. They are also referred to as sex cells. Female gametes are called ova or egg cells, and male gametes are called sperm. Gametes are haploid cells, and each cell carries only one copy of each chromosome.
Write mechanism of absorption
Answer: The mechanism for absorption is that a photon transfers all its energy to an electron in the absorbing material. The photon is "lost" from the light beam as it is absorbed in a single event. The electron is excited by the gain in energy to a higher energy state in the electron configuration around the atom. (hope it helps)
Answer: I don't know
Explanation: i am brainless
A single species can feed at only one tropic level
True
False
Answer: True sorry if I’m wrong.
Explanation:
Answer:
True
Explanation:
is eczema recessive or dominant? explain why or how.
Answer:
When caused by CARD11 gene mutations, atopic dermatitis has an autosomal dominant inheritance pattern , which means one copy of the altered CARD11 gene in each cell is sufficient to cause the disorder.
Explanation:
pls mark brainlest