Alphabetical order import,inflation,invoice,inventory

Answers

Answer 1

Answer:

import, inflation, inventory, invoice

Explanation:

:)

Answer 2
import, inflation, inventory, and invoice

Related Questions

What are some of the external motivations that shape who you are every day?

Answers

Answer:

friends

people

experience

nature

games

happyness

sadness

music

math

learning

life

etc

Explanation:

Fjfjfnf c ref f f f g f f f r. F r rngdfgtdgdtgtdf

Identify an example of dramatic irony in your novel or short story. If your story has not presented any examples of dramatic irony, describe your own suggestion for adding dramatic irony to a scene from your novel or short story. my story is the outsiders

Answers

I think An example of dramatic irony in the outsiders is:
The audience can see that Ponyboy may have turned his back on Darry, but the moment that he did Dally quickly fills that role with the same advice. Ponyboy sort of sees the connection, but not clearly, which is why this scene is an example of dramatic irony.

Or The dramatic irony comes from the fact that while we the viewers know that his gun is unloaded, the cops have no idea, leading them to misjudge the situation. If the cops knew that his gun was unloaded, they likely would not have shot him.

Read the following passage and answer the question that follows: (1) One morning, when Gregor Samsa woke from troubled dreams, he found himself transformed in his bed into a horrible vermin. He lay on his armour-like back, and if he lifted his head a little he could see his brown belly, slightly domed and divided by arches into stiff sections. The bedding was hardly able to cover it and seemed ready to slide off any moment. His many legs, pitifully thin compared with the size of the rest of him, waved about helplessly as he looked. (2) "What's happened to me?" he thought. It wasn't a dream. His room, a proper human room although a little too small, lay peacefully between its four familiar walls. A collection of textile samples lay spread out on the table—Samsa was a travelling salesman—and above it there hung a picture that he had recently cut out of an illustrated magazine and housed in a nice, gilded frame. It showed a lady fitted out with a fur hat and fur boa who sat upright, raising a heavy fur muff that covered the whole of her lower arm towards the viewer. (3) Gregor then turned to look out the window at the dull weather. Drops of rain could be heard hitting the pane, which made him feel quite sad. "How about if I sleep a little bit longer and forget all this nonsense," he thought, but that was something he was unable to do because he was used to sleeping on his right, and in his present state couldn't get into that position. However hard he threw himself onto his right, he always rolled back to where he was. He must have tried it a hundred times, shut his eyes so that he wouldn't have to look at the floundering legs, and only stopped when he began to feel a mild, dull pain there that he had never felt before. What main conflict is revealed so far in this story? Gregor does not enjoy his job. Gregor is having disturbing dreams. Gregor has transformed into a bug. Gregor cannot sleep.

Answers

Answer:

Gregor has transformed into a bug.

Explanation:

The passage describes Gregor Samsa as a "horrible vermin", with a brown belly with many legs, which sounds like a cockroach. It is true that he tries to sleep in hopes that his transformation was simply a dream, but the thing stopping sleep from coming is that he has become a bug.

Hope this helps!

Answer: Gregor has transformed into a bug!

Explanation: Imagine a cricket, a beetle or a cockroach and see if the description fits. Gregor is no longer in human form. It will pose some problems with his relationships.

49 points...... no incomplete answers.
Any help? Need a paragraph as an answer about 7 sentences??

Answers

deleted acc sry i wish i could help

Read the examples of how someone might feel after moving to a new place. Match each example with the tile on the
right that shows the kind of challenge the speaker is facing.
Why is she calling me a bookworm?
I wonder what that means.
succeeding in school
I used to wear sandals every day, but
no one here does.
adjusting to differences in appearance
Sunday is a day for rest, not
for shopping
understanding values and beliefs
Parking meters are all over this city!
learning about government and laws
With weekly tests in my classes,
I'm always studying
overcoming language barriers

Answers

advertisement the cases of how somebody might feel after moving to a modern put. Coordinate each case with the tile on the right that appears the kind of challenge the speaker is facing. Why is she calling me a bookworm? I ponder what that means. succeeding in school I utilized to wear shoes each day, but no one here does. adjusting to contrasts in appearance Sunday could be a day for rest, not for shopping understanding values and beliefs Parking meters are all over this city! learning approximately government and laws With week after week tests in my classes, I'm continuously studying overcoming dialect obstructions

Answer:

Sunday is a day for rest, not for shopping. -Understanding values and beliefs

With weekly tests in my classes, I'm always studying - succeeding in school

Why is she calling me a bookworm? I wonder what that means. - overcoming language barriers

I used to wear sandals every day, but no one here does. - Adjusting to differences on appearance

Parking meters are all over this city! - learning about government and laws

vitamin c is obtained_____ citrus fruits
A. from
B. of
C. in
D. by​

Answers

Answer:

[tex]\boxed{\sf A. \ from}[/tex]

Explanation:

Vitamin C is obtained from citrus fruits.

“from” is used here to refer the place that something comes out of.

Answer:

from

Explanation:

"from" is used to indicate where something originates from . example : Takahashi is from Japan."Of" is used in certain expression e.g. It's nice of somebody to do something.



Answer questions 4, 6, and 8 on p. 1046 of The Language of Composition. (2nd edition: Answer questions 4, 8, and
10 on pp. 72–73.)

Answers

the answer is A bagel needed to have cream cheese

Read this text from a biographical website dedicated to "Shoeless" Joe Jackson:

There was no time for school, and Joe never learned to read or write. He probably would have spent the rest of his life working in the textile mill except for one thing—baseball.

Which paraphrase best avoids issues of plagiarism?

A. With little time for education, Joe did not learn to read and would have worked all his life in the mill without baseball.

B. Because there was no time for school, Joe never learned to read or write and probably would have spent the rest of his life working in the textile mill except for one thing—baseball.

C. He would have spent his life working in the textile mill except for baseball because there was no time for school, and Joe never learned to read or write.

D. Joe never learned to read or write since there was no time for school, and he would have worked his whole life in the textile mill without baseball.

Answers

Answer:

Because there was no time for school, Joe never learned to read or write and probably would have spent the rest of his life working in textile mill except for one thing __ baseball

Answer:

B

Explanation:

i promise u it is bc i did the test and got 100

Sáharas won huntington middle schools science fair when she was in sixth and seventh grade _____ she got second this year.
A.) In fact
B.)Similarly
C.) However
D.) Therefore

Answers

Hey There!!

The answer to this is: C.) However. The name 'Sahara' is derived from the Arabic word for "desert", ṣaḥra (صحرا /ˈsˤaħra/). The desert comprises much of North Africa, excluding the fertile region on the Mediterranean Sea coast, the Atlas Mountains of the Maghreb, and the Nile Valley in Egypt and Sudan.

Hope It Helps!~

[tex]ItsNobody[/tex]~✨

The reply to this is: often C.) Be that as it may. The title 'Sahara' is inferred from the Arabic word for "desert", ṣaḥra (صحرا /ˈsˤaħra/). The desert comprises much of North Africa, barring the ripe locale on the Mediterranean Ocean coast, the Map book Mountains of the Maghreb, and the Nile Valley in Egypt and Sudan.

What is the relationship between an idiomatic and a literal phrase? A literal phrase indirectly states the meaning of an idiomatic phrase. An idiomatic phrase restates the meaning of a literal phrase to make it easier for a reader to understand. An idiomatic phrase presents non-literal language that influences the connotation of the literal phrase. A literal phrase is the straightforward language that interprets the figurative meaning of an idiomatic phrase.

Answers

Answer:

A literal phrase is the straightforward language that interprets the figurative meaning of an idiomatic phrase.

Explanation:

The relationship between an idiomatic and a literal phrase is that a literal phrase is the straightforward language that interprets the figurative meaning of an idiomatic phrase. Therefore, Option D is correct.

What is an idiomatic phrase?

A phrase or expression is considered to be an idiom if it usually has a metaphorical, non-literal meaning connected to it. However, some phrases keep their literal meaning while developing into figurative idioms.

The metaphorical meaning of an idiom differs from the literal meaning, which is why it is labeled as formulaic language.

Idiomatic expressions are a form of colloquial speech that has a meaning distinct from the words they contain.

Therefore, The relationship between an idiomatic and a literal phrase is that a literal phrase is the straightforward language that interprets the figurative meaning of an idiomatic phrase. Option D is correct.

Learn more about  idiomatic phrase:

https://brainly.com/question/902417

#SPJ2

what strategies can you use to ensure learners are both physically and mentally active during a basketball game

Answers

Answer:

Physically:

Make sure you have plenty of fluids on hand.Rehydrate regularly.Protect yourself by becoming strong and flexible.Warm up and stretch you muscles before going to the court.

Mentally

Build endurance.Improve balance and coordinationLearners should develop self-discipline.

Physically:

1. Players should always be hydrated, but shouldn't drink too much water.

2. If players know that they are week in their knees they could wear a protective covering.

3. Players should warm up before the game, to reduce risk of injuries.

4. (This is kind og obvious) but players shouldn't play if they already have injuries, minor or not.

Mentally:

1. Before the game, players should be in a good mood, not distracted by events that happened prior to the starting of the game.

2. Players shouldn't worry about losing and focus on the game.

3. Players should be content with their teamates, that is very important.

Think about your favorite superhero. Write a four sentence paragraph about your
favorite superhero. Why do you like this superhero? Why qualities do they possess that
you wish you had as well. How does your favorite superhero inspire you?
plz help

Answers

Answer:

with the release of avengers endgame all of us know very well about iron Man. and he is my favourite superhero.this because iron Man is a superhero which has developed his super powers with his own mind like the repulsors and super flying jet boots and most amazing and iron Man armour.I like him because I think that I can match my part of life with him he is a genius person. he is a Playboy philanthropist as well as billionaire. firstly everyone thought that he always thinks of himself first and then of the other world but in avengers endgame he sacrificed his life for the whole universe which was a great stop that's why my favourite superhero iron Man.

Answer:

my favorite super hero is superman

Explanation:

it is because he have flying, cold breath and alot more super powers. i wish i had flyingand lazer powers as i could see the sky and i could defeat the robers by helping the police and helping the armers to defeat other countries. it inspires me alot that i could save the world and help alot of eople in need.

Which event marks the beginning of the "rising action" in "The Most Dangerous Game"?
Rainsford's dinner with Zaroff
Rainsford trapping Zaroff
Rainsford falling off the yacht
Rainsford being hunted

Answers

Answer:

Rainsford falling off the yacht

Explanation:

The rising action of a story begins when a conflict is introduced. A story's rising action includes the major plot points leading up to the climax. A conflict is defined as any kind of struggle between two forces. These forces can be anything from two human beings to a human being against an inhuman force. In this case, since Rainsford has fallen into the water, there is now a person versus nature conflict which starts the rising action.

Rainsford being hunted

Explanation


As soon as Rainsford discover that he is going to be hunted at night by General Zaroff and that confreontation and a battle to death is inevitable the rising actions stars.

What is the difference between reading a book for entertainment versus reading a
book as protest literature? In what way could a simple book change the world? How does it do it
exactly for you? How did Spiegelman’s book and Urrea’s book do this for you?

Answers

Answer:

Protest Literature is a text that protests society.  But, when you think about it, is literature divided into protest type literature OR is it is a way that someone artistically expressed themselves?  People put their emotion, values, and things that they are concerned about into literature every day that they want you to read.  Is it protest to portray your point of view on a given subject?  You desire change. Society needs to change.  Why not write what you believe and encourage others to see what your point of view is?

Spiegelman had a nervous breakdown.  He decided to unload on the world with his comic about his parent's Holocaust experience.  His father was a survivor of Auschwitz.  He wanted to change the comic book world.  He was a graphic novelist!

Urrea's book was non fiction too.  He wrote about the deaths of 14 Mexicans attempting to cross into the US.  

I think that if you have the opportunity to compare and contrast, I would focus on the fact that these people who suffered were all immigrants.  Both stories are about hope and death.  Both stories show that there is a need for change.  Write about Bias against these people and discuss how the bodies of each of the groups of people discussed in each story were horrendous and awful for a human to experience.

Hope this helps.

Explanation:

When I read about the Holocaust, I do not do it for pleasure.  When I read about illegal immigrants and children being stuck in pens, I do not read it for pleasure.  I read it to learn how I can be a game changer in our world.  How can I change the way the things were done this and how can we finally have peace?

When you read a book for entertainment your not learning the topic it’s like you doing it for fun when your doing it for a lecture your learning


Example:
Spiegleman’s Book and Urea’s book explained or elaborated about ____________________ and it helped or it shows __________


Or fantasy it would be
(Character name ) showed a change or did or explains I hope this help if so pls follow

My brother and sara ...... dinner with us tomorrow night.

a-are eating
b-will eat

Answers

Answer:

b-Will eat

Explanation:

Since they are eating tomorrow night it should be future tense. eating is present.

Answer:

Will Eat

Explanation:

Are eating means right now and will is future tense.



Why doesn't Adelina remember killing Dante? What have her powers done to her ?

Answers

Answer:

The power went out of control

Hey i need help please write in a long paragraph pleaseee and write descriptively

Answers

One day, a giant stone face appeared right in the middle of a highway, next to a lake! Car horns honked, tired screeched, and there was general mayhem as people strained to avoid the giant head that had just plopped right down in the middle of the road. A few minutes later, the authorities arrived. To everyone's shock, the stone face declared:

Scratch my nose, and I shall disappear as soon as my need is satisfied!

Mostly everyone just blinked in confusion, but eventually a few bright minds grappled with some ropes and started climbing to the middle of the statue's face.

And that is the story of the giant stone head!

What the person above said was good!

HELP PLEASEEEE write a paragraph pleaseeeee

Answers

Who Knows who’s Nose this is.
I would say it’s a giants nose.
The giant made the horrible mistake of looking medusa in the eyes and his form was petrified into stone, oh this story is one of old but this picture was not so long ago, see they found the stone body of this giant and these people wanted to see the world from high upon his head.

Hi! Hope this helps!

One day, a giant stone face appeared right in the middle of a highway, next to a lake! Car horns honked, tired screeched, and there was general mayhem as people strained to avoid the giant head that had just plopped right down in the middle of the road. A few minutes later, the authorities arrived. To everyone's shock, the stone face declared:

Scratch my nose, and I shall disappear as soon as my need is satisfied!

Mostly everyone just blinked in confusion, but eventually a few bright minds grappled with some ropes and started climbing to the middle of the statue's face.

After almost twenty minutes of slipping and scrabbling, the two companions finally made it to the top of the head's nose. There was a general commotion down below as people yelled and made a fuss, but the two just wanted to go home. The first climber poked the statue's nose disdainfully.

"There," he said. "Itched."

And the statue disappeared with a pop! The disgruntled men fell to the ground and shook their heads in confusion.

"What a day," The other said.

And that is the story of the giant stone head!

How do the parenthetical remarks in John Jeremiah Sullivan's article 'How
William Faulkner Tackled Race - and Freed the South From Itself" contribute
to its tone?
O A. They add a conversational tone to the article.
O B. They add an academic tone to the article.
O C. They enhance the level of discourse by providing unnecessary
information.
O D. They reflect Sullivan's disparaging tone toward Faulkner.​

Answers

Answer:

A. They add a conversational tone to the article.

Explanation:

The parenthetical remarks in John Jeremiah Sullivan's article contributes to the tone is they add a conversational tone to the article. Thus, option A is correct.

What is parenthetical?

A word or phrase enclosed in parentheses is referred to be parenthetical. A description or modifier contained in parentheses and indented within a line of speech to define how it should be played or directed onscreen.

A parenthetical comment or section is added to something written or spoken, although it is not required. Fox was making a long parenthetical statement on his travels along the country's border. I was, incidentally, attempting to stop smoking at the time.

The parenthetical observations in John Jeremiah Sullivan's piece help to the tone by giving the text a conversational tone. As a result, option A is correct.

Learn more about tone here:

https://brainly.com/question/1416982

#SPJ5

create a list of elements from
both lists you believe define a positive relationship--this will be your code of professionalism. Your code of
professionalism is how you want to represent yourself in your work experiences. Who you want to be and what
behaviors you want to value?

Answers

Love

care

punctual

Honesty

Trust

I want to see myself a successful,honest,interactive and loved in my career.

i was gonna say exactly what the other person said

“Sonnet 73:” Which of these inferences is best supported by the passage below? “In me thou seest the twilight of such day As after sunset fadeth in the west, Which by and by black night doth take away, Death’s second self, that seals up all in rest.” Question 28 options: a) The narrator feels his life is slowly draining away. b) The narrator feels he has wasted his life and has deep and terrible regrets. c) When the narrator dies he wants to be cremated. d) The narrator believes he is immortal.

Answers

The correct answer is A) The narrator feels his life is slowly draining away.

Explanation:

In this poem, the author refers to the twilight or end of daylight and compares this to the end of life and death, this is mentioned in "by black night doth take away, Death’s second self". Also, by stating "In me, thou seest the twilight " the author indirectly suggests the end of the day or the end of life is approaching. According to this, one inference or guess supported by the passage is "The narrator feels his life is slowly draining away" because the narrator directly explains death is close and this means, his life is ending.

are elephant seals in danger of becoming extinct today? Why or why not? ANSWER DETAILED

Answers

Answer:

I think yes, because people are killing them for their tusks.

Explanation:

Today, there are approximately 160,000 northern elephant seals. ... By 1988/1989, about 2,000 elephant seals came ashore at Año Nuevo, and the number of seals breeding and giving birth on the mainland is still increasing. During the 1994-95 breeding season, approximately 2,000 pups were born on the mainland. They have long since been removed from the endangered species list, though they are still protected in the U.S. by the Marine Mammal Protection Act. However, being reduced to such a minuscule breeding population a century ago caused problems for the species that persist today.

Plz help I’ll mark brainliest

Answers

you’re correct answer will be D
The answer is D hope it helps!!

What do the explicit details in this section of the poem
describe?
In the foyer up four steps a semicircular
desk presided
To the left side the card catalog
On the right newspapers draped over
what looked like a quilt rack
Magazines face out from the wall
"My First Memory (of Librarians),"
Nikki Giovanni
A. the route the speaker took to the library
B. the different people who used the library
C. how the library was arranged
D. how to look up a book in the library

Answers

The other didn’t give any explanation so in case you need that,

Look at the options and try to imagine how it could be each one. Then, once you do that, simply pick which one makes the most sense. It wouldn’t be the route the speaker took because he is already in the foyer. And it can’t be different people who used the library because he didn’t describe a single person in the whole poem. It almost looks like it could be how to look up a book because if you look at the first two lines, they could be used as landmarks to find your way to the card catalogue, but then he begins to describe other things which would make the “directions” just a bunch of gibberish about the library. Leaving only one answer left, C

Answer:

answer is c

Explanation:

(1) One morning, when Gregor Samsa woke from troubled dreams, he found himself transformed in his bed into a horrible vermin. He lay on his armour-like back, and if he lifted his head a little he could see his brown belly, slightly domed and divided by arches into stiff sections. The bedding was hardly able to cover it and seemed ready to slide off any moment. His many legs, pitifully thin compared with the size of the rest of him, waved about helplessly as he looked. (2) "What's happened to me?" he thought. It wasn't a dream. His room, a proper human room although a little too small, lay peacefully between its four familiar walls. A collection of textile samples lay spread out on the table—Samsa was a travelling salesman—and above it there hung a picture that he had recently cut out of an illustrated magazine and housed in a nice, gilded frame. It showed a lady fitted out with a fur hat and fur boa who sat upright, raising a heavy fur muff that covered the whole of her lower arm towards the viewer. (3) Gregor then turned to look out the window at the dull weather. Drops of rain could be heard hitting the pane, which made him feel quite sad. "How about if I sleep a little bit longer and forget all this nonsense," he thought, but that was something he was unable to do because he was used to sleeping on his right, and in his present state couldn't get into that position. However hard he threw himself onto his right, he always rolled back to where he was. He must have tried it a hundred times, shut his eyes so that he wouldn't have to look at the floundering legs, and only stopped when he began to feel a mild, dull pain there that he had never felt before. Whose view does the author follow throughout this selection? A.The woman in the picture's B.Gregor Samsa's C. An all-knowing narrator's D. The author's

Answers

Answer:

I thik B is correct because a person telling this story and sometime woman speaks

have good day

Explain the sentence
"There was a feverish triumph in her eyes, and she carried herself unwittingly like a
goddess of victory".

Answers

Explanation:

'There was a feverish triumph in her eyes'

Her expression displayed a frantic excitement over winning/succeeding.

'and she carried herself unwittingly, like a goddess of victory'

She unknowingly had the visage or mannerisms of someone extremely good at winning.

You can explain a sentence correctly if you understand the context of the sentence and the meaning of the words used by the author.

The sentence here shows that the victory which the girl recorded was clearly visible and she rejoiced in her victory. This can be deduced from the way she carried herself.

We can explain a sentence when we understand the meaning of the words used by the author.

The sentence above means that the girl was victorious and this was visible in her countenance.

Learn more here:

https://brainly.com/question/18116441

While you're doing this, consider: What values are most
important to you, and which are least important? How do your
values fit into your educational or future career goals? How do
your values impact your community?

Answers

Answer:

From my personal point of view, one of the most important values that a person should have is honesty and integrity, as we now live in a world in which honesty has become a rare quality that people rarely characterize, and this is what led to the decline of social, economic and even political relations among the children of the universe in general. In my opinion, the commitment of a person to adhere to these two attributes may make him loved by some people and reprehensible for another type of them. As many see in the honest person a strong personality capable of dropping their fake masks, which makes the lives of honest and honest people always in danger on this planet. The values that I do not fully possess are humility. There is an aspect within me that makes me believe that what I have presented and presented will not be done by anyone else.

harry styles because he is the best human being to ever exist on the planet

100 PTS Based on your reading of Jennifer Buchet’s "Grief Along the Reef," explain why reefs are in danger of becoming extinct. Provide evidence from the text to support your answer.

Answers

There in danger because somebody said "Grief Along the Reef" meaning they want bad things to happen to the reefs

“grief along the reef” is referring to how reefs are in danger of becoming extinct hence the “grief” part .. the loss of the reefs.

In a Notes:TM document, the details from the text appear in the right-hand column appear in the left-hand column are written in the center of the page are written in the margins of the text

Answers

Answer:

right hand column

Explanation:

In a Notes: TM document, details from the text appear in the right-hand column, while the left-hand column is for additional notes.

In a Notes:TM document, the right-hand column is reserved for capturing details directly from the text. This includes key information, quotes, or specific facts that the reader wants to highlight or remember. The left-hand column on the other hand serves as a space for additional notes, summaries or personal reflections related to the text. It allows the reader to jot down their own thoughts, ideas, connections or questions that arise while engaging with the material.

The center of the page is typically utilized for organizing main ideas or creating headings to provide structure and facilitate easy reference. The margins of the text can be used for jotting down quick annotations, underlining important passages, or marking areas that require further exploration. The layout of a Notes:TM document encourages active reading, critical thinking and personalized engagement with the text.

learn more about personalized engagement here

brainly.com/question/28236486

#SPJ2

Pls help me!!!!!!!!!!!!

Answers

Answer: Take it one step at a time. Annotations are up to you. Highlight words and phrases that you find interesting, or peculiar and , as the directions state: Label "Question" if you wonder why the author used it, or you might want to find the definition or ask others about their interpretation. Label "Track" if the phrase or sentence is like evidence for how the plot, characterization or theme is developing. Label "Response" If you have a reaction-- like "This narrator is showing signs of insanity. Eight nights sneaking in to look in on an old man sleeping. He's crazy!"

Explanation: I see the word "steadily" highlighted. You might question why the word is repeated. Is it to establish a rhythm-- like the narrator's own heartbeat?

There is no exactly right answer to this. The only mistake is not to try.

Good Luck-- and enjoy the story, IF you can imagine yourself in the scenario!

Two words Good Luck .-.
Other Questions
After getting the slide and microscope ready, Stella is eager to see the microscopic pond water specimen! She crouches around her microscope and aligns her eye with the microscopes eyepiece. But she's only able to see a bright white light.. What is the responsible estimate of 6207 divided 214 Maurer, Inc., has an odd dividend policy. The company has just paid a dividend of $2 per share and has announced that it will increase the dividend by $6 per share for each of the next five years, and then never pay another dividend. If you require a return of 12 percent on the companys stock, how much will you pay for a share today HELP ME!!!!And I mark as BRAINLIESTmake sure show proper working Anyone the answers? Please help Last Sunday, the average temperature was 8\%8%8, percent higher than the average temperature two Sundays ago. The average temperature two Sundays ago was TTT degrees Celsius. Which of the following expressions could represent the average temperature last Sunday? Find an equation of the plane through the point(1, 5,-1) and perpendicular to the vector (1, 5, 1). Do this problem in the standard way. Solve for x: 2(10-2x) = 4(3x + 1). Write your answer as a fraction. can u help me ASAP. i need to know how to do it step by step the formula s= I dont know how to type that but I really need helppppp Pasteur's experiments proved that ________. Pasteur's experiments proved that ________. spontaneous generation can only occur if nutrient broth is left open to the environment cells cannot survive in swan-necked flasks preexisting cells present in the air can grow in sterilized nutrient broth sterilizing nutrient broth prevents spontaneous generation in order to grow, cells need to be supplied with oxygen please help !!!!! please note that two images are there................ i am urgently needs this question On a plane trip, baggage over 40 pounds ischarged at the rate per pound of 1% of the one-way fare. The charge for a bag weighing 52pounds on a trip where the one-way fare is $98is:HELP PLEASEE!! QUICK!! When the hydraulic conductivity Ks = 10 mm/hr; effective matrix potential Ns = 20 mm, and rainfall intensity I = 30 mm/hr , determine the amount of runoff generated when the runoff rate reaches 15 mm/hr?( 2.7 mm or 0.21 mm or 18 mm or 0.67 mm) PLS HELP ASAP Solve the inequality and enter your solution as an inequality in the box below 8>4-x>6 difference between photosynthesis and respiration In a survey of adults in a certain country conducted during a period of economic uncertainty, % thought that wages paid to workers in industry were too low. The margin of error was percentage points with % confidence. For parts (a) through (d) below, which represent a reasonable interpretation of the survey results? For those that are not reasonable, explain the flaw. how many are 2 raised to 2 ??? Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG This rectangular patio is tiled using 50 cm by 50 cm square tiles. How many tiles are used?