An acceptable website design is one that meets
user design expectations and is also:

A.colorful
B.effective
C.template-based
D.standardized

2. Which ethic do you think is most important for a journalist to have? Why? Write the relationship between cells, tissue and organs in human body.(plzzzzz answer correctly) At an auto repair shop. 3.5 hours of labour costs $311.50. What is the labourcharge for a 5 hour job? 4. How are the main narrator and Simon Wheeler different? Give as many details aspossible. What fossil helped support Wegener's hypothesis of continental drift?A. GondwanalandB. KannemeyeridC. MesosaurusD. Glossopteris 2What does Don Pepe's lesson to Nayeli in paragraph 13 reveal about theirrelationship?A. He was protective of her and did not want to worry her about life's difficulties.B. He thought she would be able to understand complicated ideas.C. He found her annoying and wanted to limit their conversations.D. He was interested in unusual trivia and wanted to share it with her. what is the mRNA in TACCGGATGCCAGATCAAATC? Layla is going to invest $5,200 and leave it in an account for 15 years. Assuming the interest is compounded monthly, what interest rate, to the nearest tenth of a percent, would be required in order for Layla to end up with $13,800? Most Americans consume a varied diet. They eat foods that are both plant- and animal-based. Which words are clues to the meaning of the word consume? A. are both B. eat foods C. animal-based D. Most Americans why is it important to save energy in our daily lives Red and white blood cells are produced inside the __________ of bones. This is an interaction between the skeletal, circulatory, and immune systems.A. MarrowB. Spongy BoneC. Compact BoneD. Liver This Question: 1 pt20 of 20This QuthThe pH of a fruit juice is 2.9. Find the hydronium ion concentration, [H30 * ), of the juice. Use the formula pH = -log[H30*]The hydronium ion concentration [H30 + ] is approximately moles per liter.(Use scientific notation. Use the multiplication symbol in the math palette as needed. Round to the nearest tenth as needed.) A worldwide organization of academics claims that the mean IQ score of its members is 118, with a standard deviation of 17. A randomly selected group of 40 members of this organization is tested, and the results reveal that the mean IQ score in this sample is 115.8. If the organization's claim is correct, what is the probability of having a sample mean of 115.8 or less for a random sample of this size When riding your bike on a main road you should always follow the rules of the _________.roadbikers guidewalkerstown they are riding in Can someone please help me on this plz I beg u :( Writing: Critique On Nutrition And Pregnancy. Critique a current article or website on Pregnancy and compare to good nutrition practices. 1) Evaluate the recommendations. 2) Compare the recommendations. Write a 300 or more on your findings and conclusions. ( Will Mark Brainliest). Mhanifa Plz help me with this thank you! Need help on doing escape room. How to escape from Emoji Planet. What is one service the Freedmen's Bureau provided for African Americans?The agency provided funds to pay poll taxes.The agency set up courts to settle land disputes.The agency taught them how to cultivate crops.The agency found employment in Northern cities. Which of the following is a proportion?