An earthquake causes a population of 10 deer with long tails to panic and move to a
population of 90 deer with short tails. Over time, the allele frequency for long tails
increases from 10% to 30%.
Match this scenario to its mechanism of evolution.

Answers

Answer 1

Answer:gene flow

Explanation:


Related Questions

4 In your own words, describe the relationship between
the processes and forces that create the different types of rocks

Answers

Answer:The three main rock types are igneous, metamorphic and sedimentary. The three processes that change one rock to another are crystallization, metamorphism, and erosion and sedimentation.

Which is a primary way that enzymes affect these reactions? *

Answers

Answer: chemical reactions

Explanation: The function of an enzyme is to speed up chemical reactions. They do this by lowering the activation energy, which is the minimum energy that must be available for a chemical reaction to occur. If the energy required is lowered, the reaction can go faster.

Bill Nye Earth's crust

Answers

1. rock
2. on
3. mantle
4. volcanoes
5. active
6. lava
7. hot
8. coolest
9. geyser
10. resistant
11. tectonic
12. tectonic/pangea
13. caves
14. earthquake
15. crust

Answer:

1. rock

2. on

3. mantle

4. volcanoes

5. active

6. lava

7. hot

8. coolest

9. geyser

10. resistant

11. tectonic

12. tectonic/pangea

13. caves

14. earthquake

15. crust

Explanation:

Can someone tell me if it’s correct

Answers

Answer:

yes ur right

Explanation:

Thank you to anyone who answers .

Answers

Answer:

D

Explanation:

Answer:

i think its D but im so sorry if it wrong my second answer would probably be A

Explanation:

i really hope this helps sorry if it doesn't

Which of the following represents the correct order of the phases of the
Moon?

A. new moon, full moon, last quarter, first quarter, and then new moon again

B. full moon, new moon, last quarter, first quarter, and then full moon again

C. full moon, last quarter, new moon, first quarter, and then full moon again

D. last quarter, full moon, new moon, first quarter, and then last quarter again

Answers

Answer:

c

Explanation:

full and new moons aren't back to baxk

Hello! could someone please do a 4 sentence quark poem

Answers

Answer:

Quark is a character in the television series Star Trek: Deep Space Nine.

Quark developed a few strong friendships during his stay on Deep Space Nine.

The Ferengi have business deals throughout the galaxy; Quark is no different.

For vegetarians, soft cheeses like cream cheese and quark do not contain any rennet at all.

Explanation:

Explain the lifecycle of mosquito in short​

Answers

Answer:

Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)

PLSS HELP ME!! NO LINKS!!


*fill in the blanks*

______ formation is caused by
dripping water shaping upside down
cones from cave roofs. This is an example
of________
(weathering, erosion,
or deposition)


________ formation is caused by a small amount of minerals dripping in the dissolved water during stalactite formation. This is an example of______ (weathering, erosion, or deposition)

Plss help me:(( i will give you BRAINLYEST!!

Answers

Answer:

1 stalactite

2 deposition

3 stalagmite

4 deposition

Explanation:

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

How is information for a specific protein carried on the DNA molecule?
a. as a sequence of nucleotides
b. in the double helix shape of the condensed chromosome
c. in the ratio of adenines to thymines
d. as a pattern of phosphates and sugars

Answers

Answer:

b

Explanation:

Genetic information is carried in the linear sequence of nucleotides in DNA. Each molecule of DNA is a double helix formed from two complementary strands of nucleotides held together by hydrogen bonds between G-C and A-T base pairs. ... In eucaryotes, DNA is contained in the cell nucleus.

The information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Hence, option (a) is the correct answer.  

Nucleic acids are of two types. They are namely deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). DNA molecule carries the information for a specific protein. They are described as follows:

DNA is the genetic material of the cell  DNA molecules undergo a process called transcription to code for codons on mRNA strand These codons tend to pair with tRNA molecule which holds the amino acids The amino acids will then form a chain in the sequence of DNA nucleotides to result in protein formation  

Thus, we can conclude that the information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Thus, option (a) is the correct answer.  

Learn more about DNA here:

https://brainly.com/question/264225

plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.

Answers

I think is would be A i hope it helps

¿Con que otro nombre se le conoce a las placas de espuma de poliuretano altamente contaminante?

Answers

Answer:

La espluma de poliuretano (espluma PU) ye un material plásticu porosu formáu por un agregamientu de burbuyes, conocíu tamién polos nomes coloquiales de gomaespuma n'España o gomapluma en dellos países suramericanos. Contienen sustances d'escasu poder canceríxenu que si representen dalgún peligru, namái sería tres esposiciones intenses y teniendo contautu direutu.Tamién ye denomináu Poliuretano proxectáu, por cuenta de la forma na que se suel aplicar sobre superficies. Explanation:

Carbon dioxide enters a plant through pores (openings) called the
A. stomata.

B. cuticle.

C. veins.

Answers

A. stomata

I hope this helps good luck!! :)

Outline the process of the Carbon Cycle.

Answers

Answer:

Carbon Cycle Definition

Carbon cycle is the process where carbon compounds are interchanged among the biosphere, geosphere, pedosphere, hydrosphere, and atmosphere of the earth.

Carbon Cycle Steps

Following are the major steps involved in the process of the carbon cycle:

Carbon present in the atmosphere is absorbed by plants for photosynthesis.

These plants are then consumed by animals and carbon gets bioaccumulated into their bodies.

These animals and plants eventually die, and upon decomposing, carbon is released back into the atmosphere.

Some of the carbon that is not released back into the atmosphere eventually become fossil fuels.

These fossil fuels are then used for man-made activities, which pumps more carbon back into the atmosphere.

Hope it helps!!!

ASAP!!
Write any 3 ways to protect the crop from disease and insects​!!
No links!!!
No spams!!

Answers

Pull weeds around your plants as well. Insects such as aphids and
stinkbugs feed on weeds; if they surround your plants, they're likely to attack them as well.

Biological pest control approaches such as cover crops, trap crops and beetle banks.

Fertilize and water your plants regularly. Insects are less likely to infest healthy and well-nourished plants.

A student claims that the only difference between prokaryotic cells and eukaryotic cells is that
eukaryotic cells have a nucleus, but prokaryotic cells do not. What is wrong with this claim?

The description of the cell types is incorrect.

Prokaryotic cells have a nucleus, and eukaryotic cells do not.

The description of the cell types is incorrect. Both prokaryotic and eukaryotic cells have a nucleus.

There is another difference between the cell types. Eukaryotic cells have membrane-bound organelles, but
prokaryotic cells do not.

There is another difference between the cell types. Eukaryotic cells have a cell membrane, but prokaryotic
cells have a cell wall instead.

Answers

Explanation:

Eukaryotic cells:

• There is a well defined nucleus

• They are membrane bounded cell organelles like chloroplast, golgi bodies, mitochondria.

Prokaryotic cells:

• The nucleus are not well defined

• Cell organelles are not bounded by membrane

When a person loses consciousness due to a head injury from a car crash, the ______ keeps the body functioning by regulating the flow of information between the brain and the rest of the body

Answers

Answer:

Brain stem

Explanation:

I hope this helps

Plz HELP!! where does respiration, the process of releasing energy from combination of oxygen and glucose, occur? A. Cells B. Bronchi. C. Pharynx. D. Nose

Answers

Answer:

 A

Explanation:

     

what does the respritory system do?

Answers

Answer:

The respiratory system's main job is to move fresh air into your body while also removing waste gases.

Explanation:

Your lungs are part of the respiratory system, a group of organs and tissues that work together to help you breathe.

Which organelle of a cell functions similarly to the envelope of a virus and why?

Answers

Answer: linear or circular. include genes encoding viral proteins: capsid, envelope proteins, any polymerase not found in the host cell. viruses may have a lipid envelope.

This moray eel has a small fish cleaning between its teeth. The eel gets a
clean mouth while the cleaner fish gets a nice meal.
A.Mutualism
B.Commensalism
C.Parasitism

Answers

Answer:

A. Mutualism

Explanation:

The moray eel and the small fish are both getting something out of it. Meaning they both benefit from each other.

A.Mutualism. hshshshshs

As a result of the experiment scientists did with Mexican tetras, it seems likely that their first hypothesis about blindness in the tetras is right. Explain how the result of the experiment supports their first hypothesis.

The scientists' first hypothesis is that blindness gives the fish some sort of evolutionary advantage, but not directly.

The experiment was: The scientists transplanted a lens from the eye of a surface tetra embryo into the eye of a cave tetra embryo. The result was striking—the surface tetra lens into the cave tetra caused all of the surrounding tissues to develop into a healthy eye.

Answers

A result that supports the hypothesis 'blindness gives the fish some evolutionary advantage, but not directly' may be a higher fitness in close relatives of fish.

What is a hypothesis?

An scientific hypothesis is a given explanation to a scientific observation from the real world.

A hypothesis must be verifiable, which means that it can be confirmed or rejected by using the scientific method.

In conclusion, a result that supports the hypothesis 'blindness gives the fish some evolutionary advantage, but not directly' may be a higher fitness in close relatives of fish.

Learn more about hypotheses here:

https://brainly.com/question/11555274

#SPJ1

tRNA uses (anticodons/codons) to match to the mRNA.

Answers

Answer:

anticodons

Explanation:

codons are for mRNA

tRNA uses anticodons to match to the mRNA.

Which one does tRNA uses?

tRNA (transfer RNA) molecules are responsible for carrying specific amino acids to the ribosomes during protein synthesis.

They have an anticodon region that consists of three nucleotides that are complementary to the codons on the mRNA (messenger RNA). The codons on the mRNA determine the sequence of amino acids in the growing polypeptide chain.

The anticodon on the tRNA base pairs with the complementary codon on the mRNA, ensuring that the correct amino acid is incorporated into the growing protein chain. The matching between the anticodon and codon is essential for the accurate translation of genetic information into protein synthesis.

Learn more about tRNA at:

https://brainly.com/question/4089622

#SPJ6

What two types of consumers are missing from this pyramid?
Please help I need to turn it in today !!!!

Answers

Answer:

decomposers and omnivores

Explanation:

Decomposers and omnivores


Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)

Answers

The best answer to go with is b you’re welcome

Which process begins the formation of sedimentary rock?

Answers

Weathering breaks down pre-existing rock into particles, while erosion moves the particles to a site of deposition. These processes begin the formation of sedimentary rock. ... Sediment can be moved by wind, running water, ice, or waves.

using the graph, the temperature seasonal force from the other Forest biomes. choose all the apply

A) the temperature seasonal Forest averages 100 to 200 cm rainfall/year

B) the temperature seasonal Forest is cooler and wetter than the tropical rainforest

C) the temperature seasonal Forest has warmer average temperatures than the Boreal forest

D) the temperature seasonal rainforest has similar temperatures but less rain than the temperate rainfores

E) the temperature seasonal rainforest has similar rainfall to the Boreal and tropical seasonal rainforest, but is much warmer than either one​

Answers

Answer:

The correct answer is - A and C,

Explanation:

According to the graph, the following conditions are matched correctly with the temperature seasonal forest with other biomes:

The temperature seasonal forest has the precipitation range from 50 cm to 250 cm rainfall per year approximately. The average rainfall from this would be 150 cm/year or between 100 to 200 cm per year.

B. the temperature seasonal forest has a temperature between 15 degrees Celsius to 20 degrees celsius which is warmer than the boreal forest that has a temperature between 0 to 15 degrees Celsius approximately.

Answer:

A, C, D

Explanation:

If a population is evolving, the allele frequency ________

Answers

If a population is evolving, the allele frequency will change.
Answer: Change

why is it important to save energy in our daily lives

Answers

Answer:

So you can be more active and do different things that need energy

Explanation:

Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.

Other Questions
HELP ME PLEASE IM IN A TEST, I only need a base to go off of. 6q + 8 = -9 - 76 a. 12b. -12c. 84d. -84 In a communist country, why do the new communist leaders become rich? Balance the following equation: Fe2O3 + H2O --> Fe(OH)3A.3,2,1B.2,2,3C.1,3,2D.5,2,10 HELP! WILL GIVE BRANLIEST! Solve this problem for me and Ill mark you Brainliest also have a good day people !! Ryan's take-home pay is $2,500 each month. The amount for gas is $125. Calculate the percentage Ryan uses on gas from his take-home pay. please help!! O^O What is -56 = - 8z because I dont even know the answer All of the following are stages of crises that represent Erik Eriksons view of adulthood except __________.A. integrity versus despairB. generativity versus self-absorptionC. intimacy versus isolationD. identity versus confusion The part of speech helps determine ~how to use a word ~the job of the word in a sentence ~what the author meant ~the purpose of the writingPlease help help me pweaseeeeeeeeeeeeeeee!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!Part A What is a theme of the poem "The Dragonfly"? Nature provides a spectacle of wonder. Take time to enjoy the world around you. Be wary of things that can hurt you. Don't waste time on things that don't matter. Question 2 Part B How does Louise Bogan develop the theme identified in Part A? She uses imagery to describe in detail how dragonflies look and act. She suggests spending summer days looking for dragonflies. She describes how dragonflies prefer to be in motion instead of stopping. She explains how dragonflies escape their predators. The higher prices charged by monopolists: Group of answer choices are like a private tax that redistributes income from consumers to monopoly sellers. are socially optimal because they better reflect how much society values the good relative to the resources used to produce it. have no effect on the distribution of income. return to consumers through the public goods provided by monopolies. Apply the distributive property to create an equivalent expression. 6 ( a + 2 b + 3 c ) = Plz help me solve and show your work. what does swagger mean Ill mark brainliest! Please help!!Rectangle ABCD has coordinates A(-10,5) B(10,5) C(10,0) and D(-10,0). Rectangle ABCD has coordinates A(-10,-5) B(10,-5) C(10,0) and D(-10,0). Rectangle ABCD has coordinates A(-2,-1) B(2,-1) C(2,0) and D(-2,0), which transformations describe why rectangles ABCD and ABCD are similar?A)) rectangle ABCD was reflected across the X axis and then dilated by a scale factor of 1/5 to form rectangle ABCD B)) rectangle ABCD was dilated by a scale factor of 5 and then rotated 90 degrees counterclockwise to form rectangle ABCDC)) rectangle ABCD was dilated by a scale factor of 1/5 then rotated 90 degrees counterclockwise to form rectangle ABCD D)) rectangle ABCD was reflected across the Y-axis and then dilated by a scale factor of 5 to form rectangle ABCD Please answer quickly!! There may be be more than one answer!! A rectangular prism has a length of 9 in., a width of 4 in., and a height of 112 in.The prism is filled with cubes that have edge lengths of 12 in.How many cubes are needed to fill the rectangular prism? A developer wants to divide an 84 acre parcel of land into lots in the ratio 6:2:4. How many acres are each land division. WILL AWARD BRAINLIEST.