Option D is correct, A thread-like growth called hair can be observed in the dermis. Keratin, a protein, is the main component. It develops more like an anchor from the follicles that carry hair into the skin.
The only animals that have hairs are mammals. Humans and certain other creatures are classified as mammals. Although there are certain distinctions between human and animal hair, there are some commonalities. The purpose of this article is to inform you about the peculiar differences and parallels between human and animal hair.
Except for flat areas like the palms of the hands, the soles of the feet, the lips, and the genitalia, every part of the human body and some animal bodies have hair growing on it. Compared to humans, animals seem to have more hair on their bodies. The fur is made up of the many hairs that cover their bodies.
Animal hair and human hair have several differences including:
A. the pattern of pigmentation
B. the medullary index
C. the cuticle type
D. all of these choices.
To learn more about hair please click on below link
https://brainly.com/question/29610683
#SPJ4
if you are considered prehypertensive, what are some steps you can take to lower your blood pressure?
Answer:
67%
Explanation:
I need help please
Which organs work together in the respiratory system of a hamster to help it breathe? OA. Spinal cord and nerves B. Lungs and windpipe C. Gills and gill filaments OD. Lymph nodes and lymph
Answer:
B. Lungs and windpipe
Hope helps:")
A hydrophilic peptide hormone is produced in the anterior pituitary gland located at the base of the brain. The hormone targets specific cells in many parts of the body. Which of the following best explains a possible mechanism that would enable the hormone to efficiently reach all of the target cells in the body? * (1 Point) The hormone moves through cytoplasmic connections between cells until it has reached all cells with the correct intracellular binding sites. The hormone interacts with the nerves at the base of the brain and directs signals to the target cells through the nervous system. The hormone is released into the bloodstream where it can be transported to all cells with the correct receptors. The hormone diffuses into target cells adjacent to the anterior pituitary gland where the hormone is degraded. Describe 1 method/way in which you can make a fruit ripen quicker (think of the video on ripening experiment) * (2 points) Enter your answer
The possible mechanism that would enable the hormone to efficiently reach all of the target cells in the body will be: The hormone is released into the bloodstream where it can be transported to all cells with the correct receptors.
Hormones are called as the chemical messengers. They are termed messengers because they travel to their site of action and initiate the function they are responsible for. Hormones regulate various functions of the body.
Receptors are the protein compounds that function to accept a molecule called ligand (specific to them) and begin the process of signaling in order to accomplish the function they are supposed to perform.
To know more about receptors, here
brainly.com/question/29343237
#SPJ4
many cancer cells shut down expression of the bax or bak gene. how will the cancer cell benefit from this cellular change?
The cancer cell will profit from this biological alteration since the mitochondria will be less likely to produce cytochrome C, preventing apoptosis.
Contrary to popular belief, healthy mitochondria are necessary for the growth of cancer cells. Cancer cells frequently harbor mutations in the mitochondrial genes, but these abnormalities do not deactivate the mitochondrial energy metabolism; rather, they change the cytochrome C condition of the mitochondria's bioenergetic and biosynthetic processes. In mammalian cells, mitochondria are essential for initiating apoptosis. Members of the cytochrome C control how proteins are released from the area between the inner and outer membranes of the mitochondria.
learn more about cancer cell here:
https://brainly.com/question/373177
#SPJ4
a scientist discovers a new species of fossil tetrapod. the fossil consists only of a few scattered hard parts. which trait would be most likely to allow the scientist to identify the unknown as a mammal?
The trait which most likely allow the scientist to identify the unknown as a mammal would be differentiated teeth.
Fossil, remnant, impression, or hint of an animal or plant of a beyond geologic age that has been preserved in Earth’s crust. The complex of facts recorded in fossils globally known as the fossil file—is the primary source of information about the history of the existence of the world.
Only a small fraction of historic organisms are preserved as fossils, and generally, best organisms that have a stable and resistant skeleton are conveniently preserved. most major businesses of invertebrate animals have a calcareous skeleton or shell (e.g., corals, mollusks, brachiopods, bryozoans). other kinds have shells of calcium phosphate (which additionally takes place in the bones of vertebrates), or silicon dioxide. A shell or bone that is buried fast after deposition may additionally preserve these natural tissues, though they become petrified (transformed to a stony substance) over the years.
Learn more about fossils here:- https://brainly.com/question/20158226
#SPJ4
Polymers are made of small units called
the answer is monomers
Answer: Monomers
Explanation: Can I have brainliest?
Organic compounds ____. A. Cannot be made in the laboratory c. All contain hydrogen b. Occur in living organisms d. All contain amino acids.
B. occur in living organisms. The first organic substance to be synthesized in a lab was urea, which was created accidentally.
What components make up the four organic compounds?Carbohydrates, lipids, proteins, and nucleotides are organic molecules are necessary for human body function. Because they have both carbon and hydrogen, these substances are referred to as organic.
Can hydrogen not be present in organic compounds?This indicates that the presence of carbon and hydrogen atoms is a property shared by all organic molecules. organic molecules may also contain other elements such as oxygen, nitrogen, and phosphorus.
Learn more about proteins here:
https://brainly.com/question/29776206
#SPJ1
the process green plants use to turn water and carbon dioxide into food using energy from sunlight.
Answer: photosynthesis
The Energy Pyramid is used to illustrate how energy gets transferred from one organism to another. Explain what organisms types are involved and how some energy gets lost.
Answer:
The Energy Pyramid is a visual representation of how energy is transferred from one organism to another in an ecosystem. The pyramid shows the relationship between different levels of the food chain, with the primary producers at the bottom, followed by the primary consumers, the secondary consumers, and so on.
At the base of the pyramid are the primary producers, which are typically plants or algae that convert sunlight into energy through photosynthesis. These primary producers are then eaten by primary consumers, which are herbivores that feed on the plants. In turn, the primary consumers are eaten by secondary consumers, which are carnivores that feed on the primary consumers. This process continues up the pyramid, with each level representing a trophic level.
As energy is transferred from one organism to another, some of the energy is lost through processes such as respiration, excretion, and the production of waste. This is why the pyramid narrows at each higher level, as there is less energy available to support the organisms at that level. The loss of energy at each level means that there are fewer organisms at higher levels of the pyramid.
The type of escherichia coli that produces a verotoxin similar to the one produced by shigella dysenteriae is ________ e. coli.
notch is a receptor protein displayed on the surface of certain cells in developing fruit fly embryos. notch’s ligand is a membrane-bound protein called delta that is displayed on the surface of adjacent cells. when notch is activated by its ligand, the intracellular tail of the notch protein becomes separated from the rest of the protein. this allows the intracellular tail to move to the cell’s nucleus and alter the expression of specific genes.
Delta's role in regulating cell communication through the Notch signaling pathway is that Delta restricts cell communication to short distances within a developing embryo.
What is cell communication?Chemical signals are typically used by cells to communicate. These chemical signals, which are proteins or other molecules made by the sending cell and released into the extracellular space, are frequently secreted by the cell. They can then travel to nearby cells by floating there, much like messages in a bottle.
During the development of fruit fly embryos, the receptor protein notch is visible on the surface of some cells. The protein delta, which is membrane-bound and expressed on the surface of neighboring cells, is the ligand for the notch. The intracellular tail of the notch protein separates from the rest of the protein when notch is activated by its ligand. Consequently, the intracellular tail can move to the cell's nucleus and change the way some genes are expressed.
Learn more about cell on:
https://brainly.com/question/13123319
#SPJ1
at the end of which week of the ovarian cycle should implantation occur (assuming there is an embryo)?
Answer:
first week
Explanation:
it takes 2 to 3 days tk get embryo
Drag the terms to the correct boxes to complete this infographic on the general parts of the eukaryotic cell. Cell Wall External Chromosomes Internal Mitochondria Cytoskeleton Glycocalyx Cilia Ribosomes Boundary EUKARYOTIC CELL Cytoplo membrane Append Nu Homebound Olle Endoplasmi reculum Coleratu Flagella Nuclear envelope Muide Mikrotubules Intermediate laments Actin laments chlo
A nucleus and other membrane-bound organelles are found in the cells of eukaryotes, which are creatures.
What are eukaryotic cells?A nucleus and other membrane-bound organelles are found in the cells of eukaryotes, which are creatures. All mammals, plants, fungi, protists, and the majority of algae are eukaryotic creatures, as are many other types of life. Single cells or many cells can make up eukaryotes.
Eukaryotic cells are comprised of 3 major compartments. There are two different kinds of glycocalyx and appendages in the exterior compartment.The boundary can consist of a cell membrane and possibly a cell wall as well. The internal compartment is comprised of the cytoplasm, the nucleus, cytoskeletal components, and other organelles, such as mitochondria and ribosomes.To learn more about Eukaryotic cells refer to:
https://brainly.com/question/495097
#SPJ4
modern humans have: a. large browridges, large nasal sinuses, and a large masticatory complex. b. a high vertical forehead, a round and tall skull, and small browridges. c. a small face, small teeth, and a projecting chin. d. both b. and c.
Modern humans have traits a high vertical forehead, a round and tall skull, and small browridges
The lighter skeletons of modern humans can be used to identify them anatomically from ancient humans. Modern humans have extraordinarily large brains, which vary in size from population to population and between males and females. The average size of these brains is approximately 1300 cubic centimetres.
Many of the physical and behavioural traits that modern humans have evolved share some similarities with other early human species, though not to the same extent. Modern humans were able to connect with their environment and one another in novel and unusual ways thanks to their complex minds. Our predecessors were better able to survive as the environment got more unpredictable thanks to larger brains.
To learn more about modern humans refer here:
https://brainly.com/question/28039960
#SPJ4
Select the correct answer from each drop down menu.
Specialized cells such as white blood cells interact with foreign particles in the body. A particular cell belonging to the category recognizes bacteria and forms a covering around it, pinching off the vacuole. The cell then performs 1.______ . The foreign particles recognized by the particular type of cells differ from one’s recognized by another type of white blood cell. The situation indicates that the receptors are 2._______.
Options 1. Endocytosis
Exocytosis
Diffusion
Option 2. The same for all the cells, specific for the cells, never present on cells
Endocytosis and Receptors are particular to the cells are the right selections .The immune system's white blood cells have specific functions.
Why do white blood cells in the immune system have certain roles to play?The immune system's white blood cells have specific functions. They are essential in keeping the body safe from outside threats like bacteria. This is accomplished by them recognizing the bacteria and forming a coating around it that pinches off the vacuole. This results in a process known as endocytosis being carried out by the cell ( specifically phogocytosis).White blood cells have very unique receptors that they can bind to. As a result, they can distinguish between different foreign substances. For instance, B-cells create antibodies that attach to particular antigens (foreign proteins) and so trigger a particular immune response. To put it another way, a certain type of white blood cell may distinguish a certain foreign substance. This shows that these cells have specialized receptors.To learn more about White blood cells refer to:
https://brainly.com/question/13051716
#SPJ1
suppose a mutation happened within an intron of a gene. could this affect the gene's expression? why or why not?
An intron mutation would have no impact on a protein's amino acid sequence unless it happened inside the 5′, 3′, or branch point splices, which are eliminated before translation.
Would the expression of a gene be impacted by an intron mutation?A point mutation or even a sizable deletion in the intron would probably not appreciably lower the expression of the gene unless splicing was affected since the intron regions that affect mRNA accumulation are redundant and scattered.
What takes place if an intron is altered?a genetic change in the DNA sequence that takes place at the exon-intron boundary (splice site).
Learn more about DNA here:
https://brainly.com/question/2905713
#SPJ4
When there is no pattern to a
population's growth, it is known as
A. cyclical
C. irruptive
B. declining
D. irregular
When there is no pattern to a population's growth, it is known as irregular and is therefore denoted as option D.
What is Population?This is referred to as the total number of organisms in an area over a given period of time and population growth could either be increasing, decreasing or being stable.
There are four types of population growth and they include the following below:
StableIrruptiveCyclicIrregular.A stable population growth occurs when there is a constant age-specific fertility and mortality rates over a long period of time. On the other hand, an irregular population growth is the one in which there is no pattern and it results in a chaotic behavior in population size which is therefore the reason why option D was chosen as the correct choice.
Read more about Population growth here https://brainly.com/question/1437549
#SPJ1
a community isgroup of answer choicespopulations of organisms and the abiotic factors in their environmentpetition for food between individuals in a population.multiple organisms of the same species living in a specific area.all the biotic and abiotic factors in an environment.populations of multiple species interacting with one another in a specific area.
Populations of organisms and the abiotic factors in their environment.
An ecosystem consists of all biotic and abiotic factors that affect its community. Ecosystem ecologists often focus on energy flow and nutrient recycling. An ecological community is a group of actually or potentially interacting species living in the same place.
Communities are linked by networks of shared environments and the influence of each species on others. An ecosystem is a geographical area where plants animals other living things weather and landscape work together to form a bubble of life. An ecosystem contains living or living parts and abiotic factors or non-living parts.
Learn more about The abiotic factors here:- https://brainly.com/question/12689972
#SPJ4
you are trying to identify an organism. this organism contains no muscle tissue. it is not diploblastic. it must be a
You are trying to identify an organism. It is an animal, but it does not have nerve or muscle tissue. It is neither diploblastic nor triploblastic. It is probably a sponge.
Ectoderm and endoderm are the two principal germ layers in a blastula that has diploblasty. Cnidaria and ctenophora are examples of diploblastic species, which arise from such blastulae and were once included in the phylum Coelenterata but were later split off due to greater understanding of their differences.
They can grow genuine tissue because of the endoderm. The gut tissue and related glands are included in this. On the other hand, the ectoderm develops into the epidermis, the nervous system, and, if any nephridia are present.
To learn more about diploblastic refer here:
https://brainly.com/question/29382364
#SPJ4
original DNA: TACTTTAATCCCAAATTTACT
DNA: TACTTTAATCCCAAGTTTACT
mRNA: ?
amino acid: ?
what type of mutation is this: ?
Answer:
substitution mutation
Explanation:
The original DNA sequence is: TACTTTAATCCCAAATTTACT
The mutated DNA sequence is: TACTTTAATCCCAAGTTTACT
The mRNA transcribed from the mutated DNA sequence is: AUGAAAUUAGGGUUAAUUAGA
The amino acid sequence encoded by the mRNA is: Met-Lys-Ser-Trp-Lys-Lys-Ser
This is an example of a substitution mutation, in which a single nucleotide in the DNA sequence is changed. In this case, the original DNA sequence contains the nucleotide A at position 13, while the mutated sequence contains the nucleotide G at the same position. This change causes a different mRNA sequence to be transcribed and a different amino acid to be encoded. Substitution mutations can have a variety of effects on gene function, depending on the location and nature of the mutation. Some substitution mutations may have no effect, while others may cause the protein encoded by the gene to function improperly or not at all.
A single point mutation in the gene encoding ras protein allows this protein to stay in an active form for longer periods, even in the absence of signal. therefore, this gene is ______________.
If a single point mutation in the gene encoding ras protein allows this protein to stay in an active form for longer periods, even in the absence of a signal, then this gene is an oncogene.
What is an oncogene?An oncogene can be defined as a gene that is able to activate cancer pathways when suffering mutation and or expressed in different cells that it is usually not expressed, which may be due to diverse types of genetic alterations such as in this case a point mutation.
Conversely, a tumor suppressor gene is a gene expressed to suppress cancer pathways by inhibiting cell division during the cell cycle.
Therefore, with this data, we can see that an oncogene is a gene capable of leading to cancer when it is expressed in a defective way such as occurring in presence of a mutation that activates it.
Learn more about oncogenes here:
https://brainly.com/question/3844552
#SPJ1
if you eat a candy bar, sugar enters your digestive system. some of that sugar eventually leaves the body through the urinary system. where is the body's last chance to take the sugar and recirculate it into the bloodstream for use by cells before it is excreted as urine?
Swallowing sugar, food passes through your oesophagus and into your stomach, where it is diluted by digestive juices in preparation for later passage through the rest of your digestive tract.
Sugar and carbohydrate sugars move quickly through your stomach and start to break down in your small intestine. With the aid of digestive enzymes found in the lining of your small intestine, all types of sugar are converted into the tiniest sugar molecules. Once sugar has broken down into a monosaccharide, or single molecule, it is absorbed via the intestine and turned into glucose in your blood. In order to remove blood glucose from your body and distribute it to various cells throughout your body for use as fuel, your pancreas secretes the hormone insulin.To know more about blood check the below link:
https://brainly.com/question/26214762
#SPJ4
the members of a population survive and successfully reproduce due to the specific phenotypes they posses. this is an example of
Natural selection is the variation in individual survival and procreation brought on by phenotypic variances. The development of a population's heritable features across generations is a fundamental process of evolution.
Natural selection can boost the frequency of the beneficial alleles from one generation to the next, or create microevolution, when a phenotype generated by certain alleles helps organisms survive and reproduce better than their contemporaries. Natural selection affects the entire organism; the individual is the unit of selection. NS is unable to affect specific alleles (genes). The phenotype, not the genotype, is the unit of natural selection. However, it has the potential to alter genotype. Because an organism's phenotype is what interacts with its environment, natural selection focuses on it. The physical characteristics and observable attributes that enable an organism to survive in its environment make up the phenotype. By expressing the proteins that result in the visible features, the genotype regulates the phenotype.
To learn more about phenotypic click the link below:
brainly.com/question/20730322
#SPJ4
explain the difference between arguing that humans (or other species) are fitness maximizers vs. adaptation executers.
Specifically, sociobiologists believe that the main goal of humans is to increase reproductive success, to be "fitness maximizers."
However, evolutionary psychologists believe humans to be "adaptation executors" or "mechanism activators." They believe the main goal of human beings is to solve the problems of survival ...
Persons would pay to donate to sperm banks, which is FALSE since sperm banks do not reflect ancestral conditions. Fitness maximizers are people who intentionally aim to maximize fitness.
Executors of adaptations: once we comprehend adaptations, we can explain bxr
Evolved adaptations are preferred by evolutionary psychologists.
"Individual creatures should be viewed more as adaption executors than as fitness maximizers, according to this statement."
Learn more about " fitness maximizers vs. adaptation executers" to visit here;
https://brainly.com/question/1831916
#SPJ4
Complete Question :-
Explain the difference between arguing that humans (or other species) are fitness maximizers vs. adaptation executers. Which argument is favored by evolutionary psychologists, in contrast to sociobiologists?
Why do so many eukaryotic pathogens cause highly refractory and long-term chronic infections that are difficult to treat in contrast with prokaryotic pathogens?
Globally, eukaryotic microbial pathogens play a significant role in disease and mortality.
Pharmacological resistance has challenged these therapeutic efforts, despite the fact that a large portion of their impact can be reduced by drug therapy, similar to how it is done with prokaryotic germs. Here, we talk about the difficulties brought on by eukaryotic microbial pathogens and how they compare to or diverge from the difficulties brought on by prokaryotic antibiotic resistance.
The treatments employed for a number of significant eukaryotic bacteria are then outlined in detail, along with the mechanisms that have developed to counteract these treatments.
There are significant hazards to global health, which are especially apparent in developing countries, due to the rapid emergence of resistance and the constrained pipeline of new medication therapies.
However, we go into detail on how combining modern technology with biological knowledge, epidemiology, and evolutionary research might help maintain current treatments, foresee the establishment of resistance, or enhance the application of new treatments.
Learn more about " eukaryotic pathogens " to visit here;
https://brainly.com/question/17016540
#SPJ4
match each term to its defention
Answer: Can you add the image?
Explanation: There is nothing here.
homo habilis displays a great deal of variability some scientists think that larger homo habilis fossils with wider faces and bigger teeth should be classified in their own species called
This cranium has a wider, flatter face, a larger brain, and larger teeth than other Homo habilis fossils, prompting some scientists to name it Homo rudolfensis.
The word habilis is based on a Latin word meaning 'handy' or 'skilful'. This species is known as "handy man" because stone tools were discovered near its fossil remains, and it is assumed that this species developed the ability to shape stone into tools. The following year, parts of a boy's skeleton were discovered at the site, and additional fossils from other people were discovered. Their brain size, hand and foot features, and evidence that they may have used stone tools all suggested that a new type of human ancestor had been discovered.
Their brain size, hand and foot features, and evidence that they may have utilised stone tools all suggested that a new type of human ancestor had been discovered. They were officially recognised as new species in 1964, but their inclusion in the human genus Homo was contentious. Additional fossils, including the 1986 discovery of a partial skeleton, revealed that this species was more ape-like than previously thought.
To know more about the Homo habilis, here
https://brainly.com/question/14855020
#SPJ4
Explain the theory of plate tectonics and how they have changed Earth’s surface over time. Include the role of plate tectonics in the creation of landforms.
-Please include in your response:
- Identify the evidence for plate movement.
- Explain the different types of plate boundaries and what happens at each plate boundary in the creation of landforms over time.
Answer:
Plate tectonics is the theory that Earth's outer layer is composed of a number of large, rigid plates that move relative to one another. The movement of these plates is responsible for the creation of landforms and the shaping of Earth's surface over time.
There is a lot of evidence for the movement of these plates. For example, the distribution of earthquakes and volcanoes around the world is consistent with the movement of plates. In addition, the way that the rocks on the Earth's surface are arranged and the way that they have been deformed over time also provide evidence for the movement of plates.
There are three main types of plate boundaries: convergent boundaries, where two plates are moving toward each other; divergent boundaries, where two plates are moving away from each other; and transform boundaries, where two plates are sliding past each other.
At a convergent boundary, one plate will usually be pushed beneath the other, a process known as subduction. This can lead to the creation of mountain ranges, as well as the formation of volcanoes.
At a divergent boundary, the plates are moving away from each other, which can create gaps in the Earth's crust. This can result in the formation of new crust, as well as the creation of features such as rift valleys and mid-ocean ridges.
At a transform boundary, the plates are moving past each other, which can cause earthquakes and the formation of faults. This type of boundary is often associated with the creation of strike-slip faults, where the ground on either side of the fault is moving in opposite directions.
Overall, the theory of plate tectonics helps us to understand how the Earth's surface has changed over time and how landforms are created. The movement of the plates is a slow process, but it is ultimately responsible for the shaping of Earth's surface and the creation of the landforms that we see today.
Explanation:
s this a valid statement? if flipper is a dolphin, then flipper is a mammal. flipper is a dolphin. so flipper is a mammal.
the type of disease cycle in which a pathogen is able to repeatedly spread from plant to plant during the season through the production of secondary inoculum is called
The type of disease cycle in which a pathogen is able to repeatedly spread from plant to plant during the season through the production of secondary inoculum is called Polycyclic.
"Anything that inhibits a plant from performing to its maximum potential" is the definition of a plant disease. The scope of this term covers both biotic and abiotic plant diseases. Abiotic diseases, often known as non-infectious diseases, are brought on by environmental factors rather than biological organisms. Although they cannot transfer from one plant to another, they are quite prevalent and need to be taken into account when determining the health of any plant. Nutritional inadequacies, soil compaction, salt damage, ice, and sunburn are a few examples of abiotic disorders.
Infectious or biotic diseases: These conditions are brought on by living things. When they infect plants, they are referred to as plant pathogens. We will solely talk about plant disease pathogens when addressing plant pathology. Pathogens can infect and spread from plant to plant.
To know more about Pathogen visit:
https://brainly.com/question/28148146
#SPJ4
