Annabelle works in a department store selling clothing. She makes a guaranteed
salary of $500 per week, but is paid a commision on top of her base salary equal to
30% of her total sales for the week. How much would Annabelle make in a week in
which she made $2400 in sales? How much would Annabelle make in a week if she
made x dollars in sales?
Earnings when selling $2400:
Earnings when selling $x:

Answers

Answer 1

Answer:

No 1 would be 500 + 2400*30/100 = 500 + 720 = 1220

No 2 would be 500 + x*30/100

Step-by-step explanation:

Answer 2

Answer:

$1200 and 500+ .3x

Step-by-step explanation:

Use this equation: 500+ .3x and insert in 1200.

Made equation by taking garented amount, $500, and have that be added.  Sense you get 30 percent of of x (the amount of sales), have x be multiplied by .3 to get 30 percent.


Related Questions

PLEASE HELP WILL MARK BRAINLY

Answers

Answer:

460256

Step-by-step explanation:

35900 books equal to 7.8% of all copies sold

Total number of books:

7.8% = 35900100% = ?35900*100/7.8 ≈ 460256

Answer is 460256 in whole numbers

The answer of this is 460256

How many envelopes does Jane address in a
day?
Jane addresses twice as many envelopes
as Louis in the same amount of time.
Together, they address 450 envelopes
each day.

Answers

Answer:

2x+X=450

3x=450

X=450/3

X=150

so

2x=2*150=300

X=150

so, Jane addressed 300 envelopes while Louis addressed only 150

Answer:

Jane addressed 300 envelopes while Louis addressed 150

Step-by-step explanation: Let x represent Louis's amount and 2x is Jane's amount

x+2x= 450 combine 3x =450

Divide both sides by 3.

x/3 = 450/3 x= 150. 2x = 300

Pls help me!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!please I’m begging u

Answers

Answer:

7. 36     8. 1     9. 21

Step-by-step explanation:

You plug in the variables in the equation.

7.[tex]5^{2} +-4^{2} = 41[/tex]

8. [tex](5-4)^{2} = 81[/tex]

9. [tex]5+4^{2} =21[/tex]

Answer:

See explanation

Step-by-step explanation:

1. 8^5 = 32768

2. a^6

3. 5^5*9^3 = 2278125

5. (-3)^5 = -243

6. (3/4)³ = 27/64

7. a² + b² = 5² + (-4)² = 25 + 16 = 41

8. (a + b)² = (5 + 4)² = 9² = 81

9. a + b² = 5 + 4² = 5 + 16 = 21

Consider the function represented by the graph. What is the domain of this function?

Answers

Answer:

domain={8,7,6,5,4,3,2,1,0}

Answer:

[tex]\boxed{0 \leq x \leq R}[/tex]

Step-by-step explanation:

Well domain is the amount of x values on a graph,

so looking at the given graph we can tell the x values start at 0 and since it is a solid dot the x is greater than or equal to 0 then you can tell by the arrow that the line goes on forever.

0 ≤ x ≤ R

The R stands for all real numbers.

Hope this helps :)


Ben deposited $2,700 in an account that pays 3.25% simple interest. He created a graph of his
account balance equation (A = Prt+P) with a slope of 8,775.

Answers

Step-by-step explanation:

His profit is 40%.

hope this helps

pls mark me brainliest

Answer:

40 percent i think

Step-by-step explanation:

hope its right

please put me brainlieeeeeeest

thxxx

Determine the graph transformation....

Answers

Answer:

I think its b

Step-by-step explanation:

PLease answer !!! Find constants $A$ and $B$ such that \[\frac{x + 7}{x^2 - x - 2} = \frac{A}{x - 2} + \frac{B}{x + 1}\] for all $x$ such that $x\neq -1$ and $x\neq 2$. Give your answer as the ordered pair $(A,B)$. and Find all values of $t$ such that $\lfloor t\rfloor = 2t + 3$. If you find more than one value, then list the values you find in increasing order, separated by commas.

Answers

Answer:

1. [tex](A,B) = (3,-2)[/tex]

2. The values of t are: -3, -1

Step-by-step explanation:

Given

[tex]\frac{x + 7}{x^2 - x - 2} = \frac{A}{x - 2} + \frac{B}{x + 1}[/tex]

[tex]|t| = 2t + 3[/tex]

Required

Solve for the unknown

Solving [tex]\frac{x + 7}{x^2 - x - 2} = \frac{A}{x - 2} + \frac{B}{x + 1}[/tex]

Take LCM

[tex]\frac{x + 7}{x^2 - x - 2} = \frac{A(x+1) + B(x-2)}{(x - 2)(x-1)}[/tex]

Expand the denominator

[tex]\frac{x + 7}{x^2 - x - 2} = \frac{A(x+1) + B(x-2)}{x^2 - 2x + x -2}[/tex]

[tex]\frac{x + 7}{x^2 - x - 2} = \frac{A(x+1) + B(x-2)}{x^2 - x -2}[/tex]

Both denominators are equal; So, they can cancel out

[tex]x + 7 = A(x+1) + B(x-2)[/tex]

Expand the expression on the right hand side

[tex]x + 7 = Ax + A + Bx - 2B[/tex]

Collect and Group Like Terms

[tex]x + 7 = (Ax + Bx) + (A - 2B)[/tex]

[tex]x + 7 = (A + B)x + (A - 2B)[/tex]

By Direct comparison of the left hand side with the right hand side

[tex](A + B)x = x[/tex]

[tex]A - 2B = 7[/tex]

Divide both sides by x in [tex](A + B)x = x[/tex]

[tex]A + B = 1[/tex]

Make A the subject of formula

[tex]A = 1 - B[/tex]

Substitute 1 - B for A in [tex]A - 2B = 7[/tex]

[tex]1 - B - 2B = 7[/tex]

[tex]1 - 3B = 7[/tex]

Subtract 1 from both sides

[tex]1 - 1 - 3B = 7 - 1[/tex]

[tex]-3B = 6[/tex]

Divide both sides by -3

[tex]B = -2[/tex]

Substitute -2 for B in [tex]A = 1 - B[/tex]

[tex]A = 1 - (-2)[/tex]

[tex]A = 1 + 2[/tex]

[tex]A = 3[/tex]

Hence;

[tex](A,B) = (3,-2)[/tex]

Solving [tex]|t| = 2t + 3[/tex]

Because we're dealing with an absolute function; the possible expressions that can be derived from the above expression are;

[tex]t = 2t + 3[/tex]    and   [tex]-t = 2t + 3[/tex]

Solving [tex]t = 2t + 3[/tex]

Make t the subject of formula

[tex]t - 2t = 3[/tex]

[tex]-t = 3[/tex]

Multiply both sides by -1

[tex]t = -3[/tex]

Solving [tex]-t = 2t + 3[/tex]

Make t the subject of formula

[tex]-t - 2t = 3[/tex]

[tex]-3t = 3[/tex]

Divide both sides by -3

[tex]t = -1[/tex]

Hence, the values of t are: -3, -1

MIKE WAHOUSEKEYYYYYYYY

Lara is x years old and her two best friends are (x-2) and (x+2). Write an expression for the square of Lara’s age and the product of ages of Lara’s best friends.

Please help with a detailed step by step thanks

Answers

Answer: x^2 + (x+2)(x-2)

Step-by-step explanation:

The caret ^ before the 2 indicates that the 2 is an exponent. It means "x squared"

If the keyboard doesn't allow exponents the caret is the thing to use.

The expression for the square of Lara’s age and the product of ages of Lara’s best friends is x² + (x-2)(x+2)

The first thing to do is to calculate the square of Lara's age and this will be:

= x × x = x²

The product of the ages of Lara’s best friends will be (x-2)(x+2).

Therefore, the expression that can be used to calculate the square of Lara’s age and the product of ages of Lara’s best friends is x² + (x-2)(x+2)

Read related link on:

https://brainly.com/question/16592251

Directions: Calculate the percent increase or decrease between the starting and ending
quantities below. Round your answer to one decimal place.
1. Start: 3
End: 10

Answers

Answer:233.333%

Step-by-step explanation:

1. 10-3=7 subtract end by start

2.7/3=2.333 divide difference by absolute value of start

32.333x100=233.333% multiply by 100 if negative its decreasing if positive it increasing

hoped this helped

233.333%. Njjjsjsksjsjsjsjsjsis

If f(x)=(2x^2)-1, find:
-f(3x-1)+2

Answers

Answer:

-f(3x - 1) + 2 = -18x² + 12x + 1

Step-by-step explanation:

Step 1: Find f(3x - 1)

f(3x - 1) = 2(3x - 1)² - 1

f(3x - 1) = 2(9x² - 6x + 1) - 1

f(3x - 1) = 18x² - 12x + 2 - 1

f(3x - 1) = 18x² - 12x + 1

Step 2: Plug in f(3x - 1)

-(18x² - 12x + 1) + 2

Step 3: Evaluate

-18x² + 12x - 1 + 2

-f(3x - 1) + 2 = -18x² + 12x + 1

-f(3x-1) + 2 = -18x2 + 12x+1


Select the equation of the line that passes through the point (5.7) and is perpendicular to the line x = 4.

Answers

The answer is y=7 because it makes more sense
The answer is y=7 because that’s the line that the point (5,7) is perpendicular to

solve the following problem (1+5^2)-16(1/2​)^3

Answers

Answer:

24

Step-by-step explanation:

Using PEMDAS, we know to solve exponents before everything else.

So:

[tex](1+5^2)-16(\frac{1}{2})^3 = (1+25) - 16(\frac{1}{8} )\\\\26 - 2\\24[/tex]

Hope this helped!

Answer:

24

Step-by-step explanation:

(1+5^2)-16(1/2​)^3

simplify

(1+25)-16(1/8)

simplify

26-2

simplify

24

If you apply the changes below to the absolute value parent function, f(x)=x, what is the equation of the new function? Shift 2 units to the right shift 3 units down

Answers

Answer:

f(x) = Ix - 2I -3

Step-by-step explanation:

f(x) = IxI

f(x) = Ix - 2I -3

The equation is f(x) = | x – 2 | + 3 Then the vertex of the absolute function will be at (2, 3).

What is an absolute function?

The absolute function is also known as the mode function. The value of the absolute function is always positive.

The absolute function is given as

f(x) = | x – h | + k

If you apply the changes below to the absolute value parent function

f(x) = |x|

Then the equation of the new function will be

Shift 2 units to the right, shift 3 units down

f(x) = | x – 2 | + 3

Then the vertex of the absolute function will be at (2, 3).

More about the absolute function link is given below.

https://brainly.com/question/10664936

#SPJ5

Zach keeps his pet chameleon Pinky in a terrarium with the dimensions shown below. There's sand in the bottom of the terrarium that reaches a height of 888 centimeters. Zach gets a new terrarium for Pinky that is larger. The base of the new terrarium is 252525 by 646464 centimeters. Zach moved the existing sand to the new terrarium. How deep will the sand be in the new terrarium?

Answers

Answer:

The Sand Will Be 2 inches Dip

Step-by-step explanation:

240 h = 480

=> h  = 2

sorry if this didn't help :p

The answer is the sand with be 2 inches deep

Help, show work please.

Answers

Answer:

A

Step-by-step explanation:

A: 0^2+8=8

B: 1^2+8=9

C: 2^2+8=12

D: 3^2+8=17

as 8 is the smallest, A is the answer

Pllzzz help I’ll mark brainliest

Answers

Answer:

26°

Step-by-step explanation:

AC=tan 64

BC=x=sec 64

Using sine rule

(Sin 64)/tan 64 = (sin BAC)/sec 64

Cos 64 = (sin BAC)(cos 64)

Sin BAC= 1

BAC=90

ACB+ 64+90=180

ACB= 26°

ACB=26.............. :)

PLEASE ANSWER ASAP The drama club is selling candles for a fundraiser. They spend $100 on the candles and sell them for $4.50 each. How many candles must they sell to make more than $125 profit? Let x represent the number of candles sold. Which inequality can you use to find x? 4.5x – 100 > 125 4.5x + 125 > 100 100 – 4.5x > 125 100 + 4.5x > 125

Answers

Answer: 4.5x-100 > 125

Step-by-step explanation: Each candle costs $4.50, which can be simplified to 4.5. To determine how much they will make from the candles, you want to multiply the cost of the candles (4.5) by how many candles are sold (x), and this is where the 4.5x comes from. We subtract 100, because that is how much they spent on the candles they are selling (profit means how much you make after expenses). Since they're trying to make MORE THAN $125 in profit, we use the > sign.

Answer:

So we know that they spend $100 on the candles. In order to make a $125 profit, they must sell $225 worth of candles. Each candle sells for $4.50, so: So we know that they spend $100 on the candles. In order to make a $125 profit, they must sell $225 worth of candles. Each candle sells for $4.50, so:

4.5x > 225 is the inequality for that. It just means $4.50 times the number of candles has to be more than the $225 we need. To simplify it, just divide both sided by 4.5:

x > 50

They have to sell more than 50 candles.

Santiago is eight years younger than Juan is today. If, in four years, Santiago will be half Juan’s age, how old is Santiago today? a) 1 b) 2 c) 3 d) 4

Answers

Answer:

d) 4.

Step-by-step explanation:

Let Santiago be x years old today.

Then Juan is x + 8 years old.

In 4 years Santiago will be x + 4 years.

In 4 years Juan will be x + 12 years.

From the given information:

x + 4 = 0.5(x + 12)

x = 0.5x + 6 - 4

0.5x = 2

x = 2 / 0.5

x = 4.

Let S be Santiago’s age
Let J be Juan’s age.

Since Santiago is 8 yrs younger than Juan, we can write

Equation 1: S = J-8

In 4 yrs, Santiago age will be S + 4,
In 4 yrs, Juan’s age will be J + 4.

Given:
In 4 yrs, Santiago will be half of Juan’s age, so ..

Equation 2: S+4=(J+4)/2

We know the value of S from equation 1. Substitute S=J-8 in equation 2, we get

J -8 + 4=(J+4 )/2

J-4 = (J+4 )/2

2( J- 4) =J + 4
2J-8 =J + 4
2J-J =8+ 4
J = 12

Substitute J= 12 in equation 1
S= 12-8
S = 4

So, Santiago’s age is 4 yrs today.

What is the correct evaluation of x2 - y2 - z2, when x is equal to -2, y is equal to 3 and z is equal to 4?

Answers

Answer:

-18

Step-by-step explanation:

x2 - y2 - z2 if x=-2, y=3, and z=4

x2 - y2 - z2

(-2) 2 - (3)2 - (4)2

(-4) - (6) - (8)

-10 -8

-18

Answer:

18

Step-by-step explanation:

7. Assume two people, Swanson and Suzie, are standing 35 feet apart and are watching a boat
race. At a given moment, Swanson approximates the angle formed by the lead boat, himself, and
Suzie to be 30°. Suzie approximates the angle formed by the lead boat, herself, and Swanson to be
130. How far is the boat from Swanson?
130°
30"
35 feet
Swanson
Suzie
Part I: What is the missing angle in this triangle? (1 point)
Part II: Use the law of sines to find the distance from Swanson to the boat. (2 points)

Answers

Answer:

78.4 ft

Step-by-step explanation:

Part I:

Missing angle = 180° - (130 + 30) (sum of angles in a triangle)

= 180° - 160°

Missing angle = 20°

Part II: distance (d) from Swanson to the boat

Law of Sines is given as:

[tex] \frac{a}{sin(A)} = \frac{b}{sin(B)} [/tex]

Where,

a = d

A = 130°

b = 35 ft

B = 20°

Plug in the values and solve for d

[tex] \frac{d}{sin(130)} = \frac{35}{sin(20)} [/tex]

Multiply both sides by sin(130) to make d the subject of the formula

[tex] \frac{d}{sin(130)}*sin(130) = \frac{35}{sin(20)}*sin(130) [/tex]

[tex] d = \frac{35*sin(130)}{sin(20)} [/tex]

[tex] d = 78.4 ft [/tex]

78.4 ft hope this helped good luck on the test or quiz or whatever it is good luck

What is the solution to -5 + z = -12 A. z = -17 B. z = -7 C. z = 7 D. z = 17

Answers

Answer: -7

Step-by-step explanation:

Your answer is B. Z= -7

Eli is driving on a long road trip. He currently has 12 gallons of gas in his car. Each
hour that he drives, his car uses up 1.75 gallons of gas. How much gas would be in the
tank after driving for 4 hours? How much gas would be left after t hours?
Gas left after 4 hours:
Gas left after t hours: 1
I
Submit Answer
attempt out of

Answers

Answer:

I would be 7 gallons used and 5 gallons left

Step-by-step explanation:

multyply 1.75 times 4 hours equal 7 then 12-7=5 is the total of gallons left

Hope this helps

7 used and five left

If the degree measures of the angles of a triangle are in the ratio 3 : 3 : 4, what is the degree measure of the largest angle of the triangle? (Sum of all three angles is 180)

Answers

x=3k

y=3k

z=4k

x+y+z=180

3k+3k+4k=180

10k=180

k=180/10

k= 18

z=4*18

z=72

answer: 72

Answer:72 degrees

Step-by-step explanation:

3:3:4 is the ratio of the angles of a triangle and we have been asked the degree measure of the largest angle.

First of all...add the three ratios

3+3+4=10

;Ratio 10=180 degrees(the sum of all the angles;ratios add up to the sum of all three angles)

10=180 how about ratio 3?

Cross multiply...3 times 180 over 10= 54 degrees

Both angles with ratio 3 are 54 degrees

180-108=72

The angle with ratio 4 has 72 degrees which makes it the largest angle

(08.01) Two lines, A and B, are represented by the following equations: Line A: y = x − 1 Line B: y = −3x + 11 Which of the following options shows the solution to the system of equations and explains why? (3, 2), because the point does not lie on any axis (3, 2), because one of the lines passes through this point (3, 2), because the point lies between the two axes (3, 2), because both lines pass through this point

Answers

Answer:

the answer is D

Step-by-step explanation:

y=x-1

2=3-1

2=2

y=-3x+11

2=-3(3)+11

2=-9+11

2=2

Answer:

Step-by-step explanation:

If both lines pass through the point (3, 2), we automatically know that (3, 2) is the soution of the system of linear equations given here, AND that (3, 2) is a solution of equation A and equation B both.

Which statements could he include in his explanation? Select two options.

The domain of both functions is all real numbers.
The domain of f(x) is x > 5.
The domain of g(x) is x > 5.
The range of f(x) is y > 0.
The range of g(x) is y > 0.

Answers

Answer:

The domain of fx is x>5

The domain of gx is x>5

The statements could he include in his explanation are

a. The domain of fx is x>5.

b. The domain of gx is x>5.

What is the function?

A function is defined as a relationship between a set of inputs and a single output. A function is an input-output relationship in which each input corresponds to exactly one output.

A function is a sort of rule that generates a single output for a single input. The image was given by Alex Federspiel. A good example is y=x2. You will only get one output for y if you enter anything for x. We can say that y is a function of x because x represents the input value.

Both functions are real numbers, so, f(x) is x > 5 and g(x) is x > 5 will be correct.

Therefore, the correct options are, a. The domain of fx is x>5 and b. The domain of gx is x>5.

To learn more about the function, refer to the link:

https://brainly.com/question/28269290

#SPJ2

How would I solve this question? y = -1 1/8 - 7/8x -4x + 9y = -22 x = ?, y = ?

Answers

Answer:

(1.222, -2.444)

Step-by-step explanation:

I hope you can understand the question now

IM SO CONFUSED SOMEONE HELPP!! is it A? i honestly don’t even know anymore bc everytime it says i’m wrong :(((((

Answers

Answer:

it is option b

Step-by-step explanation:

pls mark me brainliest

Answer:

Hey there!

The answer is B, because the range is the possible y values.

Let me know if this helps :)

If a person earned $32,000 a year and received $800 raise, what was the percent increase in her salary?

Answers

Answer:

Hey there!

This would be a 2.5% increase in salary.

Using the percent increase formula we find the answer to be a 2.5% increase.

Let me know if this helps :)

Answer:

2.5%

Step-by-step explanation:

((new - original) / original) * 100

328-320 = 8/320 = 0.025

0.025 * 100 = 2.5

help me plz can somewon help me

Answers

Answer:

The answer is 6x10^-4.

Step-by-step explanation:

Move the decimal so there is one non-zero digit to the left of the decimal point. The number of decimal places you move will be the exponent on the  

10 .

If the decimal is being moved to the right, the exponent will be negative. If the decimal is being moved to the left, the exponent will be positive.

Answer: Bottom left corner, [tex]6 \times 10^{-4}[/tex]

How to get this answer:

Place the decimal point after the 6 to get 6.0

The question is now "how do we go from 6.0 to get back to 0.0006?"

The answer is "move the decimal point 4 spots to the left". This movement of "move 4 left" means the exponent is -4. The negative because we moved to the left. The 4 indicates how many spaces we moved.

So we get the scientific notation value of [tex]6.0 \times 10^{-4}[/tex] which is the same as [tex]6 \times 10^{-4}[/tex] because 6.0 simplifies to 6

A surveyor wants to find the height of a hill. He determines that the angle of elevation to the top of the hill is 50°. He then walks 40
feet farther from the base from the hill and determines that the angle of elevation to the top of the hill is now 30°. Find the height of
the hill (round to the nearest foot).
es

Answers

Answer:

The height of  the hill is 45 feet .

Step-by-step explanation:

Refer the attached figure

Let AB be the height of hill

We are given that He determines that the angle of elevation to the top of the hill is 50°

So, [tex]\angle ACB= 50^{\circ}[/tex]

Now  He then walks 40  feet farther from the base from the hill and determines that the angle of elevation to the top of the hill is now 30°

So, CD=40 feet

BD=BC+CD=BC+40

[tex]\ADB= 30^{\circ}[/tex]

In ΔACB

[tex]Tan \theta = \frac{Perpendicular}{Base}\\Tan 50^{\circ} =\frac{AB}{BC}\\1.1917 BC=AB ----1[/tex]

In ΔADB

[tex]Tan \theta = \frac{Perpendicular}{Base}\\Tan 30^{\circ} =\frac{AB}{BD}\\\frac{1}{\sqrt{3}}=\frac{AB}{BC+40}\\\frac{1}{\sqrt{3}}(BC+40)=AB----2[/tex]

So,equate 1 and 2

[tex]1.1917 BC=\frac{1}{\sqrt{3}}(BC+40)\\BC=37.59[/tex]

Substitute the value in equation 1

1.1917 (37.59)=AB

44.796=AB

Hence the height of  the hill is 45 feet .

The answer is 45 feet
Other Questions
Last Sunday, the average temperature was 8\%8%8, percent higher than the average temperature two Sundays ago. The average temperature two Sundays ago was TTT degrees Celsius. Which of the following expressions could represent the average temperature last Sunday? Find an equation of the plane through the point(1, 5,-1) and perpendicular to the vector (1, 5, 1). Do this problem in the standard way. Solve for x: 2(10-2x) = 4(3x + 1). Write your answer as a fraction. can u help me ASAP. i need to know how to do it step by step the formula s= I dont know how to type that but I really need helppppp Pasteur's experiments proved that ________. Pasteur's experiments proved that ________. spontaneous generation can only occur if nutrient broth is left open to the environment cells cannot survive in swan-necked flasks preexisting cells present in the air can grow in sterilized nutrient broth sterilizing nutrient broth prevents spontaneous generation in order to grow, cells need to be supplied with oxygen please help !!!!! please note that two images are there................ i am urgently needs this question On a plane trip, baggage over 40 pounds ischarged at the rate per pound of 1% of the one-way fare. The charge for a bag weighing 52pounds on a trip where the one-way fare is $98is:HELP PLEASEE!! QUICK!! When the hydraulic conductivity Ks = 10 mm/hr; effective matrix potential Ns = 20 mm, and rainfall intensity I = 30 mm/hr , determine the amount of runoff generated when the runoff rate reaches 15 mm/hr?( 2.7 mm or 0.21 mm or 18 mm or 0.67 mm) PLS HELP ASAP Solve the inequality and enter your solution as an inequality in the box below 8>4-x>6 difference between photosynthesis and respiration In a survey of adults in a certain country conducted during a period of economic uncertainty, % thought that wages paid to workers in industry were too low. The margin of error was percentage points with % confidence. For parts (a) through (d) below, which represent a reasonable interpretation of the survey results? For those that are not reasonable, explain the flaw. how many are 2 raised to 2 ??? Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG This rectangular patio is tiled using 50 cm by 50 cm square tiles. How many tiles are used? Imagine that you are the supply chain manager for the Magic Widget company and you need to measure your supply chain performance. The chart shows the financial variables that you will need to perform your task. Financial Variables Total Assets (in $ billions) 15.1 Cost of Goods Sold (in $ billions) 14.3 Inventory: Raw Material Inventory (in $ billions) 0.76 Work-in-progress Inventory (in $ billions) 0.12 Finished Goods Inventory (in $ billions) 0.82 Compute the percentage of assets committed to inventory and inventory turnover. What is the quotient of 35,423 15? The plateau phase of population growth is best described as: A. The population stops growing because they moved into the plateau environment at this stage. B. The population pauses in its growth after a natural disaster before growing again. C. The population moves onto a large, raised, flat area called a plateau for protection from predator. D. The population stops growing because the environment has reached its carrying capacity. The Coriolis effect Choose one: A. causes north-flowing currents in the northern hemisphere to curve to the west. B. causes the same direction of deflection in the northern and southern hemispheres. C. is a deflection of wind or water flowing over the Earth's surface. D. is a phenomenon created by the movement of ocean currents. Light passes through a single slit. If the width of the slit is reduced, what happens to the width of the central bright fringe