Answers
Related Questions
what are alleles mutations in the dna
Answers
Answer:
Mutations Are Recessive or Dominant
A 43-year-old Caucasian man with a 20-year history of bipolar disorder presents for the first time with long-term polyuria and polydipsia. He previously took lithium for mood stabilization for 15 years before initiating divalproex sodium therapy. He stopped using lithium because of the polyuria, but he felt that the polyuria never fully subsided. His weight is stable, and he has no other urinary complaints. His blood pressure is 115/80 mmHg and his physical exam is normal. His urinalysis shows no blood, cells, protein, glucose, nitrate, casts, or crystals.
What is the most likely cause of his polyuria?
1 Central diabetes insipidus
2 Nephrogenic diabetes insipidus
3 Polyuria secondary to hyperglycemia
4 Polyuria following acute kidney injury
5 Polyuria secondary to polydipsia
Answers
Answer:
The correct option is 2 Nephrogenic diabetes insipidus.
Explanation:
Nephrogenic diabetes insipidus (NDI) occurs when the renal tubule response to vasopressin (ADH) is weakened, resulting in the excretion of large volumes of dilute urine.
As the renal tubules do not respond to vasopressin (antidiuretic hormone) and are unable to reabsorb filtered water back into the body, the kidneys create a high volume of dilute urine in nephrogenic diabetes insipidus.
Nephrogenic diabetes insipidus (NDI) can be inherited or develop as a result of disorders that impede the ability of the kidneys to concentrate.
Therefore, the correct option is 2 Nephrogenic diabetes insipidus.
That is, the most likely cause of his polyuria is nephrogenic diabetes insipidus.
which sequence demonstrates the increasing complexity of levels of organization in multuticelluar organisms ?
A organelle_cell_tissue_organ_organ system_oraganism
B cell_organelle_tissue_organ_organsystem organisms
C organelle_tissue_cell_organ_organ system organisms
D cell_organism _organ_organ system _tissue_organelle
Answers
Answer:
it's A
Explanation:
It's just a simple chain. Many Organelles form cell, many cells form a tissue, many tissues together form an organ, various organs together form an organ system and different organ systems together make a complete organism.
I hope it helps :))
sodium-potassium pump. Find out what this pump does for a cell, and explain it here.
Answers
Answer:
protein pump
Explanation:
This protein pump, also known as the Na+/K+ pump or Na+/K+-ATPase, is located in the cell membrane of neurons (and other animal cells). It works by transporting sodium and potassium ions across the cell membrane in a 3:1 ratio of sodium ions out to potassium ions in.
Answer:
Hello There!!
Explanation:
Here is the answer↬It transports sodium and potassium ions across the cell membrane.
hope this helps,have a great day!!
~Pinky~
Explica qué son los codones y los anticodones La siguiente secuencia de nucleótidos de ADN codifica para una secuencia de aminoácidos que forman una proteína hipotética, encuentre la secuencia de codones, anticodones y aminoácidos que se forman 5 ` A T G A G C A C C C A A A C T T G C TC T T A T T C T A A A A A G A C T 3
Answers
Answer and Explanation:
La informacion genetica de ensamblaje de aminoácidos durante la sitntesis proteica, se almacena en unidades llamadas codones.
Un codón es una secuencia corta de tres nucleotidos provenientes de la cadena de ADN o ARN mensajero. Cada codón representa uno de los 20 aminoácidos disponibles para sintetizar la proteina. En total hay 64 codones, de los cuales 61 codifican aminoácidos (mas de un codón puede codificar para el mismo aminoácido), de los cuales uno de ellos a parte es el codon de inicio de sintesis proteica. Los restantes tres codones corresponden a codones de finalización.
El anticodón es la secuencia de nucleótidos presentes en ARN de transferencia, que complementa a cada codón de ARN mensajero. De esta forma el ARNt reconoce el aminoácido correspondiente y lo ensambla en la nueva proteina.
ADN ⇒ 5 ` ATGAGCACCCAAACTTGCTCTTATTCTAAAAAGACT 3
Codones ATG-AGC-ACC-CAA-ACT-TGC-TCT-TAT-TCT-AAA-AAG-ACT
ARNm ⇒ UACUCGUGGGUUUGAACGAGAAUAAGAUUUUUCUGA
Codones UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA
Recordá que para ARNm, la secuencia de nucléotidos debe ser la complementaria para ADN.
Anticodones de ARNt ⇒ Complementarios a los codones de ARNm. Recordá que para los ARN, la timina se reemplaza por uracilo.
AUG-AGC-ACC-CAA-ACU-UGC-UCU-UAU-UCU-AAA-AAG-ACU
La proteina se construye en función de la información del ARNm, es decir que para la selección de aminoácidos, se consideran los codones del ARNm, y no los anticodones de ARNt.
UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA
TYR SER TRP VAL Stop THR ARG ILE ARG PHE PHE Stop
Photosynthesis in plants is an example of
Answers
Answer: If you are asking if your answer is correct, it is. Photosynthesis is the process of converting sunlight into food and energy, therefore it is an example of nutrition.
Photosynthesis in plants is an example of nutrition
What is photosynthesis?
Photosynthesis is the process by which plants use sunlight, water, and carbon dioxide to create oxygen and energy in the form of sugar.
It is carried out by algae, plants and even some microorganisms.
The sugar produced form photosynthesis is a great source of nutrients for photosynthetic organisms and plants.
Therefore, photosynthesis in plants is an example of nutrition
Learn more about photosynthesis here:
https://brainly.com/question/3529377
#SPJ9
What is the smallest LIVING part of an organism?
A. Molecules
B. Cells
Answers
Answer:
Hi, there the answer is a cell
Explanation:
The smallest living part of an organism is a cell. The cell is the smallest structural and functional unit of living organisms, which can exist on its own.
Answer:
B. Cells
Explanation:
The cells are the smallest living part of an organism.
which process reduces the number of chromosomes by half
Answers
Answer:
Meiosis process reduces the number of chromosomes by half.
Explanation:
Meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half and produces four gamete cells.
Answer:
meiosis
Explanation:
meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half and produces four gamete cells
Which common resource is being degraded in the photograph?
A. Pastureland
B. Atmosphere
C. Ocean
D. Freshwater
Answers
Answer:
b
Explanation:
Bacteria and fungi fulfill which role in an ecosystem?
A. Consumer
B. Decomposer
D. Producer
Answers
Answer:
B. Decomposer
Explanation:
Bacteria and fungi fulfill the role of decomposers in an ecosystem. Hence, option (B) is the correct answer.
IS THIS CORRECT?? IF NOT WHATS THE ANSWER PLEASE
Answers
Hope u get good marks stay safe
:D
according to this time table a train --------- at 3 o'clock .A will leave .B is leaving C. is going to
Answers
Answer:
is going on is your answer
How are the early stages of embryonic development different from the later stages of development?
Answers
what do you mean by faunal Diversity
Answers
Answer:
animal life especially
Explanation:
i hope it helps
this is my answer
correct me if im wrong
#carryonlearning
Base your answer on the information below. A decade after the Exxon Valdez oil tanker spilled millions of gallons of crude [oil] off Prince William Sound in Alaska, most of the fish and wildlife species that were injured have not fully recovered. Only two out of the 28 species, the river otter and the bald eagle, listed as being injured from the 1989 spill are considered to be recovered said a new report, which was released by a coalition of federal and Alaska agencies working to help restore the oil spill region. Eight species are considered to have made little or no progress toward recovery since the spill, including killer whales, harbor seals, and common loons [a type of bird]. Several other species, including sea otters and Pacific herring, have made significant progress toward recovery, but are still not at levels seen before the accident the report said. More than 10.8 million gallons of crude oil spilled into the water when the tanker Exxon Valdez ran aground 25 miles south of Valdez on March 24, 1989. The spill killed an estimated 250,000 seabirds, 2,800 sea otters, 300 harbor seals, 250 bald eagles, and up to 22 killer whales. Billions of salmon and herring eggs, as well as tidal plants and animals, were also smothered in oil. Reuters The oil spilled by the Exxon Valdez tanker is an example of ______________.
Answers
Answer:
Explanation: The Exxon Valdez oil spill was a manmade disaster that occurred when Exxon Valdez, an oil tanker owned by the Exxon Shipping Company, spilled 11 million gallons of crude oil into Alaska’s Prince William Sound on March 24, 1989. It was the worst oil spill in U.S. history until the Deepwater Horizon oil spill in 2010. The Exxon Valdez oil slick covered 1,300 miles of coastline and killed hundreds of thousands of seabirds, otters, seals and whales. Nearly 30 years later, pockets of crude oil remain in some locations. After the spill, Exxon Valdez returned to service under a different name, operating for more than two decades as an oil tanker and ore carrier.
On the evening of March 23, 1989, Exxon Valdez left the port of Valdez, Alaska, bound for Long Beach, California, with 53 million gallons of Prudhoe Bay crude oil onboard.
At four minutes after midnight on March 24, the ship struck Bligh Reef, a well-known navigation hazard in Alaska’s Prince William Sound.
The impact of the collision tore open the ship’s hull, causing some 11 million gallons of crude oil to spill into the water.
At the time, it was the largest single oil spill in U.S. waters. Initial attempts to contain the oil failed, and in the months that followed, the oil slick spread, eventually covering about 1,300 miles of coastline.
Investigators later learned that Joseph Hazelwood, the captain of Exxon Valdez, had been drinking at the time and had allowed an unlicensed third mate to steer the massive ship.
what are the three main particles of soil are? How do these shape and influence the type of soil we observe and its uses?
Answers
Answer:
Soil particles vary greatly in size, and soil scientists classify soil particles into sand, silt, and clay. Texture indicates the relative content of particles of various sizes, such as sand, silt and clay in the soil. Texture influences the ease with which soil can be worked, the amount of water and air it holds, and the rate at which water can enter and move through soil. Soil provides plants with foothold for their roots and holds the necessary nutrients for plants to grow; it filters the rainwater and regulates the discharge of excess rainwater, preventing flooding; it is capable of storing large amounts of organic carbon; it buffers against pollutants, thus protecting groundwater.
The direction of force of Earth's magnetic field is from the geographic South
Pole to the geographic North Pole. Where is Earth's magnetic north pole?
O A. Near Earth's center
O B. Near Earth's equator
O C. Near Earth's North Pole
O D. Near Earth's South Pole
Answers
EARTH SCIENCE CLASS
Why is the street (asphalt) hotter than the sidewalk in the summer ?
Answers
Answer:
bad albedo ? sorry if not right
Which of the following organelles is properly matched to it's function?
lysosome: storage
endoplasmic reticulum: movement
lysosome: digestion
chloroplast: making proteins
Answers
The organelle properly matched to it's function is
-(C) lysosome: digestion
Explanation:
Lysosomes : It hold enzymes that were created by the cell. The purpose of the lysosome is to digest things. They might be used to digest food or break down the cell when it dies
Endoplasmic reticulum : to produce proteins for the rest of the cell to function.
Chloroplast : They are responsible to carry out photosynthesis
please help me answer this
Answers
Answer:
last one a dormancy structure D
Explanation:
It helps keeps bacteria and stuff dormant`
How to overcome Confusion?????
Answers
Answer:
use a full heal
Explanation:
Female mosquitoes need a meal of blood from a person or other animal in order to produce eggs. It has been discovered that mosquitoes have cells on their antennae that can detect the insect repellent known as DEET. The repellent is not harmful to mosquitoes, but when mosquitoes detect DEET, they will not land on the surface where the DEET has been applied. This protects people from being bitten by mosquitoes. Recently, scientists found some mosquitoes that are resistant to DEET because they do not detect its presence. They bred these mosquitoes and eventually produced a population consisting of about 50% DEET- resistant insects. Identify the process most likely responsible for a mosquito initially becoming resistant to DEET.
Answers
Answer:
Mutation followed by natural selection made mosquitos resistant to DEET
Explanation:
Natural selection selects beneficial alleles, which increase their frequency in the population, resulting in adaptation. Aptitude, which is the contribution of each genotype to the next generation, increases too.
In many cases adaptations, resulting from the natural selection process can be correlated to environmental factors or selective pressures applied by other organisms or habitats.
Let us remember that, a mutation is a change or alteration in DNI sequences that introduce new variants. Many of these are eliminated, but some of them might succeed and be incorporated into each individual. These mutations are the ones that have been selected by natural selection.
So, in the exposed mosquitos´ example,
The selective pressure or modeling environmental factor is the DEET repellent.Some of the mosquitos mutated changing their behavior. The new mosquito´s response is not-detection of the repellent presence -only in those individuals carrying the mutations-. Natural selection benefits these mutations. Mosquitos survive and become more resistantProbably some of the mosquitos in the population suffered a mutation that favored them in not detecting repellent DEET. These individuals developed resistance to the chemical and were able to survive and reproduce, enhancing population sizes again. Natural selection benefited the mutation that gave them resistance.
Let us remember that the term resistance refers to an inheritable change in the population sensitivity, reflected through the consecutive failure of the chemical effects, correctly used in order to cause an effect on the insect population.
Repellents might produce a genetic modification in the insects, leading them to not detect the chemical. Insects evolve with the capability of tolerating the DEET dose that normally is used to repel mosquitos
The excessive use of DEET leads to the fixation of new genes -by natural selection- that result from mutations in the mosquito genetic material, which makes them become even more resistant to the chemical.
Complete the T-chart by categorizing each environmental factor as something that would most likely increase or decrease genetic variation. Some answers will fit in both columns depending on the situation.
Predator-prey relationships
Competition
Toxins
New habitat
Disasters
Increased food source
A 2-column table has columns with labels Increase variation and decrease variation.
Answers
Answer: 1. Decrease 2. Decrease 3. Both 4. Both 5. Decrease 6. Increase
Explanation: I got it right hopefully it helps
Answer:just did it
Explanation:
What might analysts be able to use tunable lights for?
This is for a forensics class.
Answers
Explanation:
crime scene investigators and forensic examiners are now using "alternate light sources" to identify residues and prints which cannot be seen under normal light conditions.........could there be a role for them to this end?
what is a good definition of photosynthesis?
A. using glucose to create light
B. putting together lights so we can see
C. using light to put together food (glucose)
Answers
Answer:
The best answer is C
Explanation:
Plants use light to create their own food. this is called photosynthesis
Answer:
C
Explanation:
The process of photosynthesis uses light to create food and uses other gas like carbon dioxide.
According to the theory of natural selection, what is an ability of individuals that makes them more likely than others to survive and reproduce?
A The ability to change their environment
В.
The ability to avoid mutations in their genes
C.The ability to have multiple offspring
D
The ability to adapt to their environment
Answers
Answer:
D
Explanation:
It could be A but we easily adapt to our environment that animals. B is definitely out of it and C is a characteristic of animals as well
2. Ang
ay isang genre na gumagamit ng mahika at
iba pang supernatural na penomena bilang punong elemento
ng plota, tema, at/o ganapan.
A. Pabula B. Drama
C. Pantasya D. Mga Tula
Answers
Answer:
C. Pantasya
Explanation:
Ang anumang genre ng pantasya ay magkakaroon ng isang uri ng supernatural o magic na tema na isinama dito
Sana nakatulong ito :)
7.9(A) Which of these conditions is most responsible for Earth having an environment
that supports life? help please
Answers
Gizmos ( Building DNA )
Activity A :
Question : What is the structure of DNA
Build : follow the steps given in the gizmo to construct a molecule of dna
Answers
Answer:
Double Helical Spiral structure
Explanation:
DNA is a helical spiral structure in which two long strands of nucleotide form a double helix structure.
It looks like a structure of ladder in which the phosphate and sugar molecules from the side of the ladder and the base pairs form the rungs.
Classify each of the samples in the grid below as one of the following substances. Each one may be used more than once:
Answers
si 0?no Nop suficientemente silvestre usuario independencia 6t?
