ASAP When ______ is hydrolyzed, it forms _______. A. protein, amino acids B. ATP, ADP C. polysaccharide, monosaccharide D. lipid, triglyceride

Answers

Answer 1

Answer:

The answer is ATP, ADP

Explanation:

Answer 2

When protein is hydrolyzed, it forms amino acids. Thus, the correct option is A.

What is Hydrolysis?

Hydrolysis may be defined as a chemical process that utilizes the molecules of water that involve the chemical breakdown of a compound.

Amino acids are the monomers of protein. These amino acids are linked together by peptide bonds. But the process of hydrolysis breaks the peptide bond between the amino acid sequences and released them significantly in free form.

Therefore, when protein is hydrolyzed, it forms amino acids. Thus, the correct option is A.

To learn more about Hydrolysis, refer to the link:

https://brainly.com/question/4352413

#SPJ5


Related Questions

Which structure is found in the cytoplasm of a prokaryotic cell, but is not found in the cytoplasm of a eukaryotic cell?
DNA
ribosomes
nucleus
mitochondria

Answers

Answer:

DNA

Explanation:

cytoplasm of a prokaryotic cell, but is not found in the cytoplasm of a eukaryotic cell.

Answer:

A- DNA

Explanation:

Consider that a certain gene is a maternal effect gene and that the allele for dark brown pigment is incompletely dominant to the allele for no pigment (white). The incomplete dominant phenotype is light tan. If a white female is crossed with dark brown male, what will be the phenotypic ratio of the progeny?
A) all white
B) all dark brown
C) all light tan
D) either all white or all light tan
E) either all light tan or all dark brown
F) none of the above choices (cannot be determined)

Answers

Answer:

The correct answer is C. All light tan        

Explanation:

You will find the answer and explanation in the attached file due to technical problems.

Restriction digest A:

ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC

How many bases are in the second fragment?

Answers

Answer:

This question seem incomplete

Explanation:

This question seem incomplete. However, if the strand of the second fragment is what is provided above, then the answer is 51

This strand/fragment is definitely a DNA strand because of the absence of uracil (U) or because of the presence of thymine (T). The four bases in a DNA are adenine (A), Thymine (T), cytosine (C) and Guanine (G). These bases also bind to one another in the pattern described below

A ⇆ T

G ⇆ C

Hence, the adenine (A) on one strand can only bind to thymine (T) on the complementary strand (and vice versa) while the guanine (G) on one strand can only bind to cytosine (C) on the complementary strand (and vice versa).

Hence, the letters seen is the question are representations of bases in a DNA strand/fragment. The number of letters/bases here are 51

Which process involves a decrease in the dispersal of matter? Select the correct answer below: heat exchange between two solids

Answers

Answer:

The options are

A.heat exchange between two solids

B.the decomposition of a compound into its constituent elements

C.the precipitation of a solid

D.none of the above

The answer is

C.the precipitation of a solid

Dispersal of matter involves the process whereby there is more space occupied by the resulting element/compound than the initial one. For example the conversion of liquid to gas means that it has an increase in the dispersal of matter as the gas particles will contain more space when compared to a liquid.

Precipitation of a solid means conversion of a liquid to a solid. A liquid is known to contain more space which means there is a decrease in the dispersal of matter.

The process that involved the reduction in the dispersal of matter should be the precipitation of a solid

What is the dispersal of matter?

It refers to the process in which it contains the additional space that should be occupied. Like the conversion of the liquid to gas represent there should be increment in the disperson of the matter since the particles of the gas comprise more space at the time when the comparison is to be done with the liquid. Here, precipitation of the solid represent the transformation of the liquid to the solid.

This question is incomplete. Please find the options below.

A.heat exchange between two solids

B.the decomposition of a compound into its constituent elements

C.the precipitation of a solid

D.none of the above

Learn more about dispersal of matter here: https://brainly.com/question/6529880?referrer=searchResults

What is an example of nature exhibiting zero
waste?
1. Oxygen is a waste product
from plants.
2. Oxygen is a waste product
from animals
3. Animals consume oxygen in
respiration
4. Plants consume oxygen in
photosynthesis
A
1 and 3
B
1 and 4
С
2 and 3
D
2 and 4

Answers

Answer:

idontknow

Explanation:

you are aintelligent nice qiestion

When the body cells are hypotonic to the blood plasma, water will move from intracellular fluid to extracellular fluid.
A. True
B. False

Answers

Answer:

True

Explanation:

Epithelial tissue always has an exposed outer surface and an inner surface anchored to connective tissue by a thin, non- cellular structure called the (a) Nonstratified layer (b) Stratified layer (c) Basement membrane (d) Fibroblast

Answers

Explanation:

(a)Nonstratified layer

The anticodon (Select all that apply):

a. is a triplet of nucleotides in tRNA
b. determines the identity of the amino acid to be added to the peptide chain
c. is complementary to the codon
d. binds to the codon via hydrogen bonds

Answers

Answer:

choice A

Explanation:

An anticodon is a trinucleotide sequence complementary to that of a corresponding codon in a messenger RNA (mRNA) sequence. An anticodon is found at one end of a transfer RNA (tRNA) molecule.

TRBP is a protein important for the formation of the RISC complex. Which of the following would you expect in cells with null mutations in TRBP?
a. Reduced siRNA-mediated mRNA degradation
b. Increased miRNA-mediated translational repression
c. Increased deadenylase-mediated mRNA degradation
d. Reduced proteasome-mediated protein degradation

Answers

Answer:

a. Reduced siRNA-mediated mRNA degradation

Explanation:

The TRBP (transactivation response element RNA-binding protein) is an RNA-binding protein that forms the Dicer complex, which is involved in epigenetic pathways such as those mediated by the RNA interference (RNAi) mechanism. RNAi is a key process where small non-coding RNAs such as, for example, small interfering RNAs (siRNAs) and microRNAs (miRNAs) can inhibit target gene expression at posttranscriptional level by different mechanisms (including the degradation of target mRNAs). A null mutation of this cofactor will alter the Dicer complex, thereby also affecting RNAi pathways mediated by small interfering RNAs.

Explain what, if any, is the issue facing DNA polymerase in regards to its 5’->3’ activity when replicating DNA.

Answers

Answer:

The two strands of DNA are replicated in different ways

Explanation:

DNA replication is a process that occurs during the S phase of the cell cycle that consists of making two identical copies of the double-stranded DNA molecule, which subsequently are distributed in the daughter cells during cell division. During this process, DNA polymerase can add nucleotides in 5' to 3' direction, but not in 3' to 5' direction. In consequence, the DNA strand that has 3’ to 5’ directionality can be synthesized directly, while the DNA template strand that has 5’ to 3’ directionality can't be synthesized in a continuous manner and thereby it is created by adding small DNA fragments, which are known as Okazaki fragments (150-200 nucleotides in size).

How are red blood cells able to move through narrow vessels to carry oxygen throughout a multicellular organism? (1 point) a)They are flexible because they lack a plasma membrane. b)They are small because they lack a nucleus. c)They are long and thin with a tail-like end. d)They are small because their organelles are smaller than those of other cells.

Answers

Answer:

The correct answer is - option B. They are small because they lack a nucleus.

Explanation:

Red blood cells or erythrocytes are specialized cell that produce in bone marrow and have specific role such as carrying oxygen from lungs to deliver it to the various organs and carry out carbon dioxide.

In mammals these cells lack cell organelles such as nucleus and mitochondria, a major factor that determined its smaller size. The size of RBC are move through narrow vessels throughout a organism because of its specific size and shape that provide it space for hemoglobin and allow to be flexible and bend to move through narrow vessels.

Thus, the correct answer is : option B. They are small because they lack a nucleus.

General and Specific knowledge example

Answers

The sky is blue, Planes travel because of the pressure under the wings

GENERAL: the sky is blue SPECIFIC: Planes travel because of the pressure under the wings

Help with this please anyone!!!

Answers

Answer:

top right

Explanation:

What complications might arise from genetic screens targeting an organ that differentiates late in development?

Answers

Answer:

No sign of testicular development in boys and breast development in girls.

Explanation:

Complications like no sign of testicular development in boys and breast development in girls occurs if an organ develop very late. There are many causes of this type of complications such as long term illness, eating improper food and disorder of sexual development. Sometime these complications  also occurs due to genetically. These complications should be treated well with medication and use of nutritious food. These medicines increases the performance of sex hormones in order to initiate puberty.

all of the following are examples of organic matter soil except

Answers

This question is incomplete; here is the complete question:

All of the following are examples of organic matter soil except

A. Decaying plants

B. Bacteria

C. Fungi

D. Water

The answer to this question is D. Water

Explanation:

Organic matter derives from living beings, due to this, organic matter is considered as a biological product. In this context, materials such as decaying plants are organic matter because they derive from living organisms and contain biological molecules (most contain carbon). This category does not apply to water, which is composed of hydrogen and oxygen and does not derive from living beings. Thus, the one that is not organic matter is water.

Answer:

D. Water

Hope this Helps!! :))

Predict what will happen to the following lung volumes and capacities during strenuous exercise. Assume that you are comparing from a baseline of normal resting respiration.


Lung Volume or Capacity Predicted change from resting baseline : Use Increase, Decrease or No Change

TLC (total lung capacity)
No change
VC (Vital capacity)
IC (Inspiratory capacity)
FRC (Functional residual capacity
TV (Tidal volume)
IRV (Inspiratory reserve volume)
ERV (Expiratory reserve volume)
RV (Residual volume)

Answers

Answer:

During intense exercise:

lung capacity increases

vital capacity increases

respiratory capacity increases

functional residual capacity increases

tidal volume increases

the inspiratory and expiratory reserve volumes decrease as does the residual volume.

Explanation:

Residual volumes decrease because having better lung capacity, better development of the secondary skeletal muscles that collaborate in expiration and inspiration, these are given in a better way, and more effectively.

If these processes take place more efficiently, their potentiality increases and expiration and inspiration move a large current of air into the lungs, thus leaving less reserve airs.

Those people who have increased exhalation or inspiration reserve, have a weak activity of the musculature in the processes and function as "stagnant air" which is synonymous with a lack of physical activity or aerobic capacity.

It is important to clarify that all the above processes are accompanied by an increase in the size of the chest cage

Explain why you selected the location recorded in Panel 1 as the ideal incubation site for culturing microbes?

Answers

Answer:

Due to optimum environment for microbes.

Explanation:

I selected Panel 1 as the ideal incubation site for culturing microbes because the environmental conditions such as temperature, humidity and nutrients medium etc are optimum. Microbes need a specific environmental conditions for its growth and development. If the environmental conditions are not suitable so it adversely affected the growth and development of microbes.

RNA polymerase is an enzyme that copies (1 point)
o DNA into DNA.
O RNA into mRNA
O mRNA into tRNA.
DNA into RNA

Answers

Answer:Copies DNA into RNA

Explanation:

whats the answer guys help me out

Answers

Answer:

Read Exp:

Explanation:

1st one - Attracts Pollinators.

2nd one -  Prevents water loss.

3rd one - Traps insects.

Transposons need to __________________ in order to limit their negative impact on the genome of the host cell. A. control their nucleotide length B. regulate their copy number C. control their target-site choice D. avoid transposing into their own genome

Answers

Answer:

The correct answer is B

Explanation:

Transposons need to regulate their copy number to avoid errors with chromosomal pairing during meiosis and mitosis such as unequal crossover.

A typical example of this error is called the Alu Sequence or Elements. Alu elements contain more than one million copies found everywhere in the genome of human beings.

Many inherited human diseases such as cancer are related to Alu insertions.

Cheers!

In a population of flowers growing in a meadow, C1 and C2 are autosomal codominant alleles that control flower color. The alleles are polymorphic in the population, with f (C1) = 0.8 and f (C2) = 0.2. Flowers that are C1C1 are yellow, orange flowers are C1C2, and C2C2 flowers are red. A storm blows a new species of hungry insects into the meadow, and they begin to eat yellow and orange flowers but not red flowers. The predation exerts strong natural selection on the flower population, resulting in relative fitness values of C1C1 = 0.30, C1C2 = 0.60, and C2C2 = 1.0.

Required:
a. What is the C1C2 genotype frequency among the progeny of predation survivors?
b. What is the C2C2 genotype frequency among the progeny of predation survivors?
c. What is the C2C2 genotype frequency among the progeny of predation survivors?
d. What is the equilibrium C2 allele frequency in the predation environment?

Answers

B is yours answer have a nice day

The Middle Latitudes have:

Answers

Answer:

The Middle Latitudes have cyclones and anticyclones

Explanation:

The Middle Latitude is a spatial region of the earth which are found between the tropics and the polar circles.

The climate in this region of the earth is usually very windy thereby forming cyclones and in serious conditions typhoons and hurricanes. The Middle Latitude is thereby characterized by cyclones and anticyclones.

Recent research has found that on one island of the Galapagos two finch species interbred. This interbreeding may have resulted in a hybrid species that ultimately led to the extinction of one of the species Darwin discovered. They call this speciation in reverse, or despeciation. Based on what you know about speciation, why are these terms appropriate?

Answers

Answer:

Speciation is defined as an evolutionary process in which one population evolves into a distinct species.

Speciation in reverse, or despeciation is defined as the extinction of an old species due to combining with evolved species to produce hybrid species but it conserves biological lineage.

In the given research, the term used despeciation or speciation in reverse is appropriate as hybrid species resulted from interbreeding of Galapagos two finch species conserved the biological lineage but also loss one of the species Darwin discovered.

Answer:

Speciation is the method by which unique species evolve from a common ancestor. In this case, two of these species that split from a common ancestor interbred and created a hybrid. This hybrid was apparently stronger and possibly better adapted to the environment, which led to extinction of a species formed by the initial speciation event.

Explanation:

Plato

All of the following are functions of the central nervous system except it interprets signals from the external environment it translates signals from the internal organs it receives messages from the peripheral nervous system it sends messages directly to muscles and glands hint: its not A or B

Answers

Explanation:

It sends message directly to muscles and glands

ASAP What is a photosynthetic pigment? What is a photosynthetic pigment? A. An oxygen based compound that captures light energy. B. A light sensitive compound that changes color. C. A colored compound that captures light energy. D. A manmade compound that reacts to light.

Answers

I think the answer is A.

Answer:

A. An oxygen based compound that captures light energy.

Before using any chemical in the lab, why should one first read the Material Safety Data Sheet (MSDS)?
The MSDS provides information on safe handling of the chemical.
The MSDS explains where the chemical can be purchased.
The MSDS provides the chemical formula for the substance.
The MSDS describes how the chemical will react with other substances.​

Answers

Answer:

A

Explanation:

Took test on Edge.

Material Safety Data Sheet (MSDS) contains information related to occupational safety and health. The MSDS provides knowledge on the safe handling of chemicals. Thus, option A is correct.

What is MSDS?

Material Safety Data Sheet (MSDS) is the data safety sheet that states the rules and details of handling and using the laboratory chemicals that are related to health. It is of great importance as it allows the learning of chemical hazards.

Before entering the lab and using the chemicals one should read the MSDS book so to get aware of the handling and precautions that have to be taken while performing any experiments. To work safely one should know its danger and should be prepared for emergencies.

Therefore, the MSDS provides knowledge on the handling of hazardous chemicals.

Learn more about MSDS here:

https://brainly.com/question/3282390

#SPJ6

Describe how scent and taste work in conjunction. Are the tastes of below mention foods that were tested heightened by the sense of smell, or only some of the foods?

a. Salt
b. Sugar
c. Lemon Juice
d. Coffe grounds

Answers

Answer:

Scent and Taste work in conjunction because when your brain smells food, it pulls up a picture or memory of that food in your head, and you remember what it tasted like and if you enjoyed it.

Only some of the food. Salt does not really have a smell, so it does not do anything, but all the others do and are heightened

Explanation:

Take cotton candy for example. When you smell cotton candy, you smell SUGAR and lots of it. You know that sugar tastes good and as such you now want to eat the cotton candy.

For this example, we will use lemonade. Lemonade is commonly a drink that most love on a hot summer day at the beach. When you smell the lemonade, it reminds your brain of how good it tasted and pulls up the memory at the back of your mind,  making you feel happy and relaxed. It then ends up tasting better

(This is my first answer, it won't be perfect)

Smell and taste go hand in hand because when you smell food, your brain conjures up an image or recollection of that food in your head, allowing you to recall how it tasted and if you liked it.

What is Conjuction?

Since salt doesn't truly have a fragrance, it has no effect; nevertheless, all the others do and their intensity is increased.

You can definitely smell a lot of sugar when you smell cotton candy. You want to eat the cotton candy because you are aware that sugar tastes delicious.

On a hot summer day at the beach, most people enjoy drinking lemonade.

Therefore, Smell and taste go hand in hand because when you smell food, your brain conjures up an image or recollection of that food in your head, allowing you to recall how it tasted and if you liked it.

To learn more about conjuction, refer to the link:

https://brainly.com/question/25713213

#SPJ2

ASAP Why is ATP used as an active energy source over glucose? A. It is more abundant in food sources. B. It releases its energy quickly in a single reaction. C. It releases its energy slowly through multiple reactions, allowing it to last longer. D. It has more energy.

Answers

Answer:

B.

Explanation:

Glucose is an organic molecule that stores ATP or energy while Adenosine triphosphate (ATP) is an energy-carrying molecule.

ATP used as an active energy source over glucose because ATP is a shorter process and releases energy in a single reaction as glucose first converted into ATP and then used as energy in cellular respiration.

Hence, the correct option is "B".

Which phase of mitosis begins when the sister chromatids are cleaved, allowing the two sister chromatids of each pair to separate?

Answers

Answer:

Anaphase

Anaphase

Anaphase

Which term best describes the difference in colors of the birds below? 4 birds are shown. One has light brown feathers with darker wings. One has very dark feathers with lighter wings. Another has medium brown feathers with light wings. The last one has medium brown feathers with very dark wings. natural selection reproductive maturity genetic variation genetic drift Mark this and return

Answers

Answer:

genetic variation

Explanation:

Genetic variation refers to the difference in genetic content of organisms within a population. The genetic makeup of living organisms are made up of GENES, which exists in contrasting pairs called ALLELES. Each allele is responsible for variation in traits exhibited by the organisms. Differences in the allelic content of organisms of the same species leading to the display of varying phenotypic characteristics is referred to as GENETIC VARIATION.

This is the case in the example given in which four birds in a population possess a range of wing and feather colors i.e light brown feathers with darker wings, dark feathers with lighter wings, medium brown feathers with light wings, and medium brown feathers with very dark wings, all resulting from a variation in their genetic content. Hence, this is an example of GENETIC VARIATION.

Answer:    C. Genetic variation

Explanation: :)

Other Questions
The following is the number of minutes to commute from home to work for a group of 25 automobile executives. 35363943373534303634303937 403833312839353536412436 How many classes would you recommend? What class interval would you suggest? (Round up your answer to the next whole number.) Organize the data and plot a frequency distribution on a piece of paper. Comment on the shape of the frequency distribution. It is not symmetric. It is fairly symmetric, with most of the values between 24 and 43. It is not very symmetric, but most of the values lie between 24 and 43. Olympia Marketing has instituted new policies around misappropriation of assets, conflicts of interests, and kickbacks. Also with the local elections just around the corner, management sent out reminders about political contributions and confidentiality of company information. All of these policies can be found in Olympia Marketing's a) employee handbook b) policies and procedures manual c) moral rights d) approach C In the short run, the quantity of output that firms supply can deviate from the natural level of output if the actual price level in the economy deviates from the expected price level. Several theories explain how this might happen. What is the difference between an optimistic approach and a pessimistic approach to decision making under assumed uncertainty Antiono le a su madre ahroa estate castigado por un mes Answer correctly! Will give BRAINLIST!! Which of the following are arguments in favor of active stabilization policy by the government? Check all that apply. The Fed can effectively respond to excessive pessimism by expanding the money supply and lowering interest rates. Businesses make investment plans many months in advance. The current tax system acts as an automatic stabilizer. Changes in government purchases and taxation must be passed by both houses of Congress and signed b Although Python provides us with many list methods, it is good practice and very instructive to think about how they are implemented. Implement a Python methods that works like the following: a. count b. in: return True if the item is in the list c. reverse d. index: return -1 if the item is not in the list e. insert If the sum of the daily unpaid balances is $7,812 over a 31-day billing cycle, what is the average daily balance? (a) If electrons were used (electron microscope), what minimum kinetic energy would be required for the electrons which of these is an example of a discrete random variable? A. Time worked on a job B. Weight of a child C. First digit of a phone number D. Length of a fish In its third year, a project is expected to produce earnings before interest and taxes of $671,551 and depreciation expense of $125,193. If the companys tax rate is 34%, what is the projects expected operating cash flow? list out two water borne diseases How much interest is earned in just the third year on a $1,000 deposit that earns 7% interest compounded annually? You are considering two ways of financing a spring break vacation. You could put it on your credit card, at 17% APR, compounded monthly, or borrow the money from youe parents, who want an interest payment of 6% every six months. which is the lower rate? (Dont round intermediate steps to decimal places) What is the 25th term in the following arithmetic sequence? -7, -2, 3, 8, ... the title of this text is "Energy Efficiency".What could be another good title for this next time 4. Multiple-Choice1. Two complementary angles measure (12r - 18) and (5x + 23). Whatis the measure of the smaller angle?(1) 5(2) 42(3) 48(4) 90I already know that the answer is 42 but I dont know how to get that! Please help. An organization is building a new customer services team, and the manager needs to keep the team focused on customer issues and minimize distractions. The users have a specific set of tools installed, which they must use to perform their duties. Other tools are not permitted for compliance and tracking purposes. Team members have access to the Internet for product lookups and to research customer issues. Which of the following should a security engineer employ to fulfill the requirements for the manager?a. Install a web application firewallb. Install HIPS on the team's workstations.c. implement containerization on the workstationsd. Configure whitelisting for the team Thorley Inc. is considering a project that has the following cash flow data. What is the project's IRR? Note that a project's projected IRR can be less than the WACC or negative, in both cases it will be rejected. Year 0 1 2 3 4 5 Cash flows -$1,100 $325 $325 $325 $325 $325