became friends and later, a relative to Manet.

Answers

Answer 1
What do you mean by this

Related Questions

The Civil Rights Act for 1946 made discrimination based on color, race, or religion against the law true or false

Answers

Answer: trueeee

Explanation:

or either the act of 1965 i think it was that year??

Answer:

African people were also exploited


I NEED HELP ASAP PLEASE!!
Your Task: Write a short personal response as if you were a specific object from history. Your response should
include both emotional and physical feelings of the object. Imagine you are the thing! Consider that if you were
George Washington's horse you would have quite a bit to think about.
Your response must:
-Be at least two complete paragraphs in length.
-Describe the purpose and function of the object.
-Describe how the object might feel or what it might be thinking.
-Mention/explain the historical situation.
-Grammar counts!
-Add an image of the "thing"

Answers

1941, chaos is surrounding me. This is World War 2 for goodness sake! My owner Martin Bormann gifter me to a man named Adolf Hitler. It has been a few months since I have came to this new home and I am already in love with him. Sometimes, I wonder if he is different around me though. Perhaps, a completely different personality set. I still love him with all my heart though.

Speaking of love, my master was quite happy about an attack on Pearl Harbor. Some people have mixed emotions about it all. All in all, humans confuse me. I am Hilter's companion, he trains me and we play fetch. I am pregnant at the time. Let me tell you it is miserable. It makes me look obese and I am lazy all of the time now. My feet ache from all of this weight I have gained. I can't wait to have these puppies out of me. Master will be happy, and hopefully he will help me keep them safe from this chaotic war.

What writer influenced king Louis xvi?

Answers

Answer:Louis XVI was the last king of France before the fall of the monarchy during the French ... France still maintained a strong influence in the West Indies, and in India ... The two writers did not share the same sociopolitical vision, but they agreed ...

Explanation:

Italy is

A. an island in the Mediterranean Sea.

B. a peninsula shaped like a boot.

C. a large country in Central Europe.

D. part of Scandinavia.

Answers

Answer:

C

Explanation:

I'm confident with that answer!

Answer:

The correct answer is B- a peninsula shaped like a boot

Explanation:

•Hope this helps•

Which climate zone has mild temperatures, hot/dry summers and cool winters and covers 5% of the land

Savanna (Tropical Wet and Dry)
Tropical Wet (rainforest)
Desert
Mediterranean

Answers

Answer:

Tropical weather is a good place for a new

(No files or link please) who good in history and know this political cartoon?

Answers

Answer:

c

Explanation:

What are the implications of swearing an oath to an individual leader, rather than to a nation?

Answers

Answer:

German military recruits swear allegiance to Adolf Hitler.

the American genocide is an example of
a. diplomacy
b. a government using war as an excuse to commit atrocities on its own citizens
c. communist revolution
d. self determination

Answers

Answer:

B. A government using war as an excuse to commit atrocities on its own citizens.

Explanation:

I believe its this, but do you mean or armenian, because that might change the answer.

Please please help help please please help me ASAP ASAP please ASAP thank you so much
NO LINKS OR FILES

Answers

Answer:

Need to add a story i believe.

Explanation:

- Name 3 loyal slave states to the north.

Answers

Explanation:

Alabama

Missouri

Florida

What was important about Dr. King'shave a dream speech

Answers

Answer:

"I Have a Dream" is a public speech that was delivered by American civil rights activist Martin Luther King Jr. during the March on Washington for Jobs and Freedom on August 28, 1963, in which he called for civil and economic rights and an end to racism in the United States.

I Have a Dream - Wikipediahttps://en.wikipedia.org › wiki ›

Answer:

"I Have a Dream" is a public speech that was delivered by American civil rights activist Martin Luther King Jr. during the March on Washington for Jobs and Freedom on August.

His speech called for civil and economic rights and an end to racism in the United States.

The Industrial Revolution began in which of the following countries?

Russia


England


France


United States

Answers

Answer:

England

Explanation:

This process began in Britain in the 18th century and from there spread to other parts of the world. Used earlier by French writers.

Answered by NONE other than the ONE & ONLY #QUEEN herself aka #DRIPPQUEENMO!!!

HOPE THIS HELPED!!!

Who was the totalitarian leader in Spain that looked to Hitler and Mussolini for help gaining power?

Answers

Answer: Francisco Franco

Explanation:

Francisco Franco was governing over Spain during WWII, and worked with Hitler (dictator of Germany) and Mussolini (dictator of Italy) in order to gain power and fight the war.

Which statement gives evidence for Brutus's tragic flaw in The Tragedy of Julius Caesar?

Brutus is easily manipulated and persuaded by others.
Brutus finds honor in taking his life when his armies are defeated.
Mark Antony decides to go to war against the conspirators to avenge Caesar.
The audience pities Brutus because he has good intentions but is still defeated.


ANSWER: Brutus is easily manipulated and persuaded by others.

Answers

Answer:

a. Brutus is easily manipulated and persuaded by others.

Explanation:

The statement which gives evidence for Brutus's tragic flaw in The Tragedy of Julius Caesar is: A. Brutus is easily manipulated and persuaded by others.

The tragedy of Julius Caesar.

For this exercise, the statement was adopted from a literary work titled "The tragedy of Julius Caesar" in part 2 and it is a book which illustrated the casual relationship that exist between two characters, Cassius and Brutus.

Based on the The tragedy of Julius Caesar, we can deduce that Brutus is a character that was easily manipulated and persuaded by others.

Read more on Brutus here: https://brainly.com/question/16369202

Who was Dorothea Dix and what was her significance?

Answers

An early nursing pioneer, Dorothea Lynde Dix was a noted humanitarian, reformer, educator and crusader. She is best known for her patient advocacy in fighting to improve the conditions of jails and mental asylums in North America and Europe.

Answer:

Hey mate......

Explanation:

This is ur answer......

Dorothea Lynde Dix (1802-1887) was an author, teacher and reformer. Her efforts on behalf of the mentally ill and prisoners helped create dozens of new institutions across the United States and in Europe and changed people's perceptions of these populations.

Hope it helps!

brainliest pls.....

Follow me! ;)

What was covey supposed to do with Douglass?

Answers

Answer:

He was suppose to get a punishment

Explanation:

Covey orders him to take off his clothes and receive punishment.When Douglass does not respond, Covey rushes at him, tears his clothing off, and whips him repeatedly. Covey continues to whip Douglass almost weekly, usually as punishment for Douglass's supposed “awkwardness.”

Answered by the ONE & ONLY #QUEEN  aka #DRIPPQUEENMO

Hoped this helped!

Describe the scientific and mathematical advances of the Islamic civilization

Answers

Islamic Mathematicians quickly adopt it the Indian system of numerals which we know today as Arabic numerals other contributions included create an algebra , the use of decimals , mathematical induction, and trigonometry , among others.

Triangular trade routes involved shipments of raw materials, finished goods, and enslaved
• American Indians.
• Africans.
• Asians.
Europeans.

Answers

Africans have a nice day (:

Answer:

Africans.

Explanation:

pls help quick im stuck

Answers

The answer to the question is A.
I think it’s supposed to be A

How do the X and Y chromosomes determine if a person is biologically male or female?​

Answers

Answer:

The X and Y chromosomes, also known as the sex chromosomes, determine the biological sex of an individual: females inherit an X chromosome from the father for a XX genotype, while males inherit a Y chromosome from the father for a XY genotype (mothers only pass on X chromosomes)

Explanation:

Hope this helps :)

What country did Hitler first gain control of in his German expansion?

Answers

Between 1921 and 1925 Adolf Hitler developed the belief that Germany required Lebensraum ('living space') in order to survive. The conviction that this living space could be gained only in the east, and specifically from Russia, formed the core of this idea, and shaped his policy after his take-over of power in Germany in 1933.

Answer:

Hitler moved to extend German power in central Europe, annexing Austria and destroying Czechoslovakia in 1938-1939. Other territorial demands followed.Explanation:

Which one of the following is not true concerning the importance of the steam engine?
it led to the development of new means of transportation


It expanded industry


it reduced the need for coal


allowed mills and factories to be built almost anywhere

Answers

It reduced the for coal

6. What year did South Africa first gain self-rule?
1961
1932
1910
7. Why was the African National Congress formed?
To fight for equal rights
To fight for separation of church and state
To help Africa and China join forces

Answers

Answer: 1961, to fight for equal rights

Explanation:

The African National Congress fought towards uniting all ethnicities, groups of people, and races together. They fought for equal voting rights, as well as other rights that improved equality between people.

PLS HELP ME WITH THIS

How did corporations use profits?

gave better employee benefits
gave to charity
bought better equipment and machines
gave money to foreign countries

Answers

Answer:

1 or 2 because corporations always choose between more hours but efficient employees or more non efficient employees but less hours

Answer:

bought better equipment and machines

Explanation:

I have this assignment on odyseeyware Please mark brainliest if this helps

Why are containers important to the shipping industry? What effect do they have?

Answers

They are important because it’s a great way for transporting goods. They brings lots of materials. Since they can vary is size and shape, and carrying capacity, many liner ships are able to transport up to 8K containers of goods and products!
they are important because that are Easy way to transport big goods.

How did conflict develop between Spanish settlers and Native Americans in the Southwest?

Answers

Answer:Conflict developed between Spanish settlers and Native Americans in the Southwest in that the Native Americans began to fight over buffalo herds.

Explanation:Spanish leaders formed alliances with some of the Indian tribes and provided them with tools, crops, livestock, and arms. The new materials available to these tribes gave them superior weaponry over their enemies. As Indians acquired horses, they became more mobile.

Glorieta pass _______

a: is a rugged, difficult place.
b: was located on top of a mesa
c: was a toll road
d: is located in four corners

Answers

A. It’s a rugged, difficult place
Option A-is rugged, difficult place is correct

whats three times three

Answers

Answer:

It's 9. There is a couple of ways you can do this. For instance, try dividing 9 to 3 and the answer is 3. Another way, count to 9 and see how many times you used 3. So that answer will be 3.

Explanation:

This would be 9! If you add 3 + 3 + 3 you get 9 as an easier way!

PLEASE HELP ME I'M BEING TIMED!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! HURY HELP ME ASAP!!!!!!!!!!!!!

In the Jamaica Letter written by Simon Bolivar, he commented that the only acceptable form of government for the colonies of Latin America was a Republic and that in no way should a paternalistic authoritarian government be accepted.

True/False

Answers

True
Just wanted to confirm for you

The Indian Removal Act forced Indians to move where?

Answers

Answer:

Trail of Tears, in U.S. history, the forced relocation during the 1830s of Eastern Woodlands Indians of the Southeast region of the United States (including Cherokee, Creek, Chickasaw, Choctaw, and Seminole, among other nations) to Indian Territory west of the Mississippi River.

Other Questions
April ought some sports drinks and slices of pizza for her friends. She bought 3 more sports drinks than slices of pizza. If her total was $21.25, how many sports drinks did she purchase? (1 sports drink is $1.75, one pizza slice is $2.75){System of Operations} La oracin que representa un smil es: A. . Cerca del Tajo, en soledad amena, B. . Si no regresas pronto a mi lado, morir desangrado C. Los invisibles tomos del aire D. Eres como el viento tibio de los arenale What river connects the Great Lakes to the Atlantic Ocean? Alyssa's mother was sick. Alyssa, went to the store and bought 2/10 pound of medicine, then another 1/10 of medicine. What would the answer be when you add them together? Denominator stays the same. Jeremiah spent $68 for concert tickets. He bought one adult ticket for $18 and several children's tickets for $10 each. Which number line represents the number of children's tickets Jeremiah bought? Someone suggested that everything to be sent to the base on the moon must be sterelized so that no bacteria of any kind are present.Do you think this is a good idea Halfway through the third quarter, how much of the game is left?Write the answer as a proper fraction, View the work of art and answer the questions below.The work above is typically known by the name of its location. What is the name of the structure where the work be found? Who created it? PLEASE HELP WILL GIVE BRAINLIEST!! Please please only answer if you know or can help!! I need help know if what i already put is correct or how i can fix it and also the answer to question E. THANK YOU! When McCandless is working for Wayne Westerberg in Carthage, South Dakota, Westerberg thinks that McCandlessA.is lazyB.is addicted to drugsC.is probably mentally illD.is one of the hardest workers he has ever seenE.is a genius and an artist What is correct regarding trans fatty acids Choose two or three of the characteristics of successful organizations discussed in this article that you feel are the most important and, using specific examples, explain why you feel that way. (Site 1) hi can you please help me with my work Add the two functions. f(x) = 3x3 + 7x 26 g(x) = x + 2 Please help! Thank you! HELP mE need math help 20 points no links or imma report HeLP mE Find the area of the white region in the diagram shown. The sum of three consecutive integers is -27 what is the product of the smallest and largest of the three integers? what is the mRNA in TACCGGATGCCAGATCAAATC? what is (-10,10) if i dilate it by 1/2