Bile juice dose not contain any digestive enzymes yet it is essential for digestion why so ?explain

Answers

Answer 1

Explanation:

Although bile juice does not contain any enzymes, it contains bilirubin and biliverdin. These help to break big fat globules into small globules which is taken to pancreatic juices to be further digested. This is known as emulsification of fat. It also helps in secretion of lipase. Thus it plays an important role because majority of the fat digestion process is carried out by it.

Don't forget to mark the answer as brainliest if it is truly the best! Thank you!


Related Questions

If a vaccine protects you for most of your life against a particular pathogen, why do you need a new flu shot every year? A. Influenza evolves very quickly and its antigens mutate so that your memory cells from the last vaccine won’t recognize it. B. Influenza is so strong that you need a booster every year to make sure your body can fight it. C. Influenza is a virus, and vaccines only generate memory cells for bacterial infections. D. You don’t need it every year, it is just offered every year for anyone who does not have it yet.

Answers

Answer:

If you got a flu shot this year, next year you'll need it again.

Explanation:

This is because the virus changes, usually rendering the previous year's vaccine partly or totally useless. hope this helps you :)

Answer:

A.

Explanation:

Influenza evolves very quickly and its antigens mutate so that your memory cells from the last vaccine won’t recognize it.

The 2020 influenza vaccine was not as efficient because scientists were scrambling to put out a vaccine for Coronavirus. Consequently, Coronavirus cases skyrocketed during the flu season.
Hope this helped!

also.. i have to put coronavirus and not "c0vid-19" because apparently it's too political. lol.

Witch statement correctly compares the “analysis” and “conclusion” section of a lab report

Answers

Answer:

Analysis section of lab report comprises of making comparisons while Conclusion section is used to make further research about the experiment.

Explanation:

Analysis section of lab report comprises of making comparisons between specific data. After knowing the scope and objectives of the experiment, data is collected either by performing the experiment or adopted data from other organization such as hydrological data obtained from hydrological agency, analysis of such data comprises of making comparisons.

While

Conclusion section is used to make further research about the experiment. It is used to report the outcome of the result and also to determine other possibilities of results from the experiment.

answer answer answer answer

Answers

Answer: C

Explanation: Amoeba use pseudopods to move around and people use feet to move.

Answer:

The answer is C

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

Name four breeds of cattle

Answers

Answer:

Black Angus, Red Angus, Holstein, Gelbvieh

Hope this helps!

any 3 communicable diseases,its symptoms,prevention and source.

Answers

Answer:

1) Flu

2) Hantavirus

3)HIV/AIDS

hope it helps you

Explanation:

Examine the following diagram. Place the labeled layers in order from youngest to oldest.

Public Domain

A, B, C, D
C, D, B, A
D, A, B, C
C, B, A, D

Answers

Answer:

C, D, B, A

Explanation:

Got it right on the quiz. Also the definite order would be that D HAS to be before A and B and only the second option has that since C is lava which is the most recent.

Shivering and vasoconstriction would be signaled to cause a: A. increase in pH. B. decrease in temperature. C. decrease in pH. D. increase in temperature.

Answers

Answer:D

Explanation: shivering occurs when someone is cold and vasoconstriction is when the blood vessels close to the skin and the veins closer to the skin surface constrict as a result of dat air doesn’t enter the body

Vasoconstriction is the narrowing of the blood vessels that hinders blood flow. Vasoconstriction and shivering will lead to an increase in the temperature through thermoregulation. Thus, option d is correct.

What is thermoregulation?

Thermoregulation is the maintenance and balancing of the temperature and heat in the body. They are regulated by many factors including shivering and vasoconstriction.

During the vasoconstriction, the blood vessels close to the skin surface close and the body shivers as a result of cold or decreased temperature. This signals the body to increase the temperature so that shivering can be stopped.

Therefore, vasoconstriction and shivering signal the body to increase the temperature.

Learn more about thermoregulation here:

https://brainly.com/question/7450241

#SPJ2

What is another name of molecular biology????

Answers

Answer:

biotechnology

Explanation:

hope it help you

Answer:

biotechnology biotech

biological engineering biological science

The __________ is a layer of cells that surrounds an axon and helps to accelerate the transmission of information. a: soma b: nerve c: myelin sheath d: axon terminal

Answers

Answer:

C: myelin

Explanation:

its the substance that surrounds nerve cell axons

can DNA be extracted from dead cells

Answers

The short answer is yes. Based on your DNA, your body is better suited for some foods than others. This company found that 45% of people’s genes need a high carb diet, 47% need moderate and only 8% need low.

Hope this helped! <3

The narrative point of view in this excerpt allows the
reader to experience
O Rainsford's feelings as he enters the room.
Rainsford's feelings about his host.
Rainsford's impression of the dining room.
O Rainsford's impression of the island.

Answers

Answer:

O Rainsford's impression of the dining room.

Explanation:

Richard Connell's short story "The Most Dangerous Game" revolves around the famed hunter Sanger Rainsford and his change of fortune when he was left stranded in an island famed for hunting humans as a game by the island's barbaric owner General Zaroff.

In the given excerpt, the narrator reveals the "dining room to which Ivan conducted (Rainsford)". The impression that the hall was "of feudal times with its oaken panels, its high ceiling, its vast refectory table where twoscore men could sit down to eat" reveals the outline of the enormous dining hall where Rainsford was conducted to eat with Zaroff. This narrative point of view allows the reader to experience the impression of the dining room.

Answer:

C

Explanation:I took the quick on Ed (:

a) dry apricots are left transferred to sugar solution?

Answers

When dry apricots are left for sometime in pure water, they will swell. Because, water will enter into them through the process of osmosis. Later,when these apricots will be transferred to sugar solution, they will again shrink.

You are given an unknown animal to study in the laboratory. It is long and ribbonlike and appears to have some repeating units. You find it has three tissue layers, it does not have a digestive tract, and it has male and female reproductive structures in the same individual. This animal probably is __________.

Answers

Answer:

I reckon it's a tapeworm.

Explanation:

Answer:

tape worm

Explanation:

tape worm has all of the characteristics that have been described

SIOM CSserials
What has a greater influence on protein levels?
(1 point)
Protein degradation has a greater influence because outside factors like antibiotics can
cause it, and it is difficult to recover from.
O
Protein degradation has a greater influence because they are denatured faster than the cell
can produce them.
mRNA destroyer concentration has a greater influence because it is destroying mRNA before
proteins can even be produced.
mRNA destroyer concentration has a greater influence because mRNA is destroyed right
after the proteins are produced.

Answers

Answer:

mRNA destroyer concentration has a greater influence because it is destroying mRNA before  proteins can even be produced.

Explanation:

Proteins are synthesized from mRNA through the process of translation. mRNAs are first synthesized from a coding DNA template through the process of transcription. Hence, if mRNAs are destroyed, it means proteins will not be synthesized at all.

Protein not being synthesized at all means that mRNA destroyer concentration has a greater influence on protein levels than protein degradation. With protein degradation, not all the protein is degraded at once and some quantity of the protein can still be found, but with mRNA destroyer concentration, no protein can be found at all because it was not synthesized in the first place.

Beyond changes in relationships described above, explain what other characteristics of man changed after the Fall.

Answers

Answer:

The consequences of the fall was man and woman will die man turned to mortal and will turn back into dust. woman would bring children in pain. relationships between husband and wife would be difficult. The ground was cursed labor would be very hard. human was banned from the paradise and the garden. no longer would they enjoy the holiness and justice they had in paradise.

Explanation:

do foxes hunt alone yes or no.

Answers

yes. but occasionally they meet up with their packs during the night

Answer:

yes they hardley ever travel in packs

what are some non examples of hydroshere

Answers

Oceans, lakes, seas, and clouds are examples.

The hydrosphere is made up of all the water on the planet, including the water found below the surface and in the atmosphere. A planet's hydrosphere may be liquid, vaporous, or composed of ice. The three surface water bodies on Earth are oceans, lakes, and rivers.

What are some non examples of hydrosphere?

It comprises all surface waters that are liquid or frozen, groundwater that is contained in soil or rock, and atmospheric water vapor. The hydrologic cycle continuously circulates almost all of these waters. In wells and aquifers, it can also be found underground as groundwater.

Within the hydrosphere, water circulates in a cycle. Clouds contain water that eventually falls to Earth as rain or snow.

Therefore, Rivers, lakes, and seas are where this water gathers. The cycle is then restarted by its evaporation into the atmosphere. The water cycle refers to this.

Learn more about hydrosphere here:

https://brainly.com/question/14686427

#SPJ2

please answer the question​

Answers

Answer:

two of the DNA fingerprint are same when they contain the same nitrogenous bases in the same location of the DNA.

Explanation:

The DNA fingerprint is one of the most important tool as a forensic medicine expert to to form such condition and rule it out to come to a diagnosis.

DNA fingerprint uses the base pair which a different for all the other human beings. Due to this from the blood or other cells of the body there can be an evidence of the person and this is usually done on a comparative basis.

To know more about DNA fingerprint,

what is DNA fingerprinting? - Brainly.in

brainly.in/question/3388325

HOPE IT HELPS!!!

MARK IT BRAINLIEST!!!!

How are the molecules in photosynthesis and cellular respiration similar? Please include descriptions of the molecules

Answers

Answer:

They are similar because they both produce energy but in two different forms.

Photosynthesis- It produces oxygen and G3P, simple carbohydrate molecules that are high in energy and can be converted into glucose, sucrose, or other sugar molecules.

cellular respiration-During cellular respiration, a glucose molecule is gradually broken down into carbon dioxide and water.

They exhibit the same responses, but they do so in reverse. Carbon dioxide and water are converted during photosynthesis into glucose and oxygen. Carbon dioxide and water are produced during respiration in exchange for glucose and oxygen.

What similarity in photosynthesis and cellular respiration?

Energy transformations from one form to another are a part of both respiration and photosynthesis through a sequence of metabolic reactions.

The reactions that are carried out by both processes—which both use and produce ATP—are carried out on membranes and are managed by enzymes.

Light energy is converted by photosynthesis into chemical energy that is stored in glucose, which is then released by cellular respiration to create ATP, the life-sustaining compound.

Therefore, They are similar because they both produce energy, but in two different forms.

Learn more about cellular respiration here:

https://brainly.com/question/28532054

#SPJ2

Metals are useful in industry because they can be shaped without breaking. What is this property of metals called?

Answers

Answer:

malleable ................

Answer:

versatility ductility conductivity malleability

Tara placed a grape in a solution, after sometime she noticed that the grape started to shrink.
a. Name the solution and explain.
b. Then Tara placed the raisin in a solution and noticed it started to swell up. Name the solution and explain

Answers

Answer:

a. Hypertonic solution

b. Hypotonic solution

Explanation:

There are basically 3 types of solutions in biology,

1) Isotonic-Same concentration of solute and solvent inside  the grape and in the solution.

2)Hypotonic solution-More concentration of solvent in the solution than in the grape.

3)Hypertonic solution-More concentration of solvent in the grape than in the solution.

Now,

a. Tara had kept the grape in a hypertonic solution. The solvent will start draining from the grape to equalize the concentrations of solvent inside and outside. So, the grape shrank due to loss of water.

b. Tara kept it in a hypotonic solution. The solvent will start entering the grape to equalize the concentrations of solvent. So, the grape started swelling.

Which structure is located between the trachea and a bronchiole? A. epiglottis B. pharynx C. alveolus D. bronchus

Answers

the correct answer is the bronchus

here are times where you will be provided with BUD dates. When you do not have access to the BUD dates, you will have to determine that date yourself. What is the appropriate BUD date for a water containing oral formulation? Not later than 14 days Not later than 30 days

Answers

Answer:

Explanation: Not later than 14 days.

Beyond Use Date (BUD) is the date after which a compounded sterile preparation may not be stored or transported. This time is calculated from the date of compounding, and it is different from expiration date. This is because the BUDs are assigned with a different approach from those applied to assigning expiration dates to  manufactured drug products. Also, compounded preparations are intended for administration following short-term storage. So, the BUD is the date after which a compounded preparation shall not be  used. A reliable BUD is established to ensure that the preparation  has an accepted quality and purity at least  until the labeled BUD.

BUD is calculated by:

Type of container in which it is packagedHow long the medication will be takenType of drugHow fast is the drug degradatedStorage conditionsDosage of the medicationNature of the drug and its degradation mechanism Potential for microbial proliferation in the preparation

For Nonaqueous Formulation, the BUD is not later than 6 months or the time  remaining until the earliest expiration date of any API (Active pharmaceutical ingredient), whichever is earlier.  

For Water-Containing Oral Formulation, the BUD is not later than 14  days when it is stored at controlled cold temperatures.

For Dermal and Mucosal Liquid, Semisolid Formulations/Water-Containing Topical, the BUD is not later than 30 days.

Which best explains a desirable outcome for energy efficiency? A) a low second law efficiency due to use of a low efficiency furnace B) a high second law efficiency due to use of a low efficiency furnace C) a high second law efficiency due to use of solar panels on the house D) a low second law efficiency due to use of solar panels on the house

Answers

Answer:

C. a high second law efficiency due to use of solar panels on the house.

Explanation:

Second Law efficiency is the rational efficiency that computes the effectiveness of the system relative to its performance. The efficiency measure is the increase in output with the same level of input. Energy efficient system are high second law efficiency. They save electricity and use alternative sources like, solar panels, wind energy and others.

How much time is required for a P-wave to travel 6,000 kilometers?

Answers

Answer:

294.1 minutes

Explanation:

5,882 seconds (98 minutes) to travel 2,000 km.

2,000 x 3 = 6,000

5,882 seconds x 3 = 17,646

(294.1 minutes) to travel 6,000 km

A possible answer to a scientific question that can be tested is a

Answers

The key to a good and manageable investigation is to choose a topic of interest, then ask what is called a “testable question.” Testable questions are those that can be answered through hands-on investigation by the student.

Which would have a bigger effect on an organism, an error during transcription or a point mutation?

Answers

Answer: Point mutation would have a bigger effect on an organism.

Explanation:

Look at the DNA sequence (1st Picture) Which sequence shows a substitution mutation? (2nd Picture)

Also, can you explain how you got the correct answer?

Answers

Answer:

Sequence A

CGTTACTGCAAT to CGTGACTGCAAT

Explanation:

Mutation refers to any change, whether big or small, that occurs in the nucleotide sequence of a DNA/gene. This change can either be caused by replicational errors or induced by mutagens. Mutation can be of different types depending on the effects on the affected organism (mutant).

A substitution mutation is a kind of mutation in which one or more nucleotide base is replaced by another in a sequence. This is the case here as the

original sequence: CGTTACTGCAAT

Mutated sequence: CGTGACTGCAAT

The fourth base, T has been replaced by G in the upper strand of the DNA sequence.

Gene Expression Quick Check

Explanation:

1.DNA and RNA hold the code to create proteins that are the key to gene expression.

2.Endoplasmic Reticulum

3.CGTTACTGCAAT to CGTGACTGCAAT

4.The proteins are expressed differently in each cell.

5.mRNA is translated into amino acids.

Explain how scientific knowledge develops through making observations about the natural world.

Answers

Answer:

Scientific knowledge develops through making observations about the natural world. An observation may generate a scientific question, which may lead to a hypothesis. The hypothesis can be tested through experimentation. The results of experimentation lead to changes in scientific knowledge.

Explanation:

Explain how scientific knowledge develops through making observations about the natural world.  my answers are never wrong trust me

Other Questions
a positive number is 7 times another number if 3 is added to both the numbers then one of the new number becomes 5 by 2 times the other new number what are the numbers Steve wants to change shooting and exposure settings while on his photo shoot. Which camera part will allow him to do that? A. mode selection dial B. eyepiece C. aperture D. internal prism Circle12Circle the most reactive metal in each set.1) Magnesium / Potassium2) Aluminum / Gold3) Cobalt / Cesium / Calcium4) Iron / Titanium / Potassium5) Francium / Lithium / Beryllium Special right triangles The end result of a chemical reaction is always:A. the formation of new kinds of elements.B. the production of water molecules.c. a substance that was not ope of the reactants.aksD. a molecule that does not have an electric charge. Select one aspect or section of the video that caught your attention and summarize the ideas presented by the students and the teacher. Why did this section catch your interest? What information would you like to convey to that student or the teacher about that aspect of the discussion? Which function of a web page relies on responsive web design? Adding extra horizontal scroll Blocking mobile devices from viewing Eliminating extra links Resizing content to fit a screen Given the following three points, find by the hand the quadratic function they represent (0,6, (2,16, (3,33) In the absence of a specific contract provision regarding the details of payment, the UCC provides that payment be made in full:A) within 10 days of the time and place that delivery occurs.B) within 20 days of the time and place that delivery occurs.C) within 30 days of the time and place that delivery occurs.D) at the time and place that delivery occurs. Rewrite the following direct speech to reported speech. Last week a very drunk man got into a bus and sat near a skinny girl. She looked at him with contempt and said " you are very drunk. It is quite distinguish . What will your mom and dad feel when you arrive home like that?" He replied "does your husband sleeping with a dry stick or wht?" ...etc Consider these metal ion/metal standard reduction potentials Cd2+(aq)|Cd(s) Zn2+(aq)|Zn(s) Ni2+(aq)|Ni(s) Cu2+(aq)|Cu(s) Ag+(aq)|Ag(s) -0.40 V -0.76 V 0.25 V +0.34 V +0.80 V Based on the data above, which species is the best reducing agent? Use the sentence to answer the question. Although his younger students greeted the new practice with enthusiasm, the old guard had staked their reputations on the belief in miasmas. What type of connection does the author make between the ideas in this sentence? (1 point) 1) cause and effect 2)description )3problem and solution 4)contrast The average age of a part-time seasonal employee at a Vail Resorts ski mountain has historically been 37 years. A random sample of 50 part-time seasonal employees in 2010 had a mean of 38.5 years with a standard deviation of 16 years. Required:a. At the 5 percent level of significance, does this sample show that the average age was different in 2010? b. Which is the right hypotheses to test the statement?c. What are the test statistic and critical value? Solve the following equations x-1=6/x Which type of rock can be either foliated or non-foliated? A. Metamorphic B. SedimentaryC. Igneous Additional business in the form of a special order of goods or services should be accepted when the incremental revenue equals the incremental costs.A. TrueB. False New Morning Bakery is in the process of closing its operations. It sold its two-year-old bakery ovens to Great Harvest Bakery for $580,000. The ovens originally cost $778,000, had an estimated service life of 10 years, and an estimated residual value of $48,000. New Morning Bakery uses the straight-line depreciation method for all equipment. Required: 1. Calculate the balance in the accumulated depreciation account at the end of the second year. ANSWER QUICKLY PLZZZZZZ ASAP READ QUESTIONS CAREFULLY Question 1(Multiple Choice Worth 3 points)(06.01 MC)Richard's doctor says that he has become obese. What health risks is Richard now facing?Early signs of cardiovascular disease and sleep apneaUnease getting around and breathing difficultiesInsulin resistance and low blood pressureBone thickening and respiratory problems Rules requiring that only English be spoken at a place of work, even when it is not a business necessity to restrict the use of other languages, reflect Group of answer choices