Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

Answers

Answer 1
The answer is DNA I know because I know
Answer 2

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.


Related Questions

An oak tree can be a home for animals like squirrels, birds, etc. as well as provide oxygen for the environment. This is an example of a _____________: the role an organism plays in the environment.
Answer choices:
A. Understudy
B. Lead
C. Niche

Answers

Answer:

C

Explanation:

A Niche is the role an organism plays in its environment.

Answer:

C

Explanation:

Blood has traveled from the heart to the toes. Which describes the next step
of the circulation process?
A. The blood goes back to the heart to get oxygen.
B. The blood releases oxygen on the way back to the heart.
C. The blood goes through the liver to get oxygen.

D. The blood travels to the lungs to get oxygen.

Answers

The blood travels back up to the heart in a vein, APE.X

Ja’ron lives near a river that flows through farmland. He notices that the river has become more polluted over the years. The water that was once clear is now sometimes cloudy and has an unpleasant odor. What is the most likely cause of the pollution in the river? A. heat B. oil and gasoline C. industrial wastes D. pesticides and fertilizer

Answers

Answer: pesticides and fertilizer

Explanation: He lives in an area of farm land so, big crops are grown and to keep the bugs off the plants, farmers use pesticides. Then what happens is when it rains, the excess runs off into the river and pollutes it.

What challenges arise when trying to protect the environment? Select four options.
A)expensive clean energy startup
B)costs threat to the livelihood of many citizens.
C) negative effect on future crop yields
D)expensive to monitor fishing and tourism industries more land available for farming

Answers

Answer:

expensive clean energy startup costs

threat to the livelihood of many citizens

negative effect on future crop yields

expensive to monitor fishing and tourism industries

Explanation:

Answer:

Expensive clean energy startup costs

Threat to the livelihood of many citizens

Negative effect on future crop yields

Expensive to monitor fishing and tourism industries

Explanation:

All of these can affect the PEOPLE  because two include jobs, which is the way people make money, one is the people's homes, were they live, and the other one is negative to companies because they need it to be affordable to continue with it.

Hope this helps comment who said the other answer needs an explanation ;)

explain how gas is changed back into gas when it exits the barrel

Answers

Back in the days gas was Diferente and now u have to pay for it and u have to now put gas in ur car

Why do plants has stalks that hold pollen higher in flowers???

Answers

Answer: A

Explanation: due to gravity and aliens the pollen moves upwards instead of downwards , so taht bees can better access it .

The answer the other guy said is correct

If a new species of honeycreeper were discovered, and it had a short, straight beak, which bird in this puzzle would likely be its closest living relative?

Answers

Answer:

The bird species that share the closest phenotypic characteristics are likely closest relatives.

Explanation:

Evolution theory states that species evolve gradually trough mutations (many of them are neutral), thereby those honeycreeper populations closest are more likely to share phenotypic features with each other.

Answer:

Po'oull

Explanation:

Which situation is an example of nonnative species introduction?

A huge volcanic eruption in Washington destroyed many habitats.
A large oil spill in the Gulf of Mexico killed many organisms that lived there.
Horseshoe crabs in the waters of Virginia have been overfished, and their numbers have declined.
Water hyacinths from Asia now grow in the United States and are crowding out animals and other plants.

Answers

Answer:

D.

Explanation:

Nonnative species is defined as the introduction of an alien species, foreign species or exotic species to a new region and affect the native species.

The exampe of nonnative species is introduction of water hyacinths from Asia in the United States which is affecting the native species and making the ecosystem crowdy.

Introduction of non-native species can disturb the balance of an already-established ecosystem by the native species including plants and animals.

Hence, the correct option is D.

Answer:

D

Explanation:

HELP.. _____ immunity occurs when a person's immune system responds to an
antigen.

Answers

Answer:

Adaptive immunity occurs when a person's immune system responds to an antigen.

Explanation:

How does your heart rate affect the rate at which red blood cells travel throughout your body? PLEASE HELP ME QUICK!!

Answers

Answer:

with each heartbeat,the heart pumps blood throughout our bodies,carrying oxygen to every cell,after delivering oxygen the blood returns to the heart the heart then sends the blood to the lungs to pick up more oxygen.

Which of the following year graphs represent hours of daylight and solar energy at 45° S?

Answers

Answer:

The answer is D

Explanation:

Each gene in a cell's DNA codes for a specific protein. True of False

Answers

Answer:

True

Explanation:

Answer:

true

Explanation:

The genome of an organism is inscribed in DNA, or in some viruses RNA. The portion of the genome that codes for a protein or an RNA is referred to as a gene. Those genes that code for proteins are composed of tri-nucleotide units called codons, each coding for a single amino acid.

explain the difference between weathering and erosion? how is deposition also involved in this three step cycle?

Answers

Answer:

Erosion is the process by which natural forces move weathered rock and soil from one place to another. ... Deposition occurs when the agents (wind or water) of erosion lay down sediment. Deposition changes the shape of the land. Erosion, weathering, and deposition are at work everywhere on Earth

Explanation:

because thanos said so

Indica que nivel de organización representa cada uno de los siguientes elementos ADN estómago neurona electrón átomo de oxígeno, agua, ser humano, músculo cardíaco, óvulo y sangre.

Answers

Answer:

Neuron-  the level of organisation is cells.Because it s the functioning unit of nervous system.

The Blood's level of organisation is  tissues because if is made of group of cells.

The stomach level of organisation is organ, because it is made up of group of cells and tissues to form part of the digestive system.

Heart muscles is made up of organs as it is the combination of tissues and cells therefore a muscular organ,

DNA -represents a molecular level,but because it is located in the cells , its represented this level.

Egg belongs to level of organisation which is cellular.

Oxygen atom level of organisation is.(cell)

water is a Compound.( tissues )since it is the combination of two atom cells( hydrogen and Oxygen)

Human being is organism.

electron level of organisations are the smallest particles.(cells)

Explanation:

Which represents a force pair?

A. A golf club hits a golf ball. Gravity pulls the ball back down to Earth.
B. A book pushes down on a table, and gravity pulls the book toward the floor.
C. A boy's foot pushes down on a bicycle pedal. The pedal pushes up on his foot.
D. A person's foot pushes on the floor, and the person's weight pushes on the floor.

Answers

Answer:

a

Explanation:

Answer:

I'm pretty sure its either A or D.

Explanation:

in The US- Which states had the darkest skies

Answers

Answer:

The Cosmic Campground, New Mexico

Explanation:

It's THE darkest place in the United States, located in the Gila National Forest in New Mexico

For 15 points

What 10 good ideas would you give to improve a zoo. Explain each with a sentence.

How are oxygen and carbon connected through the atmosphere, geosphere, and hydrosphere. Give an explanation of how a plant might use all three spheres

Answers

Answer:

Explanation:

To preserve Zoological garden expertise are needed to manage the creatures that are there.

Good and conducive environment should be provided for the animals.

Routine cleaning to avoid outback of diseases

Adequate resources should be provided this include food to avoid eviction of important species.

Geosphere is made up of the crust they form the layer of soil that support growth of plant and also supply nutrients.

Atmosphere is made of gas some of which help sustain life. Example is oxygen, carbon dioxide

Hydrosphere form the liquid portion of the earth it included large water bodies that serves as habitat for aquatic organism.

Oxygen and carbon are been released into the atmosphere where they are been taking up by plant or animal dead and remains of this organism lead to the release of this gases in both organic and in organic form back into the soil where it is taken up by plants back into the atmosphere and some are washed in the water bodies.

Plants takes in carbon-dioxide from atmosphere, absorbs nutrients from the soil through their root and water from the water table needed fro their growth.

What is a human genome sequence?

Answers

Answer:

The human genome is the complete set of nucleic acid sequences for humans, encoded as DNA within the 23 chromosome pairs in cell nuclei and in a small DNA molecule found within individual mitochondria. These are usually treated separately as the nuclear genome, and the mitochondrial genome.

Herbicides and insecticides can be bad for the environment. Insecticides could harm beneficial insects like bees, and both herbicides and insecticides can contaminate nearby rivers and streams.

What are some of the possible environmental benefits of GM crops?





What are some of the possible environmental problems that can be caused by GM crops?




What are some of the potential risks to humans and animals that eat GM crops?

Answers

Answer:absolutely

Explanation:

Not

Why does the amount of energy DECREASE as you move up the pyramid?


It is absorbed by the sun


It is lost as heat


The animal vomits part of it's food

Answers

The correct answer to this question is the 1st one

blood type can receive Rh+ or Rh- blood

Answers

Answer:

People with Rh- blood can give blood to both Rh- and Rh+ recipients. However, those with Rh+ blood cannot give to Rh- recipients. If a person receives blood from someone with an incompatible blood type, it can cause a life threatening immune system reaction.

Answer:

Have a nice day.

Explanation:

Which of the following infectious disease agents is the smallest? A Bacteria B Virus C Fungus D Parasite

Answers

Answer:

B. Virus

Explanation:

With the exception of Virods and Prions, viruses are the smallest infectious disease agents.

After viruses, bacteria are the smallest, then fungi, and lastly parasites.

Answer:

virus

Explanation:

31. The type of immunity that occurs when the body makes its own
antibodies is __________ immunity

Answers

Answer:

passive immunity is the type of immunity inborn

Giving Brainliest to first correct and logical answer.

Explain why Calix having X chromosomes from his mother AND father meant chromosomal rearrangement was not the cause.

Answers

Answer:

Chromosomal rearrangment was not the cause because it wouldn't lead the mass of DNA per cell in Calix to appreciate by 40fg. It also wouldn't explain how he ended up with an additional sex chromosome altogether.

Explanation:

Chromosomal rearrangement occurs when one chromosome receives additional DNA while a different chromosome is missing DNA.

Keith and Marsha's only child to have a carrier genotype, Jeff, did marry. Cedric remained single due to poor health, and Nita swore off marriage after several bad relationships. Jeff and his wife Adrienne had four children, Angela, Keith, Joyce, and Denise. Although the parents were not expecting it to happen, their only son and their second born girl were born with sickle cell disease. Post- pedigree questions: If you were Ketih and Marsha's genetic counselor, what would you tell them? _____________________________________________________________________________________ Which of the Jackson's grandchildren are definitely carriers? _____________________________________________________________________________________ What is Adrienne's genotype? ________________________________

Answers

Answer:

Answer to Question 1:

Sickle cell anemia is a recessive disorder. The fact that one of their children is a carrier means that either of Keith and Marsha is a carrier ot it might be that both of them are carriers of the disease.

Answer to Question 2:

The other two kids of Jeff and Adrienne who don't have the genetic disease are still carriers of sickle cell anemia.

Answer to Question 3:

Adrienne is a carrier of the sickle cell anemia disease as well, just like Jeff.

Hope that answers the question, have a great day!

Which traits would Aristotle have used to classify sharks? Choose more than one answer.

Answers

Answer:

The main trait that was different between sharks 14 and 9 was that shark 14 (Mobulidae) has a front with two points that look like horns, whereas shark 9 (Dasyatidae) has a front with no points that look like horns.

Explanation:

The traits that Aristotle would have used to classify sharks are :

Front with points ( hornlike )Front without points

Sharks classification

Sharks whose front have two points like horns are classifed by Aristotle as sharks 14 (Mobulidae). whlie sharks whose front does not have two points like horns are classifiesd as sharks 9 ( Dasyatidae ). hence the traits that would have been used by Aristotle to classify sharks is the presence of points at the front.

Hence we can conclude that the traits that Aristotle would have used to classify Sharks are Front with points and front without points.

Learn more about Shark clasification : https://brainly.com/question/25619446

Select the correct answer.
which tissue is most likely to transport dissolved sugar?
A. sclerenchyma
B. collenchyma
C. parenchyma

Answers

Answer:

C. parenchyma

Explanation:

100%

hopes this helps.

Choose an organism to use as an example.


Describe the organisms reproductive strategy:



discuss how this strategy is an adaptation for this organism:

Answers

Answer:

I will go with sponges :)

Sponges reproduce asexually. The parent begins budding, when the buds grow to a certain point, they break off and drift with the oceans current to a new place, settle down into the sand or rocks, and start the cycle all over again. Since sponges are stationary organisms (meaning that they cannot travel on their own.) They rely on the oceans current to spread their species across the oceans.

Answer:

I would do a Moon Jellyfish

Explanation:

Moon jellyfish reproduce during two different stages in their life cycle. During the medusa stage, they reproduce sexually by releasing sperm and eggs into the water. The method of reproduction used by jellyfish polyps is known as budding, and it does look like a plant growing a new bud for a flower. The polyp essentially clones itself. The clone buds out of the original polyp and detaches to float freely in the water.

Red squirrels and gray squirrels have been the native species on an island for many years. A few years ago, black squirrels entered this island. The black squirrel is an invasive species. Invasive species aren't native to the ecosystem. They move into an ecosystem because of natural changes or human intervention. Red squirrels and black squirrels have identical food requirements, but gray squirrels have a different diet. What three effects will these events have on the island's squirrel population?

Answers

Answer:

1. There will be direct predation of species.

2. There will be competition for limited resources like breeding sites, prey.

3. Transmission of diseases or they can cause danger to the native species.

Explanation:

Invasive species are species of organisms that are not natural to an ecosystem and move to an ecosystem because of natural changes and human intervention. Islands are prone to the invasion of invasive species because they don't have predators and there is no competition that control populations in their ecosystem. The invasion of black squirrels will lead to competition for limited resources like breeding sites or prey, the black squirrels will begin to predate other squirrels because they have different nutrients requirements and they can transmit diseases to other squirrels if they are carrier.

Answer:

B C D

Explanation:

GOT IT RIGHT ON PLATO

Which of the following are examples of short-term, human-induced environmental changes? Select three answer choices.

mass extinction
global warming
deforestation
ozone layer destruction
pollution

Answers

Answer:

deforestation

pollution

mass extinction

Explanation:

all three caused by humans

Answer:

mass exinction, deforestation, pollution

Explanation:

Other Questions
Answer Choices:y= x + 10; lineary= x + 10; non lineary= 10x + 1; lineary= 10x + 1; nonlinear I'm confused, I don't know how to write a full commentary sentence for an essay. Please help the atlantic ocean is 2.7810^4 feet deep at it's lowest point. If a scuba diver dives 1/50 of the total depth of the ocean, enter how many feets he dove down? Triad 1930 Piet Mondrian What is the color scheme demonstrated in this painting? What perspective is demonstrated? Please write the linear equation when m=30 and b=20 what is the value of x and y Which genotype represents a female carrier?XHXhXHYXHXH Captain Nadia has a ship, the H.M.S Crimson Lynx. The ship is two furlongs from the dread pirate Tiffany and her merciless band of thieves.If her ship hasn't already been hit, Captain Nadia has probability \dfrac{1}{2} 21 start fraction, 1, divided by, 2, end fraction of hitting the pirate ship. If her ship has been hit, Captain Nadia will always miss.If her ship hasn't already been hit, dread pirate Tiffany has probability \dfrac{2}{7} 72 start fraction, 2, divided by, 7, end fraction of hitting the Captain's ship. If her ship has been hit, dread pirate Tiffany will always miss.If the Captain and the pirate each shoot once, and the Captain shoots first, what is the probability that the Captain misses the pirate ship, but the pirate hits? From a class of 25 students how many group of 4 Please Help!!! As quickly as possible!!! Which body system is an important place for mineral storage, gives us support and structure, and provides a place for muscle attachment? A)digestive B)muscular Eliminate C)nervous D)skeletal omar is photographing a ladybird in his garden and he wants a shallow depth of field for his shot. What type of f-stop setting should he use?A. fasterB. slowerC. largerD. smaller What is the value of the expression (5) -3 but the -3 is an exponent. . Oregon State University President Ed Ray has stated, "It never matters how small or big the impact is, its about doing the right things for the right reason." Based on this quote alone, would you say that President Ray subscribes to a deontological, utilitarianist, or virtue ethics approach to ethical decision making? Describe in detail the approach you selected and then explain why you feel this ethical approach best fits with President Rays quote. Who won the Peloponnesian War? How did they win? The right to keep and bear arms is found in which amendment?FifthTenthSecondFirst Which algebraic expression is equivalent to this expression?5(3x+2)+18 Please help ASAP! I will mark Brainliest! Please answer CORRECTLY! No guessing! WILL GIVE BRAINLIESTThe most important problem in Africa today is:tribalismeducationslavery How does saving money help people avoid debt?A.by helping them reduce interest paymentsB. By helping them get approved for loansC.by helping them apply for credit cardsD. By helping them cover unforeseen expenses