It corresponds to the formula of an acid oxide and a basic oxide:

Select one:

A. P2O3 y BaO
B. Mag y N2O5
C. FeO Y SO3
D. HNO y CaO

Answers

Answer 1

Answer:

P2O3 y BaO

Explanation:

The oxides of the main group metals are basic in nature. They form alkaline solutions when dissolved in water. Similarly, the oxides of main group non metals form acidic solutions when dissolved in water.

P2O5 is an oxide of a main group nonmetallic element in group 15. We expect this oxide to be acidic and form acids when dissolved in water as expected from the chemistry of the group.

Also, BaO is an oxide of barium, a group two main group metal. Hence we expect this oxide to be basic in nature and form alkaline solutions.


Related Questions

Which pairings match protozoa with the structures they use to move? amoeba: flagellum; euglena: cilia; paramecium: pseudopod amoeba: pseudopod; euglena: flagellum; paramecium: cilia amoeba: flagellum; euglena: pseudopod; paramecium: cilia amoeba: pseudopod; euglena: cilia; paramecium: flagellum

Answers

Answer:

The correct answer is -  amoeba: pseudopod; euglena: flagellum; paramecium: cilia

Explanation:

Protists use different type of structures for their movement known as pseudopods, flagella, and cillia.

Pseudopods are the structures found in amoeba in which flowing of protoplasm moves the amoeba forward.

A euglena moves by strikes or whip its flagellum, that is a long appendages, like propeller of a helicopter.

Cilia are thin, very small tail-like structure that stretched outward from the of body of paramecium.

Thus, the correct answer is -  amoeba: pseudopod; euglena: flagellum; paramecium: cilia

During which stage of cellular respiration is glucose broken down into two molecules of pyruvic acid?

Answers

Answer: Glycolsis

Glycolysis happens in the cytoplasm of the cell. Afterwards, in the presence of Oxygen, the two molecules will undergo pyruvate oxidation in the mitochondrial matrix.

what is the body structure for chemical levels?

Answers

Answer:

Cellular, tissue, organ, organ system, and the organism level.

Explanation:

pros and cons of genetically modifying the animals people eat? ​

Answers

Answer:

Explanation:

   GMOs are food items that have been made using genetic engineering techniques. ...

   GMO foods are easier and less costly for farmers to grow, which makes them cheaper for the consumer. ...

   The main concerns around GMOs involve allergies, cancer, and environmental issues — all of which may affect the consumer.

The advantages include improved human health, increased food production, reduced environmental impact, and so on. There is a risk that new diseases originating in genetically engineered animals will be transmitted to non-genetically engineered animals, including humans.

What is genetic engineering?

Genetic engineering (also known as genetic modification) is a process that uses laboratory-based technologies to alter an organism's DNA makeup.

This could be as simple as changing a single base pair (A-T or C-G), deleting a region of DNA, or adding a new segment of DNA.

Gene therapy aims to modify genes in order to correct genetic flaws and thus prevent or cure genetic diseases. The goal of genetic engineering is to modify the genes in order to improve the organism's capabilities beyond what is normal.

The benefits include improved human health, increased food production, and reduced environmental impact, among other things. There's a chance that new diseases originating in genetically engineered animals will spread to non-genetically engineered animals, including humans.

Thus, these are some pros and cons of the genetically modified animals.

For more details regarding genetic engineering, visit:

https://brainly.com/question/13491558

#SPJ2

Please help me...
Blonde hair (represented as b) is a recessive trait. If Julie has blonde hair, which of the following could have been her parents' genotypes?
A. Bb, bb
B. BB, bb
C. BB,BB
D. Bb,BB

Answers

I think its Bb, bb because if julie has blonde hair then it's most likely to be Bb, bb

If Julie has blonde hair, the genotypes of their parents could have been found to be Bb and bb. Thus, the correct option for this question is A.

What do you mean by Genotypes?

Genotypes may be defined as the ultimate combination of alleles of those genes which are selected for specific studies in order to express some genetic characteristics.

According to the context of this question, if the trait of Blonde hair is recessive in nature. This means that both the alleles of this gene are recessive, i.e. bb.

Now, if Julie has blonde hair, which means both alleles are recessive. So, the genotypes of parents of Julie are either homozygous recessive or heterozygous in nature. This characteristic is well determined by option 1.

Therefore, if Julie has blonde hair, the genotypes of their parents could have been found to be Bb and bb. Thus, the correct option for this question is A.

To learn more about Genotypes, refer to the link;

https://brainly.com/question/902712

#SPJ2

The destruction of an organism's habitat either through human impact or natural causes, such as a fire or flood, increases the likelihood that an organism could become extinct. Which of the following could also increase an organism's chances of extinction? A. an increase in predation, competition, and/or disease B. a lack of genetic diversity in an organism's species C. the inability to reproduce D. all of these

Answers

Answer:

D

Explanation:

all of those are likely to increase an organisms chances of extinction

Bears eat berries, humans, and large fish; large fish eat smaller fish and insects; humans eat bears, large fish, and berries; Venus flytraps eat insects. The scenario described here is an example of ______.

Answers

Food webs show how food chains are connected and what an ecological group eats. Therefore, this scenario represents a food web.

What is a food web?

An ecological community's food web is a graphical representation of the natural connectivity of food chains as well as the question of what consumes what in that community. The term "consumer-resource system" is another name for the "food web."

There are often two distinct kinds of food webs present in an ecosystem: a grazing food web that is supported by photosynthetic plants or algae, and a detrital food web that is supported by organisms that decompose dead matter (such as fungi).

Learn more about food web, here:

https://brainly.com/question/2233704

#SPJ6

Explain the importance of neem, turmeric and blue green algae in agriculture

Answers

Answer:

Blue green algae are used to prepare bio fertilizers  .Neem leaves are used in grain storage as bio pesticides . Turmeric is used in grain storage as bio pesticides  .

Hope this helps.....

Pls mark my ans as brainliest

If u mark my ans as brainliest u will get 3 extra points

Answer:

The answer is

Explanation:

Blue green algae is used in farming.

Which state of water concentration is healthiest in an animal cell?
A. Isotonic
OB. Hypertonic
C. Equitonic
D. Hypotonic

Answers

Answer:

D. Hypotonic

Explanation:

Answer:

C. Isotonic

Explanation:

i took the quiz and its right

A garden has a length of 1.5 x102 m and a width of 0.5 x 102 m. what is the area of the garden?

Answers

Answer:

7.5 × 10^3 m^2

Explanation:

The garden described in this question takes the shape of a rectangle, which has a length of 1.5 x102 m and width/breadth of 0.5 x 102 m.

To calculate the area, we use the formula for calculating the area of a rectangle, which is;

Area = length (L) × width (w)

Area = 1.5 x102 m × 0.5 x 102 m

Area = 150 × 50

Area = 7500

This, the area of the garden is 7500m^2 or 7.5 × 10^3 m^2

1.What is meant by Plasma therapy ? Is it a remedial treatment for Coronavirus? Express your answer with valid points

Answers

Answer:

It is a therapy that involves the use of plasma from recovered patients (which is composed of antibodies against the virus)

Explanation:

The immune system of patients already recovered from viral diseases naturally generates defensive molecules that circulate in the blood. These molecules are known as 'antibodies', and they are localized in the plasma of the blood, which is composed of coagulation factors, albumin, fibrinogen and, of course, antibodies. These antibodies bind to specific viral antigens in order to promote their neutralization and destruction. In consequence, the plasma from recovered patients contains particular antibodies that may be used to treat specific diseases.

A scientist is conducting research about all the plants and wildlife in the Mojave Desert as well as the desert’s resources, such as water and soil. The scientist is studying
a community.
a population.
a species.
an ecosystem.

Answers

Answer:

an ecosystem. I got it right on edge 2020.

Explanation:

A scientist is conducting research about all the plants and wildlife in the Mojave Desert this scientist is studying an ecosystem.

What is the ecosystem?

An ecosystem is a set formed by the interactions between biotic components, such as living organisms: plants, animals and microbes, and abiotic components, chemical and physical elements, such as air, water, soil and minerals.

Broad categories of terrestrial ecosystems are called biomes. In ecosystems, matter and energy are conserved.

See more about ecosystem at brainly.com/question/13979184

A researcher wants to introduce the human gene encoding tissue plasminogen activator (used to dissolve blood clots) into a mammal so that the protein will be secreted into the milk of the mammary gland. For the researcher to succeed, the gene should be:

Answers

Answer:

In the given case, for the researcher to succeed, there is a need to place the gene next to the promoter sequence, which gets expressed in the mammary cells. The sequences of DNA, which illustrate that where the transcription of a gene by the RNA polymerase initiates is known as the promoter. These sequences are generally situated at the 5 prime terminals of the initiation site of transcription or are situated directly upstream.

“Science is a beautiful gift to humanity ; we should not distort it.”-A.P.J. Abdul kalam.

How does the quote you chose relate to your ideas about the importance of studying science?

Answers

It is a wrong quote. Science is supposed to keep changing as we find new information and discover that our previous theories were wrong.

What concept from microbiology is the most challenging and why? What can you do to learn more about this concept as you progress through nursing program and career?

Answers

Answer:

The overview of the particular topic is discussed in the section through the below clarification.

Explanation:

Microbiology seems to be the branch of philosophy that deals with some really small sentient creatures like bacteria as well as about there impact on human health. The profession deals with the analysis, component, as well as classification of such species, including to exploit as well as regulate their transactions.Nevertheless, their using it as manufacturing applications is usually a complex idea of microbiology. To understand everything concerning this idea, you will concentrate on several aspects of biotechnology to properly appreciate how would control micro-organisms to generate valuable material.

please answer fast
difference between fish and frog on the habitat and structure of heart

Answers

Answer:

the answer is this

Explanation:

hope this help

good luck for your homework

"Wow! This rose bush is doing so much better on this side of the house than
on the other side. I wonder why that is?"

Answers

East or South side is best

Explanation:

Roses do best in full sun and morning sun is the best place. so always plant roses the along an east wall or south side of your home

One of the needs of today's taxonomy is:

O more information

O more species

O more interpretation

Ofewer species

Answers

Answer:

The correct choice is A

Explanation:

Taxonomy is the process of coining names for and categorising plants and animals into groups based on factors or qualities which are similar and or those which distinguish them.

Taxonomy helps to give meaning to the vast diversity of fauna and flora on planet earth.

Cheers!

Answer:

The answer is A

Explanation:

You can tell because the way that it is

How much time is required for a P-wave to travel 6,000 kilometers?

Answers

Answer:

294.1 minutes

Explanation:

5,882 seconds (98 minutes) to travel 2,000 km.

2,000 x 3 = 6,000

5,882 seconds x 3 = 17,646

(294.1 minutes) to travel 6,000 km

Suppose you take glycine tRNA and modify it so that the glycine is changed to valine. You then find that the amino acid sequence in the generated proteins does not show the expected change. This result would suggest that the protein synthesis machinery recognizes the _______ and is _______ with what was actually found by researchers.

Answers

Answer:

Suppose you take glycine tRNA and modify it so that the glycine is changed to valine. You then find that the amino acid sequence in the generated proteins does not show the expected change. This result would suggest that the protein synthesis machinery recognizes the tRNA anticodon and is congruent with what was actually found by researchers.

Explanation:

A group of researchers led by Seymour Benzer demonstrated that the anticodon of the charged tRNA was recognized by the protein synthesis machinery, when they changed the amino acid sequence. This example shows the exact result as found by the researchers.

"When human settlers arrived on the island of Mauritus, they caused the Dodo bird species to become extinct within 50 years. What did the settlers do to cause their extinction?"

Answers

Answer:

It's commonly believed that the dodo went extinct because Dutch sailors ate the beast to extinction after finding that the bird was incredibly easy to catch due to the fact it had no fear of humans.

Explanation:

A possible answer to a scientific question that can be tested is a

Answers

The key to a good and manageable investigation is to choose a topic of interest, then ask what is called a “testable question.” Testable questions are those that can be answered through hands-on investigation by the student.

Which kind of research is most likely to improve the health of the
environment?

Answers

Answer:

The environment   play a role in people mental and physical being.

Explanation:

Environment  quality and human health  remain factors and taking into multiple interactions economic and cultural context.

Environment through air pollution, chemicals, poor quality water and natural area loss, increase in rates obesity, diabetes, and diseases.

Environment factors are particular matter, environmental tobacco smoke leading,and indicative ranking of environmental impacts of health.

Environment across depend on the pressures relate to pollution and natural resources,pollution reduction and the natural environment distribute populations.

Environmental quality can be policy and population group, incomes, elderly and the educational status, environment burden they focus on health and complex causal path.

What process is similar in function to genetic engineering but different in the mechanism it uses? A. Replication in a bioreactor B. Cellular Respiration C. Breeding for specific traits D. Genetic Calculus

Answers

Option C. Breeding for specific traits is a similar process in function to genetic engineering but different in the mechanism it uses.

Genetic engineering refers to the process of using recombinant DNA methodologies to alter the genome of a particular organism and thus obtain the desired characteristics/traits in organisms derived from them.

An example of genetic engineering is the use of recombinant DNA methodologies to develop Escherichia coli strains that generate human insulin.

Moreover, selective breeding refers to the process aimed at developing organisms with desirable characteristics by choosing parents with these traits in order to cross them and produce offspring with these phenotypic traits.

For example, wheat plants with better yields can be obtained by crossing between wheat varieties that exhibit desired phenotypic traits.

In conclusion, Option C. Breeding for specific traits has a similar objective that genetic engineering but the mechanism to reach this objective is different.

Learn more in:

https://brainly.com/question/5757079?referrer=searchResults

answer it answer it .

Answers

Answer:

Pseudopodia

Explanation:

Human uses his legs for locomotion and movement similarly in amoeba pseudopodia is used for movement in amoeba and other unicellular organisms. Pseudopodia is a structure in amoeba which is used for movement and locomotion in amoeba and it is also used for engulfing food, amoebic movement is also considered as a protoplasmic movement.

Answer:

c

Explanation:

nkjbhvcgfxdsftgjkhvghcfgvhjvgc ghuvg

Which term refers to all areas of Earth where life exists?
biosphere
biome
community
ecosystem

Answers

Biosphere! Your welcome:)

The term that used to represent the land, water, surface and atmosphere of the whole planet where life exists is called the biosphere. So option A is correct.

What is the biosphere?

Multiple species make a population, population makes a community, the community makes an ecosystem, ecosystem makes a biome, and biome makes a biosphere.

The biospheres can be classified as:

Lithosphere: It consists of the land part of the earth. The lithosphere comprises plains, plateaus, mountains, etc.

Hydrosphere: The water constituent of the earth forms the hydrosphere. It includes rivers, oceans, lakes, ponds, etc.

Atmosphere: The air surrounding the earth comprising of varying gases forms the atmosphere of the earth.

So biosphere is the largest unit of ecology which include the whole planet like earth in it. So option A is correct.

Learn more about ecology, here:

https://brainly.com/question/13046612

#SPJ5

Some food material is given
below. What are the diffrent
possible ways of cooking them?
Find out and write them.
Meat - Groundnuts - Potatoes
Spinach​

Answers

Answer:

Meat-Boiling, Grilling, frying and roasting

Groundnuts-frying,boiling

Potatoes-Boiling frying and roasting

The theory of plate tectonics is supported by _______. The Eurasian and African plate are pushed away from the North and South American Plates at the _______. _______ is where rocks are carried back into the mantle of the earth. _______ iron can be magnetized by the magnetism of the earth. Subduction of the ocean floor occurs in _______. Respond to the following based on your reading. Why have rocks older than 200 million years never been found in the oceans? Explain how the movement of tectonic plates is responsible for this recycling of the ocean floor.

Answers

Answer:

1. ridges and trenches (either answer is acceptable)

2. mid-atlanitc

3. subduction zone

4. molten

5. oceanic trenches

Explain:

6. Rocks in the ocean eventually get subducted back into earths mantle due to slab pull. New rocks form at mid-ocean ridges as ridge forces two plates to diverge.

1. ridges and trenches (either answer is acceptable)

2. mid-atlanitc

3. subduction zone

4. molten

5. oceanic trenches

Explain:

6. Rocks in the ocean eventually get subducted back into earths mantle due to slab pull. New rocks form at mid-ocean ridges as ridge forces two plates to diverge.

Explanation:

1.What is the Independent Variable?
5 points
Connor and Miguel want to investigate if the type of
fertilizer changes the color of their hydrangea flowers.
They select 10 hydrangea bushes and plant them in the
same yard with the same type of soil. Every bush gets 3
cups of fertilizer, but each receiving a different brand.
One bush gets no fertilizer. All bushes receive morning
sunlight and no afternoon sunlight. All bushes are watered
the same amount every other morning. After four weeks,
the boys observe the color of the blooms on each bush.
the bush
the soil
the fertilizer
the color of the plants

Answers

Answer:

the type of fertilizer

Explanation:

because independent variable is something that effects that the whole outcome of the experiment and here the type of fertilizer chosen is going to be the thing that is going to effect the ending result

What are the uses of the whorls of the flower ​

Answers

Answer:

The outermost whorl of the flower has green, leafy structures known as sepals. The sepals, collectively called the calyx, help to protect the unopened bud. The second whorl is comprised of petals—usually, brightly colored—collectively called the corolla.

Other Questions
What is the responsible estimate of 6207 divided 214 Maurer, Inc., has an odd dividend policy. The company has just paid a dividend of $2 per share and has announced that it will increase the dividend by $6 per share for each of the next five years, and then never pay another dividend. If you require a return of 12 percent on the companys stock, how much will you pay for a share today HELP ME!!!!And I mark as BRAINLIESTmake sure show proper working Anyone the answers? Please help Last Sunday, the average temperature was 8\%8%8, percent higher than the average temperature two Sundays ago. The average temperature two Sundays ago was TTT degrees Celsius. Which of the following expressions could represent the average temperature last Sunday? Find an equation of the plane through the point(1, 5,-1) and perpendicular to the vector (1, 5, 1). Do this problem in the standard way. Solve for x: 2(10-2x) = 4(3x + 1). Write your answer as a fraction. can u help me ASAP. i need to know how to do it step by step the formula s= I dont know how to type that but I really need helppppp Pasteur's experiments proved that ________. Pasteur's experiments proved that ________. spontaneous generation can only occur if nutrient broth is left open to the environment cells cannot survive in swan-necked flasks preexisting cells present in the air can grow in sterilized nutrient broth sterilizing nutrient broth prevents spontaneous generation in order to grow, cells need to be supplied with oxygen please help !!!!! please note that two images are there................ i am urgently needs this question On a plane trip, baggage over 40 pounds ischarged at the rate per pound of 1% of the one-way fare. The charge for a bag weighing 52pounds on a trip where the one-way fare is $98is:HELP PLEASEE!! QUICK!! When the hydraulic conductivity Ks = 10 mm/hr; effective matrix potential Ns = 20 mm, and rainfall intensity I = 30 mm/hr , determine the amount of runoff generated when the runoff rate reaches 15 mm/hr?( 2.7 mm or 0.21 mm or 18 mm or 0.67 mm) PLS HELP ASAP Solve the inequality and enter your solution as an inequality in the box below 8>4-x>6 difference between photosynthesis and respiration In a survey of adults in a certain country conducted during a period of economic uncertainty, % thought that wages paid to workers in industry were too low. The margin of error was percentage points with % confidence. For parts (a) through (d) below, which represent a reasonable interpretation of the survey results? For those that are not reasonable, explain the flaw. how many are 2 raised to 2 ??? Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG This rectangular patio is tiled using 50 cm by 50 cm square tiles. How many tiles are used? Imagine that you are the supply chain manager for the Magic Widget company and you need to measure your supply chain performance. The chart shows the financial variables that you will need to perform your task. Financial Variables Total Assets (in $ billions) 15.1 Cost of Goods Sold (in $ billions) 14.3 Inventory: Raw Material Inventory (in $ billions) 0.76 Work-in-progress Inventory (in $ billions) 0.12 Finished Goods Inventory (in $ billions) 0.82 Compute the percentage of assets committed to inventory and inventory turnover.