Read the excerpt from The Giver and answer the questions that follows.
Jonas, nearing his home now, smiled at the recollection. Thinking, still, as he wheeled his bike into its
narrow port beside the door, he realized that frightened was the wrong word to describe his feelings, now
that December was almost here. It was too strong an adjective.
He had waited a long time for this special December. Now that it was almost upon him, he wasn't frightened,
but he was... eager, he decided. He was eager for it to come. And he was excited, certainly. All of the
Elevens were excited about the event that would be coming so soon.
What is the meaning of eager as it is used in the excerpt?
distracted by another thought
o careful about approaching something
O looking forward to something
o worried about the future

Answers

Answer 1

Answer:

so i read this in 7th grade i think but im in 9th now but im pretty sure that its either c or d but im leaning more to c

Explanation:


Related Questions

Refer to Explorations in Literature for a complete version of this story.

How does the boy’s actions develop a theme in "The Harvest"?

The boy isn’t sure why Don Trine does what he does, but the boy decides to follow him anyway. This develops the theme that wisdom doesn’t need to make logical sense.


The boy learns from Don Trine and begins following his lead. This develops the theme that it is important to appreciate and respect the earth.


The boy sympathizes with the old man and completes his tasks for him. This develops the theme that kindness is more important than material wealth.


The boy doesn’t give up and decides to mimic Don Trine’s actions to see if there is something more to them. This develops the theme that curiosity is the secret to wealth.

Answers

Answer: The boy learns from Don Trine and begins following his lead. This develops the theme that it is important to appreciate and respect the earth.

Explanation:k12

Instead of moving to Birmingham with her birth mother, what does Claudette decide to do? Why?

Answers

She decides to hitchhike with some bikers

4. How are the main narrator and Simon Wheeler different? Give as many details as
possible.

Answers

Answer:

The first narrator is very different from Simon Wheeler in a number of ways, including style, his superior understanding and use of grammar and syntax, his address of the reader directly, and his tongue-in-cheek manner. Moreover, he is skeptical about the story that Wheeler tells.

2
What does Don Pepe's lesson to Nayeli in paragraph 13 reveal about their
relationship?
A. He was protective of her and did not want to worry her about life's difficulties.
B. He thought she would be able to understand complicated ideas.
C. He found her annoying and wanted to limit their conversations.
D. He was interested in unusual trivia and wanted to share it with her.

Answers

Answer:

where's the story?

Explanation:

we need it

What type of figurative language is represented in the following quote?
"O God, I have an Ill-divining soul!
Methinks I see thee, now thou art so low,
As one dead in the bottom of a tomb."
A. foreshadowing
B. hyperbole
C. understatement
D. metaphor

Answers

Answer:

C

Explanation:

The answer is an understatement because understatement is the presentation of something being smaller or less important than how it is and God which is considered as a supreme or mighty being in Christianity is being portrayed through comparison to a dead person in a tomb, and this degrades Him resulting in an understatement.

In "The Hill We Cimb," Amanda Gorman uses various techniques to argue that while progress is a slow and sometimes painful “climb” up the “hill” of justice, it is possible if Americans work together to change our country for the better. Write an essay in which you analyze the choices Gorman makes to convey her argument.

Answers

Ay bro she explained information about how are country grew and improved and we had downfalls but we always come back irdk that much about that poem sorry

Which word in the following sentence functions as a pronoun? Today they will attend a fashion show sponsored by the young ladies in our church. they fashion by ladies

Answers

Answer:

They :)

Explanation:

can someone help me solve this please?

Answers

I think its 8. You have to write it dowm hope this helps.

What is the solution to having both genders respect each other?

Answers

Answer:

my friend said friendship

Explanation:

give 3 reasons why wealth is to be enjoyed
give a little explanation ​

Answers

Wealth is the be enjoyable because you can buy nice things for you, your family and those who are in need. If you are in debt, being wealthy enough can help you get out of the position. Another great reason is giving back to the ones who aren’t as wealthy or donating to churches, schools, and so much more. That is why wealth is to be enjoyed.

Which of the boys successfully spears the wild boar before it finally falls out

Answers

Answer:

is there an image associated with this because if not then this makes no sconce

Explanation:

Ralph, who has never been on a hunt before, quickly gets caught up in the exhilaration of the chase. He excitedly flings his spear at the boar, and though it glances off the animal's snout, Ralph is thrilled with his marksmanship nonetheless.

Read the first sentence of the selection.

Day had broken cold and gray, exceedingly cold and gray, when the man turned aside from the main Yukon trail and climbed the high earth bank, where a dim and little-traveled trail led eastward through the fat spruce timberland.

The author’s syntax and use of repetition establishes a tone that is ––


A. cynical

B. malicious

C. foreboding

D. tranquil

Answers

C. A foreboding tone

Foreboding undertones are created by the author's repetition and syntax. Hence, Option C is correct.

What is the meaning of the term “syntax”?

The study of syntax in linguistics deals with the way that words and morphemes come together to form longer units like phrases and sentences.

Word order, grammatical relations, the nature of crosslinguistic variation, agreement, hierarchical sentence structure constituency, and the connection between form and meaning semantics are some of the main topics of syntax.

The fundamental presumptions and objectives of the various approaches to syntax vary. Simple, compound, complex, and compound-complex sentences are different types of sentences, each with a different syntax mode.

A conjunction connects two simple sentences to form a compound sentence. Dependent clauses are found in complex sentences, and both types are seen in compound-complex sentences.

Therefore, Option C is correct.

Learn more about syntax from here:

https://brainly.com/question/28182020

#SPJ2

In order to determine what we know about the speaker of a poem, we should gather ______ about the speaker.(1 point) details adjectives rhymes perspectives

Answers

Answer:

Details

Explanation:

It is important to know context about who is speaking, because that will provide new insight into what a poem is about.

In order to determine what we know about the speaker of a poem, we should gather details about the speaker.

A speaker in a poem

In poetry, this is the voice behind a poem, the person imagined to be saying the poem out loud.

Determining what we know about the speaker of a peom, it is important to know about the details of the speaker as it will provide a good background information on what a peom is about.

Therefore, the correct answer is option A.

Read more about details here:

https://brainly.com/question/24621985

100 POINTS!!!

In at least one hundred words, give an overview of the basic tenets of the Igbo belief system, as described in Achebe’s Things Fall Apart. Use evidence to support your answer.

Answers

Answer:

The Igbo gods are mostly manifestations of nature and its elements, which makes sense because they are an agricultural society that depends on the regularity of seasons and natural phenomena to survive. They worship the goddess of the earth and are always careful to avoid committing sins against her for fear of vengeance that might wipe out an entire generation. The Igbo ancestors also take on a divine nature to some extent. Family plays such a central role in Igbo life that the spirits of their ancestors are consulted for almost every decision and even serve as judges in legal trials (in the form of masked elders). The Igbo emphasis on numerous gods associated with nature and also on ancestors and somewhat divine contrasts sharply with the single God of Christianity which seems far less directly relevant to the Igbo lifestyle.

what was lady gaga's claim in her lgbtq community speech ?

Answers

Answer:

Lady Gaga said she would take a bullet for the LGBT community during a rally in New York City commemorating the 50th anniversary of the Stonewall Riots. “True love – true, true love – is when you would take a bullet for someone,” she said during her speech.

Explanation:

Why is it important for people to have the opportunity to define their own cultural identity as opposed to allowing themselves to be labeled by others as belonging to one group or another?

Answers

Answer:

Because it is important that the individual identifies himself with the cultural concepts with which he feels comfortable and happy.

Explanation:

Cultural identity is a very important characteristic for the construction of an individual's personality, in addition to helping in the composition of behavior and in the feeling of belonging and comfort. This is because cultural identity is what allows a person to identify himself/herself as a member of a people. Once the individual is able to determine his/her cultural identity, it is possible that he or she will be able to assume cultural concepts and customs with this people. Cultural identity is highly malleable, but it is important that it is built based on the individual's own thoughts, preferences and concepts, as only the individual will be able to build an identification.

.eybdoogsyasehdnaollehdneirfymdlotdnaemohtnewios

Answers

Answer:

so i went home and told my friend hello and he says good bye

Explanation:

brainliest please?

Answer:

i answered the question give the other person brainliest :]

Explanation:

Which sentence is written correctly?

A. If it is winter in the southern hemisphere, what is the season in the united states?
B. If it is winter in the Southern hemisphere, what is the season in the United states?
C. If it is winter in the Southern Hemisphere, what is the season in the united states?
D. If it is winter in the Southern Hemisphere, what is the season in the United States?

Please help, thanks

Answers

Answer:

summer

Explanation:

Northern hemisphere is opposite of southern hemisphere

Answer: D.

Explanation: United States is sopest to be spelled like that.

can somebody help please

Answers

i think it’s B if not then it has to me C

Make up a pseudonym for yourself and explain why you chose it?

Answers

Answer:

My pseudonym would be Lin-Manuel Miranda's Best Friend and I would choose this because he is cute and LEGENDARY

Read the excerpt below and answer the question.

I have no accurate knowledge of my age, never having seen any authentic record containing it. By far the larger part of the slaves know as little of their ages as horses know of theirs, and it is the wish of most masters within my knowledge to keep their slaves ignorant.

Why does Douglass compare slaves to horses in this excerpt from Narrative of the Life of Frederick Douglass, An American Slave?

to show how poorly kept records were in those days
to show how naive he was at that age
to show how hard slaves had to work
to show how dehumanizing slavery was

Answers

Answer: to show how dehumanizing slavery was

Explanation:

In comparing the lack of knowledge forced upon enslaved people to horses who also lack knowledge, Douglass was trying to show that slavery was so dehumanizing because humans were treated in the same way that animals were treated in this particular regard.

Slave owners felt that the more ignorant an enslaved person was, the easier they would be to control and this was a very accurate view. Once they saw the success of keeping the enslaved ignorant, they pursued it as a strategy ever so diligently.

"Hercules the Mighty."
7. In Scene 1, the line “It’s like tickling a butterfly” contains *
5 points
A. a metaphor that tells you that butterflies are ticklish.
B. a simile that tells you that the lyre must be played gently.
C. symbolism that shows how lovely lyres sound.
D. hyperbole that emphasizes how easy it is to play the lyre.

Answers

I think the answer is B

Please help me this is due today and no file please
I need help explaining why it is logos

1.Seven out of ten people would recommend that you buy this video game and how do you know it is logos

Answers

Answer:

because it uses statistics and research from people to support the statement which is also a way to persuade the buyers to purchase the product.

The part of speech helps determine
~how to use a word
~the job of the word in a sentence
~what the author meant
~the purpose of the writing
Please help

Answers

Answer:

B

Explanation:

it tells what word works it in

Answer:

how to use a word, the job of the word in a sentence

Explanation:

Refer to the Newsela article “Opinion: From Embarrassed about Bicultural Identity to Celebrating It."

Which statements convey an accurate assessment of the author's argument that people who are bicultural should use their experiences to educate others.

Select two correct answers.

A: The argument is adequately supported with examples from Indian culture that the author and her daughter have shared with others.

B; The argument fails because the author only provides examples from her own cultural experiences for support.

C: If the author had provided more information about what the government is doing to expand bicultural education, the argument would be more relevant.

D; The author could have included statistics about how learning about different cultures benefits communities to strengthen the argument.

Assessment navigation

Answers

Answer:

The argument is adequately supported with examples from Indian culture that the author and her daughter have shared with others.

The author could have included statistics about how learning about different cultures benefits communities to strengthen the argument.

Explanation:

The author shows how the bicultural experience is beneficial and can be very productive and positive in people's lives, as it generates an enriched and educating and enriched vision of the world. To reinforce this idea, the author uses her own experience, showing examples of how Indian culture was educational in her and her daughter's life. The author's argument would be reinforced if she presented statistical data that showed how beneficial biculture is in several other communities across the country.

Answer: The answer to your question is A and B:

The argument fails because the author only provides examples from her own cultural experiences for support.

The argument is adequately supported with examples from Indian culture that the author and her daughter have shared with others.

Explanation: I have tooken this quiz, have a great day sir/ma'am.

How would you describe a biome to someone who has never hear of the word?

Answers

Answer: A place where animals, plants, and the rest of the environment work together to much a community in the wilderness

Explanation:

Help me please guys

Answers

1) Meadow Trail
2) A skier got buried in an avalanche
3) Jen felt concerned and scared for the skier
4) the dog located the spot where the skier was buried
5) the skier was put on a sled and went down the mountain

(Treasure island)
Can you please compare Jim Hawkins and dr. livesey please i need help

Answers

Dr. Livesey's narration adds a sense of plausibility to all the excitement we've witnessed. All the same, Livesey's observations are rather similar to Jim's so there's no significant break in continuity when he picks up the story.

Most Americans consume a varied diet. They eat foods that are both plant- and animal-based. Which words are clues to the meaning of the word consume? A. “are both” B. “eat foods” C. “animal-based” D. “Most Americans”

Answers

Answer:

Option B, the meaning of the word consume means to eat

Explanation:

Americans eat a wide variety of diet inclusive of both vegetarian (plant based ) and non vegetarian (animal based)

Hence, consume word here signifies eat food. Option B is correct

Option A, C and D are incorrect because if we replace the consume word with given options, the sentence does not make any sense.

HELP PLZzzzzzzzzzzzzzzzzzzzzzzzzzzz

Answers

Answer:

I believe the first one is the answer. I read an explanation online

Explanation:

I hope this helps, and thanks! BRAINLIEST PLEASE!

Answer:

The first choice: He describes the balloonman as a strange, "goat-footed character and depicts his capacity to attract children to him.

Explanation:

The goat footed balloon man is Pan, the god of fertility, and also of love/sex.  The balloonman is a p*dophile, as some suggest, and abusing kids, giving them “joy” but making them also dirty, and the injustice could be that the children sometimes find it sad that they bust these guys who abuse them, but also treat them really nice.

Other Questions
Write the relationship between cells, tissue and organs in human body.(plzzzzz answer correctly) At an auto repair shop. 3.5 hours of labour costs $311.50. What is the labourcharge for a 5 hour job? can somebody help please 4. How are the main narrator and Simon Wheeler different? Give as many details aspossible. y321-4-3 -2-112234-1+-2+-3+-4What is the slope of the line? Help please thank you:) QUICKLY!!!!!!!!! The Dust Bowl of the 1930s was caused by_______(choose multiple answers) earthquakesvolcanic eruption erosion overgrazing the clearing of grasslands fertilizer runoff The writer Angelo Pellegrini has recalled his own family's detention at Ellis Island:We lived there for three days -- Mother and we five children, the youngest of whom was three years old. Because of the rigorous physical examination that we had to submit to, particularly of the eyes, there was this terrible anxiety that one of us might be rejected. And if one of us was, what would the rest of the family do?The purpose of this excerpt is..A. to describe the physical examination experienced by an immigrant family.B. to explain the day-to-day schedule experienced by an immigrant family.C. to describe the fond memories experienced by an immigrant family.D. to explain the feelings of worry experienced by an immigrant family. What fossil helped support Wegener's hypothesis of continental drift?A. GondwanalandB. KannemeyeridC. MesosaurusD. Glossopteris Puteti sa ma ajutati va rog 2What does Don Pepe's lesson to Nayeli in paragraph 13 reveal about theirrelationship?A. He was protective of her and did not want to worry her about life's difficulties.B. He thought she would be able to understand complicated ideas.C. He found her annoying and wanted to limit their conversations.D. He was interested in unusual trivia and wanted to share it with her. A line graph titled Video Rental Stores has year on the x-axis and stores (thousands) on the y-axis. In 2009, there were 4,000 stores.The line graph shows the number of video rental stores for the years 2005 through 2012.There were stores in 2009. What is wrong with the claim statement: "Everyone should use a cell phone." In the circular flow model, businesses provide goods and services to whichpart of the economy?A. BusinessesB. Product marketsC. Resource marketsO D. Households PLEASE HELP WILL GIVE BRAINLIEST!! Please please only answer if you know or can help!! I need help know if what i already put is correct or how i can fix it and also the answer to question E. THANK YOU! hi can you please help me with my work Add the two functions. f(x) = 3x3 + 7x 26 g(x) = x + 2 Please help! Thank you! Find the area of the white region in the diagram shown. what is the mRNA in TACCGGATGCCAGATCAAATC?