can somebody pls help me solve this question?

Can Somebody Pls Help Me Solve This Question?

Answers

Answer 1

Answer: Im pretty sure its G

Step-by-step explanation:


Related Questions

URGENT!!!! Han earns $48 for babysitting 3 hours. How much money does Han make per hour? Explain
your reasoning. :)

Answers

Answer:

Step-by-step explanation:

If he earns $48 dollars in 3 hours, you need to divide 48 by 3 to work out how much he makes per hour. and 48/3 = 16. So he makes $16 dollars an hour.

Answer:

16$

Step-by-step explanation:

You would have to divide the number of hours he worked for three days by the days he worked in order to find out what he would earn per hour.

This means the answer is 16 dollars per hour.

Multiply the polynomials: (x – 4)(x2 + 2x – 5)

Question 16 options:

A)

x3 + 6x2+ 3x – 20

B)

x3 + 6x2 + 3x + 20

C)

x3 – 2x2 – 13x – 20

D)

x3 – 2x2 – 13x + 20
Question 17 (5 points)
Subtract: (4x3 + 9xy + 8y) – (3x3 + 5xy – 8y)
Question 17 options:

A)

7x3 + 14xy

B)

x3 + 4xy

C)

7x3 + 14xy + 16y

D)

x3 + 4xy + 16y
Question 18 (5 points)
What are the real solutions to the equation 5x2 + 29x + 20 = 0?
Question 18 options:

A)

x = –5, x = 4∕5

B)

x = –4∕5, x = 5

C)

x = 4∕5, x = 5

Answers

Step-by-step explanation:

Hey there!

Given;

[tex] = (x - 4)( {x}^{2} + 2x - 5)[/tex]

[tex] = x( {x}^{2} + 2x - 5) - 4( {x}^{2} + 2x - 5)[/tex]

[tex] = {x}^{3} + 2 {x}^{2} - 5x - 4 {x}^{2} - 8x + 20[/tex]

[tex] = {x}^{3} - 2 {x}^{2} - 13x + 20[/tex]

Therefore, Option D is correct answer.

Q.no.

Given;

[tex] =( 4 {x}^{3} + 9xy + 8y) - (3 {x}^{3} + 5xy - 8y)[/tex]

[tex] = 4 {x}^{3} + 9xy + 8y - 3 {x}^{3} - 5xy + 8y[/tex]

[tex] = {x}^{3} + 4xy + 16y[/tex]

Therefore, answer is Option D.

Qno.

Given;

[tex]5 {x}^{2} + 29x + 20 = 0[/tex]

[tex]5 {x}^{2} + (25 + 4)x + 20 = 0[/tex]

[tex]5 {x}^{2} + 25x + 4x + 20 = 0[/tex]

[tex]5x(x + 5) + 4(x + 5) = 0[/tex]

(5x + 4)(x + 5) =0

Either (5x+4)= 0,

5x = -4

X = -4/5

Or, X+5 = 0

X = -5.

Therefore, X= -5, -4/5.

Hope it helps....

1. A store sold 700 motorcycles last year. This year the store sold 820 motorcycles. What is the percent change in the number of motorcycles sold from las year to this year?​

Answers

Answer:

120 or 120%, hope this helps!

Step-by-step explanation:

4.02>4.1 TRUE OR FALSE

Answers

Answer: true

Step-by-step explanation: cuz

Answer:

False

Step-by-step explanation:

Question 16 please help me

Answers

The answer is 32.8 this is because using the Pythagorean it’s a”

Tyree and four friends go to the movies. Each person buys a movie ticket for $7, a snack for $5, and a drink for $2. Write an expression for the total cost of the trip to the movies. Then find the total cost.

Answers

Answer:

Tyree and all of his friends get 1 ticket for $7. Next they all get 1 snack for $5. Then they all get a drink for $2. So:

1=7

1=5

1=2

Then you take each person (which there are five of then) and you times all five people by 7, 5, 2.

5 x 7=35

5 x 5=25

5 x 2=10

After that you add it all together:

35 plus 25=60

60 plus 10=70

Step-by-step explanation:

your welcome

Answer:

Im not sure if it ment, Tyree and four friends go to the movies. Each person buys a movie ticket for $7, a snack for $5 (meaning only one snack), and a drink for $2. (Meaning only one drink) or if it ment Tyree and four friends go to the movies. Each person buys a movie ticket for $7, a snack for $5 (meaning everyone got a snack), and a drink for $2(meaning everyone got a drink). So i did the math for both of them, if they only got 5 tickets, one snack, and one drink, it would be 42 (the math problem is 35 + 2 + 5). if they got 5 tickets, 5 snacks, and 5 drinks, it would be 70(the math problem is 35 + 25 + 10). Hope this helps!

A line has a slope of a and has a y-intercept of (0,b). Which equation represents this line?
A. y-b=a(x-0)
B. y+b=a(x-0)
C. y-0=a(x-b)
D. y-0=a(x+b)

PLEASE HELP GIVING 50 POINTS!!!

Answers

Step-by-step explanation:

General line equation: y = mx + c, where m is the slope of the line and c is the y-intercept.

We have y = ax + b.

=> y - b = ax

=> y - b = a(x - 0).

The answer is option A.

Answer:

A

[tex]general \: equation \: of \: line \\ y = mx + c \\ from \: the \: data \: given \\ m = a \\ c = b \\ y = ax + b \\ y - b = ax \\ y - b = a(x - 0)[/tex]

In a batch of lightbulbs, 30% are tinted, if 45 lightbulbs are tinted, how many lightbulbs are in the batch?

Answers

Step-by-step explanation:

30% of lightbulbs = 45 lightbulbs

100% of lightbulbs

= 45 * (100/30) = 150 lightbulbs.

Hence there are 150 lightbulbs in the batch.

Annabelle drove 155 miles in 5 hours. How many miles does she drive in 4 hours? How many miles does she drive in 6 hours?

Answers

She drives 124 miles in 4 hours and 186 miles in 6 hours.

Write an equation, and then solve.
5. Kiesha and Wanda went to the mall for 4.5 hours. While they were there, they went to a movie that lasted 130
minutes and ate dinner for 70 minutes. They spent the rest of the time walking around the mall. How long did
they spend walking around the mall?

Answers

Answer:

70 mins

Step-by-step explanation:

Lets first convert the 4.5 hours to minutes. We know that there's 60 mins in an hour, so we can just multiply 4.5 by 60 to get 270 minutes. Now we know the total time spent at the mall.

Then, we can add the times given in the question.

130 mins + 70 mins + walking mins = 270 mins

To solve, simply collect like terms:

200 mins + walking mins = 270 mins

walking mins = 270 mins - 200 mins

walking mins = 70 mins

Write an expression that represents the number of shells in pile 2.

Answers

Answer:

2

Step-by-step explanation:

4/2=2

The meaning of an inequality depends on the __________________of the inequality sign.

Answers

Answer:

Denpeds on the left hand side of nagetive of the inequality sign

Vocabulary: How are integers and their opposites related? Select all that are true.

Answers

They are either both positive or negative
Example:|-2| |2|

Find the solution to the system of equations: x + 3y = 7 and 2x + 4y = 8

1. Isolate x in the first equation:

2. Substitute the value for x into the second equation:

3. Solve for y:







4. Substitute y into either original equation:

5. Write the solution as an ordered pair:





x = 7 – 3y

2(7 – 3y) + 4y = 8

14 – 6y + 4y = 8

14 – 2y = 8

–2y = –6

y = 3

x + 3(3) = 7

(, )

Answers

Answer:

The solution to the system of equation is: (-2,3)

Step-by-step explanation:

We need to find the solution to the system of equations: x + 3y = 7 and 2x + 4y = 8

I am placing steps for each point given

1. Isolate x in the first equation:

First equation is:

x+3y=7

Isolating x:

x=7-3y

2. Substitute the value for x into the second equation:

Second equation is:

2x+4y=8

Putting value of x: x=7-3y

2(7-3y)+4y=8

3. Solve for y:

2(7-3y)+4y=8

Multiply 2 with terms inside the bracket

14-6y+4y=8

-2y=8-14

-2y=-6

y=-6/-2

y=3

So, we get value of y: y=3

4. Substitute y into either original equation:

Putting value of y: y=3 in equation 1

x+3y=7

x+3(3)=7

x+9=7

x=7-9

x=-2

So, we get value of x: x=-2

5. Write the solution as an ordered pair:

After solving the equation we get:

x = -2 and y = 3

The ordered pair is: (-2,3)

Answer:

-2,3

Step-by-step explanation:

Isolate x in the first equation:

Substitute the value for x into the second equation:

Solve for y

Please give me brainiest

What is the length of side EF in the triangle? Please give a step by step explanation, I'm having lots of trouble finding the solution. Thank you!

Answers

Answer:

EF = 8.8 cm

Step-by-step explanation:

In the given right angled ΔDEF, DE is the hypotenuse while EF and DF are adjacent sides. So that applying the Pythagoras theorem, we have;

[tex]/hyp/^{2}[/tex] = [tex]/adj1/^{2}[/tex] + [tex]/adj2/^{2}[/tex]

[tex]/DE/^{2}[/tex] = [tex]/EF/^{2}[/tex] + [tex]/DF/^{2}[/tex]

[tex]/16.2/^{2}[/tex] = [tex]/EF/^{2}[/tex] + [tex]/13.6/^{2}[/tex]

262.44 = [tex]/EF/^{2}[/tex] + 184.96

[tex]/EF/^{2}[/tex] = 262.44 - 184.96

          = 77.48

EF = [tex]\sqrt{77.48}[/tex]

     = 8.8023

EF = 8.8 cm

The length of side EF is 8.8 cm.

A standard train ticket in a certain city costs $1.50 per ride. People who use the train also have the option of purchasing a frequent rider pass for $17.25 per month. With the pass, a ticket costs only $0.75 per ride. How many train rides a month make the frequent rider pass a better deal than standard train tickets?

Answers

Just off the bat 17$is 12 rides and then 17.25 +0.75 is 18 so 13 rides

x = number of rides per month.

Without the pass, the cost per ride is 2.00 per ride.

With the pass, the cost per ride is 1.25 per ride plus 15.75 per month.

You want to know at what number of rides does the cost per ride using the pass become cheaper than the cost per ride without using the pass.

The formula for total cost is as follows:

without the pass:

C1 = 2*x

with the pass:

C2 = 15.75 + 1.25*x

You want to know when C2 becomes less than C1.

C2 < C1 is the inequality equation you are looking for.

Since C2 = 15.75 + 1.25*x, and C1 = 2*x, this equation becomes:

15.75 + 1.25*x < 2*x

Subtract 1.25*x from both sides of this equation to get:

15.75 < 2*x - 1.25*x which becomes:

15.75 < .75*x

Divide both sides of this equation by .75*x to get:

15.75/.75 < x

Simplify to get:

21 < x

21 < x is the same as x > 21.

Your answer is the C2 becomes cheaper than C1 when x > 21.

If you make x = 21, then:

C1 = 2*21 = 42
C2 = 15.75 + 1.25*21 = 15.75 + 26.25 = 42

They are equal.

If you make x = 22, then:

C1 = 2*22 = 44
C2 = 15.75 + 1.25*22 = 15.75 + 27.5 = 43.25

43.25 is cheaper than 44 so C2 is cheaper than C1, confirming that the equation is good.

find the slope thanks​

Answers

17) undefined slope/no slope
18) 1/4
19 -4/5
20) -1

Question 1
Find the missing angle to the nearest degree.
36
14
degrees

Answers

Answer:

23°

Step-by-step explanation:

Let the missing angle be x

Reference angle = missing angle = x

Opposite side to x = 14

Hypotenuse = 36

Applying trigonometric ratio, we have:

[tex] sin(x) = \frac{14}{36} [/tex]

[tex] x = sin^{-1}(\frac{14}{36}) [/tex]

x = 23° (to the nearest degree)

800 adults were surveyed to find out how many notes per week they cook dinner 60% indicated that they cooked dinner more than four nights at per week based on the results of the survey how many adults out of a group of 2000 to cooked dinner more than four nights per week

Answers

Answer:

1200

Step-by-step explanation:

60                 x

-              =    -

100               800

There are 2 ways to solve this.

1) 800 x 60= 48,000

Divide by 100= 480

x=480

2)  Multiply 60 by 8.

Now there are another 2 ways to go.

1) 480        x

   -        =   -

  800        2000

OR

2) 60            x

   -          =    -

   100           2000

I recommend the second option for both. It is easier. The second option allows you to find and equal ratio, with less of the hassle.  

To get 2000, 100 must be multiplied by 20. So.... multiply 60 by 20 to get a equal ratio.

Your answer is 1200. Meaning 1200 adults cooked dinner more than four nights per week.

I hope this helps you significantly

~~~LampteyJ

Answer:

1200

Step-by-step explanation:

When using a number line, in which direction should you move when subtracting a negative value?

Answers

Answer:

LEFT

Step-by-step explanation:

Answer:

Move to the right when you're subtracting a negative number.

Complete the sentence using the bare infinitive.
1.My parents often make me __________​ English Subject

Answers

Answer:

study my ___________ I hope it helps

1-i need to mix 25% mineral spirits to the varnish i am using what ratio of spirit to varnish am i using? 2-if i use 240 ml of varnish what quantity of mineral spirits will i need in ml ? 3-Robison's tapestries all measure 1.5m x 1m wide. Express the proportion of the tapestries' heights to width using whole numbers. Give the answer in ration.

Answers

Answer:

(1) The required ratio of spirit to varnish is 1:3.

(2) You need 80 ml of mineral spirit.

(3) The ratio of tapestries' heights to width is 3:2.

Step-by-step explanation:

(1) If you need to mix 25% mineral spirit to the varnish, then the solution would contain 25% mineral spirit and 75% varnish.

So, [tex]\frac{spirit}{varnish}=\frac{25}{75}[/tex]

                  [tex]=\frac{1}{3}[/tex]

Thus, The required ratio of spirit to varnish is 1:3.

(2) If you use 240ml of varnish, then this quantity is 75% of the total solution or ration of varnish to the total solution will be 3:4.

Let [tex]x[/tex] be the quantity of total solution.

Then, [tex]240:x=3:4[/tex].

⇒[tex]\frac{240}{x}=\frac{3}{4}[/tex]

⇒[tex]3x=240*4[/tex]

⇒[tex]x=\frac{240*4}{3}[/tex]

⇒[tex]x=320[/tex]

That is, total solution is 320 ml.

Now, Spirit = Total solution - Varnish

⇒Spirit = 320ml-240ml

⇒Spirit = 80ml

Hence, if you use 240 ml of varnish, you need 80 ml of mineral spirit.

(3) Robison's tapestries all measure 1.5m long and 1m wide. First, we express dimensions in whole numbers by multiplying them by 10.

Then, dimensions are 15m long and 10m wide.

Now, Height : Width = 15:10

⇒[tex]\frac{Height}{Width} =\frac{15}{10}[/tex]

⇒[tex]\frac{Height}{Width} =\frac{3}{2}[/tex]

Hence, the ratio of tapestries' heights to width is 3:2.

Which equation produces the values in the table?
O y= 4x
O y=4+x
O y=1/4x
Oy=4 - x

Answers

Answer:

Step-by-step explanation: It’s C thank me later

The equation produces the values in the table is y = x/4

What is an equation?

Mathematically, an equation can be defined as a statement that supports the equality of two expressions, which are connected by the equals sign “=”.

For example, 2x – 5 = 13.

Given is table (attached) we need to determine an equation that produces the values in the table,

So, seeing the value it is much that the value of x are the 4 times of the values of y,

So, we can write,

4y = x

or, y = x/4

Hence, the equation produces the values in the table is y = x/4

Learn more about equation, click;

https://brainly.com/question/29657983

#SPJ7

The feet of a poem can easily be compared to _______.

a heartbeat
footsteps
a musical beat
a drum beat

Answers

A footsteps I believe

Answer:

its a heartbeat.

Step-by-step explanation:

sorry for late answer, just answering for any future people.

Please help ASAP!! 20 points givin

Answers

Answer:

d or b

Step-by-step explanation:

quick math

Answer is A 5/3
Hope it helps :)

I will give you a good amount of points if you answer this correct​

Answers

Answer:

I think the answer is B. The equation has infinitely many solutions.

Step-by-step explanation:

4(3x + 4) = 15x + 12 - 3x + 4

*group like terms so 4(3x+4) = 15x - 3x + 12 + 4

*add similar elements 15x - 3x = 12x

*add the numbers 12 + 4 = 16

*Expand to 12x + 16 - 16 = 12x + 16 - 16

*You simplify 12x = 12x

*Subtract 12x from both sides

*Then Simplify which is 0

Which means Both sides are equal to 0

True for all X

QR is parallel to ST Rs is parallel TU QS is congruent to SU

prove QRS is congruent to STU

Answers

Answer:

hope my answer is helpful to you

plz mark me as brainlist and also follow me

As QR is parallel to ST Rs is parallel TU QS is congruent to SU the measure of their included angle is also same ∠QRS ≅ ∠STU.

What is congruency?

We know two similar planer figures are congruent when we have sides or angles or both that are the same as the corresponding sides or angles or both.

Given, Line segment QR is parallel to line segment ST.

Line segment RS is parallel to line segment TU, And line segment QS is similar to line segment SU.

So, The included angle of two pairs of parallel lines will also be the same as

line segment QS is similar to line segment SU.

∴ ∠QRS is similar to ∠STU.

learn more about congruency here :

https://brainly.com/question/7888063

#SPJ5

[50 Points] The function [tex]y = 4.2\sqrt{0.28 x - 1}[/tex] models the annual number of visitors to an amusement park, where y is the number of visitors in millions and x is the number of years since 1975. Find the first year in which the amusement park had 12 million visitors?

Answers

Answer:

In 2008.

Step-by-step explanation:

The function:

[tex]y=4.2\sqrt{0.28x-1}[/tex]

Models the annual number of visitors to an amusement park, where y is the number of visitors (in millions) and x is the number of years since 1975.

We want to determine the first year in which the amusement park had 12 million visitors.

So, we will set y equal to 12 and solve for x. This yields:

[tex]12=4.2\sqrt{0.28x-1}[/tex]

By dividing both sides by 4.2, we acquire:

[tex]\displaystyle \frac{12}{4.2}=\frac{120}{42}=\frac{20}{7}=\sqrt{0.28x-1}[/tex]

And by squaring both sides:

[tex]\displaystyle \frac{400}{49}=0.28x-1[/tex]

Adding 1 to both sides produces:

[tex]\displaystyle \frac{400}{49}+1=\frac{449}{49}=0.28x[/tex]

And finally, dividing both sides by 0.28 gives us the approximation:

[tex]\displaystyle x=\frac{449}{49}\cdot \frac{1}{.28}=\frac{11225}{343}\approx32.72\approx33[/tex]

So, 33 years after 1975, the amusement park will have 12 million annual visitors.

Therefore, the first year in which the amusement park will have 12 million annual visitors is in the year 2008.


Avery's classroom has 3 round tables and 6 square tables. Each table can seat 4 students.
Students are randomly seated at the tables as they arrive to class.
What is the probability that the first student to arrive will be seated at a square table

Answers

answer:
the answer is 13

Plss answer
i will give brainliest

Answers

Answer:

sorry im doing a challenge but i will have someone answer it    

Step-by-step explanation:

Other Questions
3(2(8-2x4)+25divided by 5 )-(2(8 divided by 4x2)-7(7-2x3) Calculate the volume of 1280 kilograms of aluminium if the density is 2700kg/m3 can you please help me:) What is a central idea in the Newsela article "Washed-Up Plastics Become Art with a Vital Message"?Children enjoy the art displays of sea creatures.Many people now look for trash to pick up when they are visiting the beach.Creating artwork can be both beautiful and horrifying.Increased awareness of the dangers of ocean pollution are creating interest in Pozzi's art.Question 2Part BWhich detail from the text best conveys the answer in Part A?"'It's the only thing he's liked all day,' his grandmother said.""An army of about 10,000 volunteers in Oregon help her collect, prepare and assemble the beach trash into art.""All of the art is made from plastic trash that washed ashore, including a great white shark""She now has more than 70 pieces in three exhibitions currently traveling throughout the United States. She also has requests from overseas." Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... paid rent of Rs.25000 by cheque. make journal entry Use a number line to order the numbers from least to greatest. HELLLPPPP!!!!! write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC RIP grandsonhow does earths crust change earths surface [2.1 + (9.2 x 3.3)] x 0.8 PLEASE HELPPFill in the blanks in the following sentences with the logical word(s). Pay attention to the pronunciation.Spell out the following numbers in french: 1. 200:2. 256:3. 987:4. 875:5. 435:Based on the context, fill in the blanks in the following sentences with either the logical word or the appropriate forms of voir or croire. Say the whole sentence aloud.6. Est-ce que tu crois________Paul va aller au cinma ce soir?7. Elles_________les pommes sur la table.8.________vous aux fantmes?Oui! Vous_________ce fantme, l! Mais non, je ne le___________pas! i need help lol i forgot how to do this y32c-4-3 -2 -1-1+1 2 3 4-2+-3+-4+41What is the slope of the line? Since she tried blueberry ice cream Black Canary hasrefused to eat any other flavor. Explain why the Hitler youth had only mixed success among the young German people. You may use the following in your answer comradeship (friendship), compulsory membership. hi...need help....thank you.. A restaurant customer left $1.35 as a tip...Plz help me complete the addition equation that represents the associative property DIRECTIONS: Use this information to answer Parts A, B, and C.A traffic cone has a diameter of 10 inches and a height of 27 inches.Part AFind the volume of the cone. Need answers for #3 please hep