Can someone help?
"Well, clinging to the side like that is not going to get you any further," Mac replied.
What does the word clinging suggest about Rashmi?

A) She is very physical.
B) She looks desperate.
C) She remains hopeful.
D) She seems in control.

Answers

Answer 1
B. She looks desperate

Related Questions

Most Americans consume a varied diet. They eat foods that are both plant- and animal-based. Which words are clues to the meaning of the word consume? A. “are both” B. “eat foods” C. “animal-based” D. “Most Americans”

Answers

Answer:

Option B, the meaning of the word consume means to eat

Explanation:

Americans eat a wide variety of diet inclusive of both vegetarian (plant based ) and non vegetarian (animal based)

Hence, consume word here signifies eat food. Option B is correct

Option A, C and D are incorrect because if we replace the consume word with given options, the sentence does not make any sense.

28. In the course of the poem, the speaker displays
each of the following emotions EXCEPT
(A) frustration
(B) jealousy
(C) uncertainty
(D) impatience
(E) defensiveness

Answers

I’m sorry but what is the poem

Answer:

I believe it's E

Explanation:



A claim is:

the thesis statement

The position you are trying to get your readers to

accept

found in the introduction

all of the above

Answers

Answer:

all of them above

Explanation:

:)))))))))

all of them.............

7th grade English Question
An interjection can be set apart by
A
a comma.

B
a number.

C
parentheses.

D
quotation marks.

Answers

Answer:

i think a comma.

Explanation:

because i think so i'm not sure.

Answer:

A

Explanation:

An example:

I was very happy to recieve the money, of course.

HELP ME PLS ITS DUED SOON


Match the story opening on the left to the "Narrative Beginning Strategy" on the right.


"Can you keep a secret? Everybody has secrets, of course, but mine's different, and it's kind of weird." -The Tail of Emily Windsnap by Liz Kessler


which one does the story match with?


(no links of report, if you dont know the answer dont answer pls!)

Answers

Answer:

Ask a question or set of questions.

Explanation:

Can you keep a secret?

Hope this helps!

Answer:

Ask a question or a set of quetsions.

Explanation:

it satarts off with “Can you keep a secret?” That is a question. The other answers don’t fit.

Spring and Fall
by Gerard Manley Hopkins

Márgarét, áre you gríeving
Over Goldengrove unleaving?
Leáves like the things of man, you
With your fresh thoughts care for, can you?
Ah! ás the heart grows older
It will come to such sights colder
By and by, nor spare a sigh
Though worlds of wanwood leafmeal lie;
And yet you wíll weep and know why.
Now no matter, child, the name:
Sórrow’s spríngs áre the same.
Nor mouth had, no nor mind, expressed
What heart heard of, ghost guessed:
It ís the blight man was born for,
It is Margaret you mourn for.

Which statement best expresses the theme of "Spring and Fall"?


Innocence is best left in childhood.


Nature is the best place to meditate.


Children cannot understand death.


The loss of a child's innocence should be mourned.

Answers

Answer:

Nature is the best place to meditate.

Please I beg you, don’t use my points please. If you don’t know please don’t answer please please please I beg you.

Answers

To make virtual learning the best it could be I would do a few things. The first thing I would do is do a few fun activities with my students. I would do this because I would want to have a good relationship with my students, and I would like to become a very fun teacher.

Another thing I would do is give them a few mental health days a month where we would just relax, and maybe watch movie. I would do this because I don’t want anyone to get very sad because of my class.

The third thing I would do is make sure everyone didn’t have a any questions. I would do this because I wouldn’t want to ever see anyone of my students struggle, so I would make sure to help them as much as I can.

The last thing I would do is check ins with each one of my students, to make sure no one is struggling or falling behind. I would do this because I think as a teacher instead of always assigning piles of work I should focus on the students at least 60% of the time. All in all, this is what I would do as a teacher if I had virtual learning the best it could be.



I hope this helps. :)

Answer:

i know it

Explanation:

can somebody help please

Answers

i think it’s B if not then it has to me C

1. Do you think creative nonfiction or literature is more powerful? Why?

Answers

Answer:

nonfiction

Explanation:

because it expands your imagination wich is vital to ones sanity.

Help me please guys

Answers

1) Meadow Trail
2) A skier got buried in an avalanche
3) Jen felt concerned and scared for the skier
4) the dog located the spot where the skier was buried
5) the skier was put on a sled and went down the mountain

Why does the author Cruz and Felix Varga as the "amigo brothers"? How were the boys alike? How were they different?

Answers

Answer:

they are both teenage boys from the same city. they are different by their appearance.

Let’s Answer This!

Directions: Use the given subject and verb in constructing your own sentence.

Observe subject-verb agreement in your sentences. You may add “s” or “es” to the

verb. Write your answer in your notebook.

SUBJECT VERB SENTENCE

United States Make

The students Excel

English language Help

The books Improve

The journey Enhance

The patient Cry

Mrs. Cruz Appeal

Filipino people Provide

A child Love

The lecturer Explain​

Answers

Answer:

United States makes brilliant minds

Read the first sentence of the selection.

Day had broken cold and gray, exceedingly cold and gray, when the man turned aside from the main Yukon trail and climbed the high earth bank, where a dim and little-traveled trail led eastward through the fat spruce timberland.

The author’s syntax and use of repetition establishes a tone that is ––


A. cynical

B. malicious

C. foreboding

D. tranquil

Answers

C. A foreboding tone

Foreboding undertones are created by the author's repetition and syntax. Hence, Option C is correct.

What is the meaning of the term “syntax”?

The study of syntax in linguistics deals with the way that words and morphemes come together to form longer units like phrases and sentences.

Word order, grammatical relations, the nature of crosslinguistic variation, agreement, hierarchical sentence structure constituency, and the connection between form and meaning semantics are some of the main topics of syntax.

The fundamental presumptions and objectives of the various approaches to syntax vary. Simple, compound, complex, and compound-complex sentences are different types of sentences, each with a different syntax mode.

A conjunction connects two simple sentences to form a compound sentence. Dependent clauses are found in complex sentences, and both types are seen in compound-complex sentences.

Therefore, Option C is correct.

Learn more about syntax from here:

https://brainly.com/question/28182020

#SPJ2

100 POINTS!!!

In at least one hundred words, give an overview of the basic tenets of the Igbo belief system, as described in Achebe’s Things Fall Apart. Use evidence to support your answer.

Answers

Answer:

The Igbo gods are mostly manifestations of nature and its elements, which makes sense because they are an agricultural society that depends on the regularity of seasons and natural phenomena to survive. They worship the goddess of the earth and are always careful to avoid committing sins against her for fear of vengeance that might wipe out an entire generation. The Igbo ancestors also take on a divine nature to some extent. Family plays such a central role in Igbo life that the spirits of their ancestors are consulted for almost every decision and even serve as judges in legal trials (in the form of masked elders). The Igbo emphasis on numerous gods associated with nature and also on ancestors and somewhat divine contrasts sharply with the single God of Christianity which seems far less directly relevant to the Igbo lifestyle.

what was lady gaga's claim in her lgbtq community speech ?

Answers

Answer:

Lady Gaga said she would take a bullet for the LGBT community during a rally in New York City commemorating the 50th anniversary of the Stonewall Riots. “True love – true, true love – is when you would take a bullet for someone,” she said during her speech.

Explanation:

Read and contrast two passages about sun safety.
Which difference can be found when contrasting these
two passages?
Passage 1
"It is a scientific fact that everyone needs sunscreen,
regardless of skin color or ethnic origin. All people are
subject to sun damage."
O The first author uses humor to appeal to children.
O The second author uses humor to appeal to
children.
Passage 2
"No one wants to look like a lizard! You need a big
squirt of sunscreen before heading outside to play.
Sunburns are no fun, so protect yourself."
The first author uses scientific facts to appeal to
children.
O The second author uses scientific facts to appeal to
children.

Answers

Answer:

B   :)

Explanation:

I took the test

Answer: the answer is B: The second author uses humor to appeal to children.

Explanation: PLEASE mark be brainilist this is for sure correct ( I took the test!)

4. How are the main narrator and Simon Wheeler different? Give as many details as
possible.

Answers

Answer:

The first narrator is very different from Simon Wheeler in a number of ways, including style, his superior understanding and use of grammar and syntax, his address of the reader directly, and his tongue-in-cheek manner. Moreover, he is skeptical about the story that Wheeler tells.

Consider the dialogue in chapter 3 of A Christmas Carol. Choose one example of dialogue, and analyze what it reveals about Scrooge's character. Give an example and explain how it brings out Scrooge's character traits.

Answers

Answer:

his dialog from chapter 3 of A Christmas Carol reflects one key part of Scrooge’s character:

"What of that, my dear!" said Scrooge’s nephew. "His wealth is of no use to him. He don’t do any good with it. He don’t make himself comfortable with it. He hasn’t the satisfaction of thinking—ha, ha, ha!—that he is ever going to benefit US with it."

These lines highlight Scrooge’s stinginess. They reveal that even his own family members, including his nephew, believe that he is a miser. They feel that he keeps all his money for himself, and they cannot rely on him for financial support.

The dialog also reflects the miserly and unfeeling aspects of Scrooge’s nature. Although he seems to have money to spare, his nephew is convinced that he doesn’t use it for any charitable purposes. Scrooge doesn’t even use his money to fulfill any of his own wishes or pleasures.

Explanation:

Edmentum <3

In chapter 3 of A Christmas Carol, there is a dialogue between Scrooge and the Ghost of Christmas Present. One example of dialogue that reveals Scrooge's character is when the Ghost says, "There are some upon this earth of yours [...] who claim to know us and who do their deeds of passion, pride, ill-will, hatred, envy, bigotry, and selfishness in our name, who are as strange to us and all our kith and kin, as if they had never lived."

Who are the children in Stave 3 of A Christmas Carol?

Under the Ghost's robe, Scrooge sees a claw-like foot. After that, the Ghost of Christmas Present unzips its robe to show two abhorrently malnourished and tattered children. These are human children, according to the Ghost. The girl is Desire, while the boy represents Ignorance.

Scrooge responds by saying, "But why do spirits walk the earth, and why do they come to me?" This response reveals Scrooge's character traits of skepticism and a lack of understanding of the spiritual world. He is a practical man who believes only in what he can see and touch, and he cannot comprehend the idea of spirits and their purpose on earth.

Learn more about A Christmas Carol here:

https://brainly.com/question/29772454

#SPJ3

Each computer, or device, that stores blocks is called a node. A laptop, a smartphone, a tablet—any of these can be a node. Nodes are connected to one another in a network. (Think of a spider web.) When a digital transaction takes place, the block goes to all the devices on the network. The transaction is approved when the devices on the network see that the block was created with cryptocurrency that’s never been used before.

Based on the context of the paragraph, what is the most likely meaning of the word network?


a system of interconnected devices

a group of machines linked by wire

an organization of people working together

a chain of communication among individuals

Answers

Answer:

The answer is a system of interconnected devices.

Explanation:

They are not connected by wire, but rather through internet and the other two answer choices have nothing to do with the paragraph. The paragraph is talking about electronics, not humans. I hope this helped.

Answer:

The answer is a system of interconnected devices

give evidence that people who look at their phones every minute never have a good relationship give up to 2 statements as to why

Answers

Answer: Research has proven that overuse of phones can cause dissatisfaction with a partner in a relationship. It has also been proven by people who are in a relationship that using phones most of the time causes problems, such as a boring relationship and more argruements.

Explanation:

I tried my best

I NEED AN ARGUMENTATIVE LETTER WITH EVIDENCE AGAINST SCHOOL DRESS CODE(not uniforms) WILL GIVE BRAINIEST

Answers

Answer:

this will not be as good but feel free to modify (i wrote this in like 10 minutes)

Explanation:

   Plenty of schools around the world have dress codes. Although dress codes will guide students to wear appropriate clothing, dress codes can also be a pain to students in the mornings.

    Many scholars wear inappropriate clothing to schools. Dress codes have been made to prevent this from happening. Although dress codes have their own perks of not having students wear inappropriate clothing, they can make students' mornings more uncomfortable. Waking up early in the mornings can be difficult for some, now imagine that with having to measure out clothing. Students who can't afford to clothe may need to just get dress coded. There are many solutions to avoid this problem in both ways.

      Uniforms have been going around schools. Although they may not satisfy every student's style, they do bring one solution to the struggles of mornings. Some teachers may find this a little bit easier to spot the trouble makers as well. They can easily spot the students not wearing the uniforms and dress code them, rather than trying to measure everything by eye.

      Dress codes can have their own perks of letting the students choose their own clothing with a bit of a guideline. Having to struggle in the morning to find clothes that fit the dress code standards can take up time and result in being late for school. Uniforms are one of many solutions to this problem. Although they do not give students much of a choice, they can solve the issue with both the students and teachers.  

The part of speech helps determine
~how to use a word
~the job of the word in a sentence
~what the author meant
~the purpose of the writing
Please help

Answers

Answer:

B

Explanation:

it tells what word works it in

Answer:

how to use a word, the job of the word in a sentence

Explanation:

Someone please help, I need to know what order the words go. Look at the picture bellow

Answers

Answer:

1. banished

2. obey

3. grief

4. memory

5. punishment

6. forbidden

7. willful

8. recall

I really need help with this question

Answers

Answer:

D, it is the one that works because it uses the semicolon correctly and makes sense with the question

2
What does Don Pepe's lesson to Nayeli in paragraph 13 reveal about their
relationship?
A. He was protective of her and did not want to worry her about life's difficulties.
B. He thought she would be able to understand complicated ideas.
C. He found her annoying and wanted to limit their conversations.
D. He was interested in unusual trivia and wanted to share it with her.

Answers

Answer:

where's the story?

Explanation:

we need it

What type of figurative language is represented in the following quote?
"O God, I have an Ill-divining soul!
Methinks I see thee, now thou art so low,
As one dead in the bottom of a tomb."
A. foreshadowing
B. hyperbole
C. understatement
D. metaphor

Answers

Answer:

C

Explanation:

The answer is an understatement because understatement is the presentation of something being smaller or less important than how it is and God which is considered as a supreme or mighty being in Christianity is being portrayed through comparison to a dead person in a tomb, and this degrades Him resulting in an understatement.

“Guns don’t kill people; people kill people.”

Write one sentence about an alternative/opposite opinion.

Answers

Answer:

Guns kill people; People don't kill people.

Explanation:

I think this is correct

I think this statement is correct, provided with the knowledge to know that a gun does not have a mind of its own therefore, it’s who’s hands the weapon lands into.

What is the topic sentence of the paragraph below?


Monarch butterflies make an incredible journey, though no single butterfly lives for the whole trip. In the fall, the monarchs in the United States migrate south to Mexico or California. In the spring, butterflies return to the northern states—but these are the children or grandchildren of the butterflies who left the previous winter. Scientists still don’t know how the monarchs know how to return to their ancestral home.


A. In the spring, butterflies return to the northern states—but these are the children or grandchildren of the butterflies who left the previous winter.


B. Scientists still don’t know how the monarchs know how to return to their ancestral home.


C. Monarch butterflies make an incredible journey, though no single butterfly lives for the whole trip.


D. In the fall, the monarchs in the United States migrate south to Mexico or California.


Please answer I need help no files please

Answers

Answer:

C.

Explanation:

The topic sentence is the first sentence of a paragraph :)

Answer:

Monarch butterflies make an incredible journey, though no single butterfly lives for the whole trip.

Explanation:

Why might the U.S. face its own Luddite-style rebellion?
A
Workers believe that they perform better work than
the machines that have replaced them.
B
New jobs for replaced workers do not pay as well as
old, lost jobs.
Innovation and invention have stopped increasing
wealth in the U.S.
D
Innovation and increased wealth no longer ensure
new job markets for replaced workers.

Answers

i think workers believe that they perform better work than the machines that have replaced them

(No linksssssssssssss)

Pls help me~English ~I’ll mark brainliest if correct <3

Answers

I’m 95% sure it’s B.
Other Questions
At an auto repair shop. 3.5 hours of labour costs $311.50. What is the labourcharge for a 5 hour job? can somebody help please 4. How are the main narrator and Simon Wheeler different? Give as many details aspossible. The writer Angelo Pellegrini has recalled his own family's detention at Ellis Island:We lived there for three days -- Mother and we five children, the youngest of whom was three years old. Because of the rigorous physical examination that we had to submit to, particularly of the eyes, there was this terrible anxiety that one of us might be rejected. And if one of us was, what would the rest of the family do?The purpose of this excerpt is..A. to describe the physical examination experienced by an immigrant family.B. to explain the day-to-day schedule experienced by an immigrant family.C. to describe the fond memories experienced by an immigrant family.D. to explain the feelings of worry experienced by an immigrant family. What fossil helped support Wegener's hypothesis of continental drift?A. GondwanalandB. KannemeyeridC. MesosaurusD. Glossopteris Puteti sa ma ajutati va rog 2What does Don Pepe's lesson to Nayeli in paragraph 13 reveal about theirrelationship?A. He was protective of her and did not want to worry her about life's difficulties.B. He thought she would be able to understand complicated ideas.C. He found her annoying and wanted to limit their conversations.D. He was interested in unusual trivia and wanted to share it with her. In the circular flow model, businesses provide goods and services to whichpart of the economy?A. BusinessesB. Product marketsC. Resource marketsO D. Households PLEASE HELP WILL GIVE BRAINLIEST!! Please please only answer if you know or can help!! I need help know if what i already put is correct or how i can fix it and also the answer to question E. THANK YOU! Please help! Thank you! what is the mRNA in TACCGGATGCCAGATCAAATC? Help!!! I do not seem to understand this problem well. Dr. Seals borrows $15,000 to remodel her backyard. The interest rate is 3%. The interest is compounded twice a year for two years. Why would an investor want to choose a certificate of deposit over a corporate bond describe how the state of Washington and its residents played a huge part in winning World War II? Plzzz help NEED THIS FAST!!! Layla is going to invest $5,200 and leave it in an account for 15 years. Assuming the interest is compounded monthly, what interest rate, to the nearest tenth of a percent, would be required in order for Layla to end up with $13,800? Most Americans consume a varied diet. They eat foods that are both plant- and animal-based. Which words are clues to the meaning of the word consume? A. are both B. eat foods C. animal-based D. Most Americans plz no bit.yl stuff, just answers Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?A.It shows that a disease can cause genetic changes.B.It is a reflection of how genetic factors affect health.C.It shows how public health is affected by environmental factors.D.It indicates how a toxin can play a role in the development of disease. why is it important to save energy in our daily lives Red and white blood cells are produced inside the __________ of bones. This is an interaction between the skeletal, circulatory, and immune systems.A. MarrowB. Spongy BoneC. Compact BoneD. Liver