Answer c
Explanation:
what process causes stem cells to become immune system cells,then some immune system cells to become antibodies?
This is a question that has been confusing - In addition to carbon dioxide, what other two ingredients does a plant need for photosynthesis?
Answer:
Carbon dioxide, water and sunlight
Answer:
water and sunlight
Explanation:
Can someone tell me if it’s correct
Answer:
yes ur right
Explanation:
Will give Brainliest within five minutes of answer - Why do we want to explore Mars more than the other planets/moons even though it is not currently habitable (with its temperatures, atmosphere, etc.)? How can it be habitable?
Answer:
After the Earth, Mars is the most habitable planet in our solar system due to several reasons:
Its soil contains water to extract
It isn’t too cold or too hot
There is enough sunlight to use solar panels
Gravity on Mars is 38% that of our Earth's, which is believed by many to be sufficient for the human body to adapt to
It has an atmosphere (albeit a thin one) that offers protection from cosmic and the Sun's radiation
The day/night rhythm is very similar to ours here on Earth: a Mars day is 24 hours, 39 minutes and 35 seconds
The only other two celestial bodies in orbits near the Earth are our Moon and Venus. There are far fewer vital resources on the Moon, and a Moon day takes a month. It also does not have an atmosphere to form a barrier against radiation. Venus is a veritable purgatory. The average temperature is over 400 degrees, the barometric pressure is that of 900 meters underwater on Earth, and the cherry on top comes in the form of occasional bouts of acid rain. It also has nights that last for 120 days. Humans cannot live on Mars without the help of technology, but compared to Venus it's paradise!
Additional info:
Mars is an obvious target for exploration because it is close by in our Solar System, but there are many more reasons to explore the Red Planet. The scientific reasons for going to Mars can be summarised by the search for life, understanding the surface and the planet’s evolution, and preparing for future human exploration.
Searching for life on Mars
Understanding whether life existed elsewhere in the Universe beyond Earth is a fundamental question of humankind. Mars is an excellent place to investigate this question because it is the most similar planet to Earth in the Solar System. Evidence suggests that Mars was once full of water, warmer and had a thicker atmosphere, offering a potentially habitable environment.
Carbon dioxide enters a plant through pores (openings) called the
A. stomata.
B. cuticle.
C. veins.
FOODS HIGH IN PROTEIN RELEASES ENERGY
A. FAST
B. QUICKLY
C. SLOWLY
Answer:
quickly
Explanation:
Answer:
SLOWLY
Explanation:
using the graph, the temperature seasonal force from the other Forest biomes. choose all the apply
A) the temperature seasonal Forest averages 100 to 200 cm rainfall/year
B) the temperature seasonal Forest is cooler and wetter than the tropical rainforest
C) the temperature seasonal Forest has warmer average temperatures than the Boreal forest
D) the temperature seasonal rainforest has similar temperatures but less rain than the temperate rainfores
E) the temperature seasonal rainforest has similar rainfall to the Boreal and tropical seasonal rainforest, but is much warmer than either one
Answer:
The correct answer is - A and C,
Explanation:
According to the graph, the following conditions are matched correctly with the temperature seasonal forest with other biomes:
The temperature seasonal forest has the precipitation range from 50 cm to 250 cm rainfall per year approximately. The average rainfall from this would be 150 cm/year or between 100 to 200 cm per year.
B. the temperature seasonal forest has a temperature between 15 degrees Celsius to 20 degrees celsius which is warmer than the boreal forest that has a temperature between 0 to 15 degrees Celsius approximately.
Answer:
A, C, D
Explanation:
I will mark Brainliest for frist answer
Answer:C, to contain the information
Explanation:
Number the steps from when a stimulus is received to when the body reacts.
_____ The stimulus is received by sensory receptors.
_____ Motor neurons cause muscles to contract so the body can react to the stimulus.
_____ The brain processes the information through interneurons.
_____ Interneurons transfer response information to motor neurons.
_____ Sensory neurons carry stimulus information to the brain or spinal cord.
Answer:
The correct answer is -
1 - The stimulus is received by sensory receptors.
2 - Sensory neurons carry stimulus information to the brain or spinal cord.
3 - The brain processes the information through interneurons.
4 - Interneurons transfer response information to motor neurons.
5 - Motor neurons cause muscles to contract so the body can react to the stimulus.
Explanation:
In most of the organism including humans body response according to the stimulus it receives. The stimulus is received by the sensory receptors to the sensory neurons or afferent neurons that are present on the skin, nose tongue ears, or eyes. Many other receptors and pain receptors present on various internal organs as well.
These sensory neurons carry the stimulus to the spinal cord or brain where this information received by the stimulus process through interneurons and transfer the response of the particular stimulus to the motor neurons. These motor neurons result in muscles contracts so the body can react.
The term used to describe a location with many different cultural groups is
A. culturally diverse
B. globalization
C. multiple perspectives
D. ethnicity
This moray eel has a small fish cleaning between its teeth. The eel gets a
clean mouth while the cleaner fish gets a nice meal.
A.Mutualism
B.Commensalism
C.Parasitism
Answer:
A. Mutualism
Explanation:
The moray eel and the small fish are both getting something out of it. Meaning they both benefit from each other.
explain how at least three pieces of evidence support the theory of evolution.
Dont put any link or else I won’t give brainlist, just answer.
Answer:
1. Fossil evidence
2. Homologous similarities.
3. Molecular evidence
what are cotyledons? & what is its use
Answer:
Cotyledon, seed leaf within the embryo of a seed. Cotyledons help supply the nutrition a plant embryo needs to germinate and become established as a photosynthetic organism and may themselves be a source of nutritional reserves or may aid the embryo in metabolizing nutrition stored elsewhere in the seed.
*You Can put this in your own words
what is the mRNA in TACCGGATGCCAGATCAAATC?
Answer:
AUGGCCUACGGUCUAGUUUAG
What are the factors that determine
the level of harm an introduced chemical
has on the enviroment?
PLEASE ANSWER QUICKLY
Explain the lifecycle of mosquito in short
Answer:
Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)
Marcus grew three rosemary plants. He put one in
direct sunlight, one in the shade, and one in the
dark. The plant in the sun grew the most quickly
and looked the healthiest. Marcus concluded that
rosemary plants grow best in the sun.
How would you evaluate Marcus's conclusion?
O A. His conclusion is valid because his
experiment included a control.
B. His conclusion is valid because he tested
only one variable.
O C. His conclusion is flawed because he did
not perform enough trials.
O D. His conclusion is flawed because it is
based on the appearance of the plants.
Answer:
His conclusion is flawed because he did
not perform enough trials.
Explanation:
i jus took the test
How is energy produced by respiration stored
Answer:
Explanation:
Cellular respiration converts the chemical energy stored in glucose into chemical energy stored in the ATP molecule. The cells break glucose down into carbon dioxide and water while producing energy that they store in ATP molecules.
Answered by the ONE & Only #QUEEN aka #DRIPPQUEENMO
Hope this helped!!!
plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.
What organisms are capable of cellular respiration?
A. Heterotrophs only
B. Animals and fungus
C. Animals, fungus, and some bacteria
D. Protists
E. All organisms
Please help i am giving away brainiliest
Describe the Lytic cycle.
No dam links
Answer: here ya go
Explanation: The lytic cycle is one of the two cycles of viral reproduction
Answer:The lytic cycle (/ˈlɪtɪk/ LIT-ik) is one of the two cycles of viral reproduction (referring to bacterial viruses or bacteriophages), the other being the lysogenic cycle. The lytic cycle results in the destruction of the infected cell and its membrane.
Explanation:
Can someone please help me on this plz I beg u :(
Answer:
Coleoptera is correct! Hope this helps.
which involves producers, consumers, and decomposers?
the water cycle
nitrogen fixation
evaporation
the carbon and oxygen cycles
Which process begins the formation of sedimentary rock?
The Rio Grande River separates Mexico from Texas.
What most likely created the riverbed?
A.glaciers
B.plate collisions
C.volcanoes
D.water erosion
Answer:
d I think or b?
Explanation:
water could cause it to form a river and spread over time
tRNA uses (anticodons/codons) to match to the mRNA.
Answer:
anticodons
Explanation:
codons are for mRNA
tRNA uses anticodons to match to the mRNA.
Which one does tRNA uses?tRNA (transfer RNA) molecules are responsible for carrying specific amino acids to the ribosomes during protein synthesis.
They have an anticodon region that consists of three nucleotides that are complementary to the codons on the mRNA (messenger RNA). The codons on the mRNA determine the sequence of amino acids in the growing polypeptide chain.
The anticodon on the tRNA base pairs with the complementary codon on the mRNA, ensuring that the correct amino acid is incorporated into the growing protein chain. The matching between the anticodon and codon is essential for the accurate translation of genetic information into protein synthesis.
Learn more about tRNA at:
https://brainly.com/question/4089622
#SPJ6
What two types of consumers are missing from this pyramid?
Please help I need to turn it in today !!!!
Answer:
decomposers and omnivores
Explanation:
¿Con que otro nombre se le conoce a las placas de espuma de poliuretano altamente contaminante?
Answer:
La espluma de poliuretano (espluma PU) ye un material plásticu porosu formáu por un agregamientu de burbuyes, conocíu tamién polos nomes coloquiales de gomaespuma n'España o gomapluma en dellos países suramericanos. Contienen sustances d'escasu poder canceríxenu que si representen dalgún peligru, namái sería tres esposiciones intenses y teniendo contautu direutu.Tamién ye denomináu Poliuretano proxectáu, por cuenta de la forma na que se suel aplicar sobre superficies. Explanation:
why is it important to save energy in our daily lives
Answer:
So you can be more active and do different things that need energy
Explanation:
Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.
Hello! could someone please do a 4 sentence quark poem
Answer:
Quark is a character in the television series Star Trek: Deep Space Nine.
Quark developed a few strong friendships during his stay on Deep Space Nine.
The Ferengi have business deals throughout the galaxy; Quark is no different.
For vegetarians, soft cheeses like cream cheese and quark do not contain any rennet at all.
Explanation:
