Choose the sentence that is correctly punctuated. A. Take the last muffin long dash —its ​your's, not mine. B. Take the last muffin long dash —​it's ​your's, not mine. C. Take the last muffin long dash —​it's ​yours, not mine. D. Take the last muffin long dash —its ​yours, not mine.

Answers

Answer 1

Answer:

C. Take the last muffin —​ it's ​yours, not mine.

Explanation:


Related Questions

America is an improbable idea. A mongrel nation built of ever-changing disparate parts, it is held together by a notion, the notion that all men are created equal, though everyone knows that most men consider themselves better than someone. "Of all the nations in the world, the United States was built in nobody's image," the historian Daniel Boorstin wrote. That's because it was built of bits and pieces that seem discordant, like the crazy quilts that have been one of its great folk-art forms, velvet and calico and checks and brocades. Out of many, one. That is the ideal. Which statement best explains the role context plays in better understanding this excerpt? Quindlen uses the context of American diversity to help readers rethink the concept of American identity and understand that she supports the idea of unity among Americans of all cultures. Understanding that Quindlen is the descendant of immigrants helps the reader realize that she supports the idea that some cultures are naturally better than others. Quindlen uses the context of living in the United States during the 9/11 attacks to help the reader realize that she feels that unity among all Americans is impossible to achieve. Understanding that Quindlen is an immigrant from another country helps readers realize that she understands societies like the United States more than most people.

Answers

Answer:

im not 100% sure but i think the answer is D

Explanation:

America is an improbable idea: tells the reader how Quindlen feels about the US

The mention of Daniel Boorstin's quote allows the reader to understand the authors idea

anyway this all means that Quindlen has more of an understanding than most immigrants

HOPE THIS HELPS!!! :)

PLEASE CORRECT ME IF IM WRONG

The statement that best explains the role of context is the usage of American diversity to help readers rethink the concept of American identity and understand that she supports the idea of unity among Americans of all cultures. Hence, Option A is correct.

What is the meaning of role of context?

Although from various angles, the role of context in the explanation of a linguistic unit has long been debated.

These perspectives range from the one that sees context as an extralinguistic feature to the one that holds that pragmatics, as well as semantics, are inseparable because meaning can only exist in use.

Hence, Option A is correct.

Learn more about role of context:

https://brainly.com/question/20146335

#SPJ2

how does the mask help you if you sick?​

Answers

it helps you spread it to others
A mask prevents you from spreading the sickness to other people in your surroundings

Read this excerpt from another writer's account of the Smithsonian
Institution
estion(s).
thy person. When he died in
ed States. Smithson, a British
Ip spread knowledge. In
o build the Smithsonian
educational sites in
that focus on art, history,
When James Smithson left his wealth to the United States, he asked
that it be used to spread knowledge. The result was the founding of the
Smithsonian Institution. Smithson's gift was generous, but the actual
work of defining and refining the Smithsonian's mission was left to
figures such as Joseph Henry, its first Secretary.
Which of the following best describes the difference in the
perspectives of the two authors on their topic?
O A. The first highlights Smithson's role in founding the
Smithsonian Instution, the second emphasizes the important
part played by others.
n Art features different forms
Visitors can see American
and other works. The
ry has exhibits on all types of
out human, animal, and plant
erican History includes
items, along with inventions
Air and Space Museum
Lion and aeronautical
The first emphasizes the government's role in maintaining
the Smithsonian Institution, the second highlights Smithson's
role.
C. The first emphasizes the importance of the Smithsonian in
preserving art, the second highlights its work in science.
D. The first tends to portray James Smithson as a hero, the
second tends to portray him as an ordinary man.​

Answers

Answer:

A. The first highlights Smithson's role in founding the  Smithsonian Instution, the second emphasizes the important  part played by others.

Explanation:

Smithson was a British scientist who was born in 1765 and died in 1829. he was a wealthy man and he make a will that all his wealth will be used to spread knowledge among people. So for that reason, the United States of government founding the institute in the name of Smithson but the rest of his wealth was deposited in the treasury of United States of America in the form of bonds so the wealth was not efficiently used by the government for spreading of knowledge.

forget the other question can someone answer this one instead

Answers

Answer:

the answer is D I hope this can help you

What is the meter of this poem?

To views far distant and to scenes more bright,
Along the vale of Time extend thy sight,
Where hours and days and years from yon dim pole,
Wave following wave in long succession roll,
There see, in pomp for ages without end,
The glories of the Western World ascend.
See, this blest land in orient morn appears,
Waked from the slumber of six thousand years,
While clouds of darkness veil'd each cheering ray;
To savage beasts and savage men, a prey.
Fair Freedom now her ensigns bright displays,
And peace and plenty bless the golden days.
In radiant state th' imperial realm shall rise,
Her splendor circling to the boundless skies;
Of every Fair she boasts the assembled charms,
The Queen of empires and the nurse of arms.

Answers

Answer:Meter of a peem is nothing but the "basic structure of the poem like it's rhyming, etc".

Here let's take the rhythmic words for the poem:

Bright, Sight.

Pole, Roll.

End, Ascend.

Appears, Years,

Ray, Prey.

Displays, Days.

Rise, Skies

Charms, Arms.

There are eight set of rhyming words in this poem.

Thank you!

Which words could correctly replace the underlined words in the sentence below?
The morning has a stimulating chill.

a controlling

an awakening

an exhausting

a beginning

Answers

Answer:

awakening

Explanation:

stimulating and awakening are the most similar of the words given, they are both used to illustrate a cold chill feeling.

What feelings and emotions are expressed in the descriptions of Equiano’s village? In your opinion, what can readers learn from reading these excerpts of the memoir? Use details from the excerpts to support your answer.

Answers

The correct answer to this open question is the following.

The feelings and emotions that are expressed in the descriptions of Equiano’s village are of nostalgia for his birthplace.

In my opinion, what readers can learn from reading these excerpts of the memoir is the fond memories Equiano had for his village, his people, traditions, culture, and customs.

He describes the landmark. A place full of vegetation, where people grew fruits and vegetables. He refers to the clothes the people used. Nothing fancy. Those were simple and comfortable clothes. He remembers that his people traded different artifacts with white people. He mentions some traditions such as marriage and the way the elders punished people who committed any crime.

You can read more about Olaudah Equiano in his autobiography and refers to his life as a slave.

How are the Greek values of family and perseverance shown through Odysseus’s return home?

Answers

Answer:: We can see Greek family values based on Penelope who waited for Odysseus for 10 years to come home and did not want to marry any of the suitors. His Son is also always on his side and believes that he'll come back. Even his dog is faithful and is one of the rare Ithacians who recognizes him.

Explanation:

Suppose, you are a student of 2nd semester, BBA. Your batch want to arrange an initiation ceremony for the freshers of the department. Now, write an application to the proper authority seeking permission to arrange this ceremony by justifying your stance. help plz

Answers

Answer:

When a letter is made to request permission for an event within the university, it should be addressed to the supervising school of the career, since it is the direct manager of the novices and the space used by them.

Explanation:

- First, start with the date and place from where the letter was sent.

- Second, the letter must begin with a greeting. (Good Morning).

- Third, we must add the authorship to which the letter is addressed. (Gentlemen, directors of the career school of ...) For example: School of engineering.

- Fourth, you must add below who wrote the letter, the reason for which the letter was written and the request that is made.

- In fifth and last place, the instance is thanked for receiving the letter and a prompt response is requested, the signature of the person making the letter and their university data such as student number, career being carried out, semester being carried out, etc. .

how long did he walk to borrow a book abrahm lincoln

Answers

Answer:

Even though Lincoln had very little formal education, he loved to read, and neighbors remembered how he would walk for miles to borrow a book.

Explanation:

what causes do salerio and solanio suggest for antonio's melancholy?

act 1, scene 1(merchant of venice)
pls help me​

Answers

Answer:his money was invested in ships

Explanation:

Read the passage from Sugar Changed the World. Sugar was the connection, the tie, between slavery and freedom. In order to create sugar, Europeans and colonists in the Americas destroyed Africans, turned them into objects. Just at that very same moment, Europeans—at home and across the Atlantic—decided that they could no longer stand being objects themselves. They each needed to vote, to speak out, to challenge the rules of crowned kings and royal princes. How could that be? Why did people keep speaking of equality while profiting from slaves? In fact, the global hunger for slave-grown sugar led directly to the end of slavery. Following the strand of sugar and slavery leads directly into the tumult of the Age of Revolutions. For in North America, then England, France, Haiti, and once again North America, the Age of Sugar brought about the great, final clash between freedom and slavery. Which sentence best states the authors' claim in this passage? Economic demand for sugar led to political pressure to end enslavement. The growing demand for sugar made the lives of enslaved people even worse. Turning Africans into objects was important for the sugar industry to succeed. Monarchies became increasingly strong and popular during the Age of Sugar.

Answers

Answer:

A). Economic demand for sugar led to political pressure to end enslavement.

Explanation:

The first statement i.e. 'economic....enslavement' most aptly states the author's claim in the given passage as he says that 'they could no longer stand being objects themselves.' The author provides sufficient support to justify his claim by stating that 'the global hunger for slave-grown sugar led directly to the end of slavery.' The increasing economic demand for sugar eventually led to 'the Age of Revolutions and a clash between sugar and slavery' as the slaves were a crucial factor in the production of the sugar and meet the rising demands. Thus, this led to the end of slavery, and hence, option A is the correct answer.

Answer:

A). Economic demand for sugar led to political pressure to end enslavement.

Explanation:

Got it right on edge

Answer it, answer it, answer it.

Answers

Explanation:

Option B is the correct answer

b is the correct answer

Which passage most strongly supports the inferences you've made about Jupiter?
O A) “Now Pandora had brought with her as a gift from Jupiter a golden casket."
B) “But before punishing Prometheus he decided to vex the children of men."
C) “Indeed, they were very poor and wretched and cold, without fire, without
food, and with no shelter but miserable caves."
D) "He climbed the rugged peak, slew the fierce eagle, and with mighty blows
broke the chains that bound the friend of man."

Answers

Answer: The answer is B

Explanation:

“But before punishing Prometheus he decided to vex the children of men passage most strongly supports the inferences you've made about Jupiter.

What is the passage?

The length of a passage varies depending on the context and the goal of the extraction. A passage can be, for example, a sentence's clause, a few phrases, or it can be a few pages.

An excerpt or segment of a literary work, whether it be fiction or nonfiction, is referred to as a passage. Despite some claims to the contrary, most passages are at least one paragraph long and frequently multiple. They had influence over how things were transported through their region.

Therefore, Thus option (B) is correct.

Learn more about the passage here:

https://brainly.com/question/26999874

#SPJ2

what does the writer wanted to mean in the story The Portrait of a Lady​

Answers

The story portrays a grandson's perception of his grandmother and how their bond of love undergoes changes. Moral: The story puts light on the need of companionship and friendship felt by our elders. It also shows how love and emotion is experienced not only by human beings but animals and birds too.

Explanation:

The Portrait of a Lady is the story of a spirited young American woman, Isabel Archer, who, "confronting her destiny",finds it overwhelming. She inherits a large amount of money and subsequently becomes the victim of Machiavellian scheming by two American expatriates. Like many of James's novels, it is set in Europe, mostly England and Italy. Generally regarded as the masterpiece of James's early period, this novel reflects James's continuing interest in the differences between the New World and the Old, often to the detriment of the former. It also treats in a profound way the themes of personal freedom, responsibility, and betrayal.

Need a 2 min speech about gender inequality. quick please

Answers

Explanation:

in my life experiences, i haven't seen a satisfactory proportion of men and women's involvement at a particular objective. As we all know, at school, there are still children who are acknowledged to work at home rather than going to school. or forced by the society to withdraw their dream, we shall stand together for the next generation if we strive to see our dream universe.

Hey everyone good morning...... if u would start a business.what kind of business would u start?and why?
FAST I NEED IT ASAP

Answers

Answer: slime buisness

Explanation: i would start a slime buisness because it is just really fun and kids love playing with it

How was unemployment affected during the war? A. It had risen quickly B. It had lowered slightly C. It was unaffected by the war D. It had fallen to very low levels

Answers

Typically, unemployment rates D. falls to very low levels during the war. As long as a person is fit for service whether mentally or physically-capable, they would have a mandatory service within the branch of the military. The military pays, and so the soldiers count as employed. With the removal of many males from the workforce, women typically fill the roles back home, which means that technically more people are employed during times of war. This means that the unemployment rate falls drastically.

What does it was now midnight, and my task was drawing to a close. Mean?

Answers

Answer:

oh yeah this question is what does she was no midnight and and my eyes drawing to a close me the answer will be the midnight equal drawing a cross and it is night square drawing in a fortune so what will happen in the core loss and joining the people will be cleaned

Younique is writing an essay in favor of recycling to reduce garbage in the ocean. Which piece of evidence is least relevant to her argument?
1. Litter is not only ugly, but also harmful to animals in national parks
2. Millions of plastic water bottles end up in the ocean each year, adding to the millions already there and not decomposing.
3. Recycling has become easier with many public places including recycling bins right next to all garbage cans.
4. Plastic that hasn’t been recycled has extremely harmful effects to the wildlife that live in the ocean.

Answers

Answer:

1. Litter is not only ugly, but also harmful to animals in national parks

Explanation:

When writing an essay in support of a point, you have to select salient points that are consistent and relatable to what you're writing about..

Younique is writing an essay in support of recycling to reduce garbage in the ocean and therefore she has to bring points that relates to side effects of throwing garbage in the ocean, how easy it is to recycle garbage and other necessary points.

The truly odd one out is option A which says "Litter is not only ugly, but also harmful to animals in national parks".

This has no direct connection to effect of garbage in the ocean or recycling so this is the piece of evidence with the least relevance to her argument.

Textbook
What is the name of Pearson's App used for watching a video or listening to audio on a mobile device?
WigglePages App
BouncePages App
Jump Pages App
None of the above​

Answers

Hope this Helps :) Sorry if itz wrong!

The answer is A Wigglepages APP

Plz mark this brainliest

Write a letter to your pen friend telling him or her about the effect of corona virus ravaging your country at present

Answers

Answer:

them

Explanation:

Answer:

I am writing second paragraph.

Explanation:

Dear Sam,

How are you? Hope you are good. Normally I would have written a letter to you every month, but due to this pandemic it's not easy. How are you going on? Are your online classes good? Mine is going perfectly fine. Man, this pandemic, it's not even allowing me to get outside. Here it's more than a 1000 cases. Can you go out? We have lockdown. What about you? Anyways, my house is also running out of paper, so I better make this letter short. Be good and always Stay home and stay safe.

Hope this helps....

Have a nice day!!!!

who are the two white women zora meets and why are they at her school

Answers

In Chapter 4, Hurston recalls that "two young ladies just popped in" one afternoon when she was at school. She says that white people would often bring their friends, "who came down from the North," to visit the village school, because "a Negro school was something strange to them." We, therefore, assume that these two white ladies are from the North, visiting friends in Florida, and curious to see "a Negro school." However, these particular ladies are different because they arrive unannounced.

Hurston says that the two ladies both "had shiny hair, mostly brownish" and that one of them was "dressed all over in black and white." However, she was most attracted by and curious about their fingers, which she describes as "long and thin, and very white." Hurston reads for the two ladies, and they are very impressed.

The ladies, Mrs. Johnstone and Miss Hurd, invite Hurston (or Zora, as I'm sure she would have been known to them), to the hotel they are staying at and give her "strange things, like stuffed dates and preserved ginger." The ladies then have their picture taken with Zora, and they give her one more present, a cylinder stuffed with "One hundred goldy-new pennies." The next day, more presents begin to arrive, including "an Episcopal hymn-book bound in white leather," "a copy of The Swiss Family Robinson," and, finally, "a huge box packed with clothes and books."

The two ladies return to Minnesota about a month later, and we hear no more about them. We can only assume that they were two ladies visiting friends in Florida, curious to look around "a Negro school," who became particularly fond of Zora after hearing her read.

In what way does the following line from James Joyce's "Araby" contribute to the symbolism of the story? She was waiting for us, her figure defined by the light from the half-opened door.

Answers

Answer:

Hey There Again. ☆~___`|\/|`____~☆ The line contribute to the symbolism of the story by James Joyce's "Araby", "She was waiting for us, her figure defined by the light from the half-opened door." is by 4, which is the partial light reflects the sense of balance that the narrator seeks but finds missing in his "blind" street and neighborhood.

Hope It Helps!~ ♡

ItsNobody~ ☆

Answer:

D: The partial light reflects the sense of balance that the narrator seeks but finds missing in his "blind" street and dark neighborhood.

Explanation:

The answer is as above if the provided answers are as follows:

A.  

Mangan's sister's attractive figure symbolizes the better life the narrator expects when he is older and has escaped his dark neighborhood.

B.  

The light mentioned here works symbolically with the "half-opened door" motif to suggest the narrator's confusion about what path to take in life.

C.  

Mangan's sister is associated with light in the story's imagery because she is part of the narrator's hopes for a greater life.

D.  

The partial light reflects the sense of balance that the narrator seeks but finds missing in his "blind" street and dark neighborhood.

E.  

Mangan's sister, who is half-cloaked in light, symbolizes the dark buildings and bright lights of the enchanting East.

Why is it important to check for evidence in a text? to understand why the author wrote the text to disagree with the author to enjoy reading the text to determine if the text is believable If you give all answers to me I'll give extra points lol im desperate and dumb by the way this is Providing evidence quick check connexus.

Answers

To determine if the text is believable.

It becomes essentially important to check for evidences in a textual composition in order to make sure if the text is believable or not. Therefore, the option D holds true.

What is the significance of textual evidence?

A textual evidence can be referred to or considered as an evidence, which is generally referred to by an author of composition as such in order to make sure that the intended meaning behind the composition is easily interpreted by the readers.

Sometimes it becomes essential to look for the believability of a textual evidence. This gives the reader a sense of satisfaction that the writer has written a textual composition that can be easily believed as correct.

Therefore, the option D holds true and states regarding the significance of textual evidences.

Learn more about textual evidence here:

https://brainly.com/question/9355555

#SPJ2

Select the correct answer. Which is a step in the research process? A. entertaining the audience B. finding background information C. searching for presentation ideas D. discussing the reliability of a source

Answers

Answer:

D.

Explanation:

It is always important to discuss the reliability of a source so you know you are getting the right information.

The statement that is a step in the research process is discussing the reliability of a source. That is option D.

What is research process?

A research process is the steps that needs to be followed in order to conduct a research work appropriately. These steps are associated and interlinked with each other.

In research process, the step that discusses the reliability of a source helps to check the truthfulness and correctness of the information obtained from the research.

Therefore, the statement that is a step in the research process is discussing the reliability of a source.

Learn more about research here:

https://brainly.com/question/25257437

#SPJ2

The small object in the picture is an artifact from Anglo-Saxon England. What do you think this object might be?

Answers

The small object in the picture which is an artifact from Anglo-Saxon England is part of a sword.

An artifact refers to an object that shows human workmanship. It is simply an object that human beings make. Examples of artifact include stone tools, jewelry, clothing etc.

The Anglo-Saxon existed around the 5th century to the 11th century. Some of their artifacts include stone, ivory, and fresco.

In conclusion, the correct option is part of a sword.

Read related link on:

https://brainly.com/question/17363337

Which word is an example of an iamb?
O A. Compare
O B. Parachute
O C. Barbell
O D. Tiger
SUBMIT
PREVIOUS​

Answers

Answer:

O A. Compare

Hope this helps :)

Which features of epic poetry does this passage show? Check all that apply. a vast setting a supernatural force a hero with great strength a compelling, formal speech a narrative voice

Answers

1. a vast setting

3. a hero with great strength

5. a narrative voice

Answer:

1 3 5

Explanation:

Which element is necessary to complete the graphic organizer? A. Prepositional phrase B. Subject C. Complex sentence D. Subordinate clause

Answers

Answer:

The answer is Subordinate clause.

Explanation:

Because you are converting it into Independent clause.

Hope this helps....

Pls ask for more help if my answer is wrong.

Be Brainly!!!!

Have a nice day!!!!

Other Questions
PLS HELP ASAP Solve the inequality and enter your solution as an inequality in the box below 8>4-x>6 difference between photosynthesis and respiration In a survey of adults in a certain country conducted during a period of economic uncertainty, % thought that wages paid to workers in industry were too low. The margin of error was percentage points with % confidence. For parts (a) through (d) below, which represent a reasonable interpretation of the survey results? For those that are not reasonable, explain the flaw. how many are 2 raised to 2 ??? Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG This rectangular patio is tiled using 50 cm by 50 cm square tiles. How many tiles are used? Imagine that you are the supply chain manager for the Magic Widget company and you need to measure your supply chain performance. The chart shows the financial variables that you will need to perform your task. Financial Variables Total Assets (in $ billions) 15.1 Cost of Goods Sold (in $ billions) 14.3 Inventory: Raw Material Inventory (in $ billions) 0.76 Work-in-progress Inventory (in $ billions) 0.12 Finished Goods Inventory (in $ billions) 0.82 Compute the percentage of assets committed to inventory and inventory turnover. What is the quotient of 35,423 15? The plateau phase of population growth is best described as: A. The population stops growing because they moved into the plateau environment at this stage. B. The population pauses in its growth after a natural disaster before growing again. C. The population moves onto a large, raised, flat area called a plateau for protection from predator. D. The population stops growing because the environment has reached its carrying capacity. The Coriolis effect Choose one: A. causes north-flowing currents in the northern hemisphere to curve to the west. B. causes the same direction of deflection in the northern and southern hemispheres. C. is a deflection of wind or water flowing over the Earth's surface. D. is a phenomenon created by the movement of ocean currents. Light passes through a single slit. If the width of the slit is reduced, what happens to the width of the central bright fringe Our Senate has finally emerged from weeks of debate with a decided version of the Missouri Compromise. Among its list of provisions, all lands acquired in the Louisiana Purchase that are north of the southern border of Missouri, with the exception of Arkansas, will now d. Write the symbol for the nucleus that completes each nuclear equation. (1 point each) URGENT PLS HELP ASAP! THANK YOU :) What is the x-value of point A? I need some help plsssssssssssss Which of the following is a characteristic of outer planets?O Close to the sunFew moonsHave ringsRocky surfaces Find the formula for the inverse function.f(x)=2/3-4x Assume you have created a class named MyClass and that is contains a private field namedmyField and a nonstatic public method named myMethod(). Which of the following istrue?a. myMethod() has access to and can use myFieldb. myMethod() does not have access to and cannot use myFeild.c. myMethod() can use myField but cannot pass it to other methods.d. myMethod() can use myField only in myField is passed to myMethod() as aparameter. what in your home would be considered something you could study in biology?