Choosing the right dog to adopt is a big responsibility that takes some thought and planning. To begin with, there are hundreds of breeds of dogs available to pet owners. They all have the potential to be great pets, but not every breed is right for every person. For example, Veterinarian's Weekly categorizes a Jack Russell terrier as a high- energy breed. My aunt has one, and that thing is crazy! It needs walks like 24/7. Therefore, it would be best suited to a very active family that has a large yard and a walkable neighborhood. In addition to energy level, pet owners should consider the size of their dog How could this excerpt from an essay best be revised to clarify meaning and enhance style? O A. Use evidence that supports the topic sentence more clearly. B. Clarify the topic and purpose in the topic sentence. C. Use transitions to clarify the flow of ideas D. Maintain a formal style.​

Choosing The Right Dog To Adopt Is A Big Responsibility That Takes Some Thought And Planning. To Begin

Answers

Answer 1

Answer: I would say stick to a formal style. The formality would help make the overall meaning of it seem for crisp. Taking out little comments here and there and just getting right to the point would help the evidence really stand out and support it much better.

Hope this helps :)


Related Questions

what is modified cloze procedure what does it mean

need help​

Answers

The Cloze Procedure is a technique for omitting words from a passage so that the reader is forced to use background experience, knowledge of syntax, vocabulary, interest, and, generally, higher order thinking skills to fill in the blank and complete the thought.

PLZ HELP ASAP John Bunyan was imprisoned because he was an Anglican minister.

True
False

Answers

Answer:

true

Explanation:

In the 1600s , the Angelic church was seemed as a treachery because some of it's structure does not fit the Traditional Catholic ( which was was imposed on all England). John Bunyan is one of the most famous Anglican Minister in the Era. A lot of European Angelic Churches honor his death on every August 31st 

Answer:

True

Explanation:

What did Beowulf's final speech teach about Anglo-saxon values?

Answers

What does Beowulf's speech in lines 630 - 649 suggest about Anglo-Saxon values? Beowulf's speech suggests that courage is typical of an epic hero and honor is more important than life. Beowulf fought the dragon with fate against him.

At the end of the story, before Anna's leg breaks through the windshield, it thumps against the glass over and over. What effect does this have on the mood of the story? Support your answer with details from the text. Answer

Answers

Answer:

I don't know what story you're talking about, but I will attempt to make an educated guess.

It may make the story more exciting with action, but it also may induce sorrow as well.

Unfortunately since I don't know the backstory to this I cannot provide details from the text, however I hope this gave you a jumpstart!

Hope this helps! c:

Answer:

tension and suspense because at the end of the passage it says " and then everything went black" leaving the reader on a cliff hanger.

1. Select the correct sentence type for the following sentence:
Even though he prefers to eat with a fork, Jacob uses chopsticks in Asian restaurants, so he can appreciate the experience.
A. Simple
B. Compound
C. Complex
D. Compound-Complex

Answers

i would say answer b


1. On March 21 1985, our community held its bicentennial.
2. On March 21, 1985, our community held its bicentennial.
3. On March 21, 1985 our community held its bicentennial.
4. On March 21, 1985 our community, held its bicentennial.​

Answers

It’s 2 since there is a comma after 21 and 1985.

Convert 77° F into kelvins.
Conversion Formulas
C° = (F° - 329) - 1.8
Fo= 1.8 x C° + 320
K= C° + 273

Answers

77° F converts into 298.15 in kelvins

Which sentence revise the best enemas of the story setting

Answers

Answer:

There’s no story, sentences, or answers. Try retrying this answer.

Plsss I need help
As the party winds down, both Romeo and Juliet make surprising discoveries
about each other. What's the problem?

Answers

Answer:they need to break up

Explanation:

cz their families hate each other

My side of the mountain
What food does the narrator find after losing track of the crow?

Answers

Sam finds a patch of dogtooth violets.

need help no links on My question

Answers

Answer:

1.are

2. carry

3. gives

4. makes

5. has

Plz help it's due in 2 hours and no links please no links because it don't let me download the link.

Answers

Henry's meeting with Sam contributes to the theme of the story by showing that Sam is a female.  Before he met the real sam, he incorrectly thought that Sam was a male.

I believe that the theme relates to how women can do things men can do just as well and how Henry has to learn and understand this.  When Henry met Sam, I could tell that he was a little off-put by the fact that she was the diner owner and a strong woman.  In the play, Henry says "...but surely you have help from this fellow named Sam."  this shows how he wrongly assumes Sam is a male.  In the end, he even admits that "my readers and I have a lot to learn!"  

I hope this helps!

It took me a while to write this all out, and I would appreciate it if you could mark me as brainliest :-)

What types of nouns should be used in effective process writing?
Discuss the last time you explained a process to someone at home, at school, or at work
Was your explanation effective?


WILL GIVE BRAINLIST






X







X





X





X
X

X

X
X
X


X

X

X
X
X
X
X

X
X
X

X
X


















X

Answers

Answer:

person place or thing or idea

Question 10 of 10
In a multiple-choice question, the correct answer will be found:
A. in the sample.
B. in the stem.
C. among the qualifiers.
D. among the responses.
SUBIE

Answers

Answer:

In the stem.

Explanation:

this makes the answer more legible and less confusing.

Identify the verbal in the following sentence.
You can save some time by removing all the tags before using the product.
before
can save
removing
some time

Answers

Answer:

removing

Explanation:

verbal is to be doing something (took the test got it right)

Answer:

person above is correct.

Explanation:

The answer is removing

I got it right on my test

Why can't we force our emotions when we are truly happy?

Answers

Answer:

Emotions come from within and how we feel, also how we interact with those around us.

Example:

If you are alone in a dark room you will most likely be scared, or if you are in a bright colored room with people you like you will most likely be happy or neutral.

In which sentence were the commas used correctly before and after the appositives?

After the pep-rally, a player celebration we walked to the game.

After the pep-rally a player celebration, we walked to the game.

After the pep-rally a player celebration, we walked to, the game.

After the pep-rally, a player celebration, we walked to the game.

Answers

Last one after pep-rally .

What is the sentence structure? Because he needs to improve his grades,Joesph after-school tutoring, and he worked harder on his homework.

Answers

Answer:

The structure of the sentence provided is C) compound-complex.

Explanation:

Valley forge: would you have quit?

Question: how could this document be used to argue for quitting?

Answers

Answer:

is this a book? Please tell if so.

The girls, how does this poem describes gender norms for women’s

Answers

Answer:

That women are objects to men and can just be thrown away when they are bored

Explanation:

3. Rewrite the following sentences into ‘reported speech’ (5 marks)

a. There is a typhoon coming in the India Ocean.

b. I have never seen rain in this area.

c. They will go for shopping day after tomorrow.

d. We saw a pack of wild dogs on the road.

e. There are many tribes living in this area.

Answers

Answer:

a. It was reported that a typhoon was coming in the Indian Ocean

b. She said she has never seen rain in the area

c. They said they would go for shopping the day after tomorrow.

d. They said they saw a pack of wild dogs on the road.

e. It is said that there are many tribes living in this area.

Explanation:

Reported speech, which is also called indirect speech is a technique that is used to relay the content or words of a speaker without directly quoting it or changing the meaning.

Therefore, the sentences above have been changed to reported speech.

what is standardization mark of Frozen Peas?​

Answers

Answer:

Grade C. Inspection Aid 106 Universal Sizer, Inspection Aid 107 USDA Pea Sizer.

Explanation:

I think so...

What does "charging an army, while all the
world wondered" mean?

Answers

Explanation:

is there like a file to this if not i think it means ...........

Answer:

Explanation:

It means that the light brigade was insane to attempt such a charge. They were on flat ground while the enemy held the higher ground. The event let Alfred, Lord Tennyson (a pretty good poet -- who was astonished by the event ) to write about it. The sentence quoted was the key attitude about how people felt when hearing of it.

Why is the waste going to those countries instead of saying in the United States for recycling? In complete sentences

Answers

The correct answer to this open question is the following.

Unfortunately, you forgot to include the name of "those countries" that receive the waste from the United States. Without the names, we are limited to fully answer.

However, trying to help you we can comment on general terms based on our knowledge of this topic.

Many times the waste going to underdeveloped o poor countries instead of saying in the United States for recycling is because it is cheaper for the United States to send that waste abroad to those countries. Another reason is that environmental laws in the US are stricter than in other countries, so US industries have to invest more money to comply with United States environment regulations. So these industries prefer to pay to other recycling companies abroad.  

In those other countries, legislation is not as strict as in the US or sometimes environmental legislation is non-existent. The problem is that in these countries people, civilians, suffer the consequences.

In the final sentence of the passage, the pairing of the verbs "balanced" and "leaped" suggest what fine distinction regarding the character of Altaf? He is uncomfortable back in a village that he barely knows. He is uncomfortable back in a village that he barely knows. A He is finally secure in his decision to return home. He is finally secure in his decision to return home. B He looks forward to a happy reunion with his neglected family. He looks forward to a happy reunion with his neglected family. C He relishes his celebrity with the children and mimics their play. He relishes his celebrity with the children and mimics their play. D He is poised between two worlds but eager to be home.

Answers

Answer:

D). He is poised between two worlds but eager to be home.

Explanation:

As per the context(background) of the given passage, the author pairs verbs like 'balanced' along with 'leaped' to signal that although Altaf was composed under the two different worlds yet he wished to return to his home. The use of words like 'balance' symbolizes the readers that he was in a calm and assured disposition while the word 'leaped' signifies his delight and excitement to return to his home.  Thus, the most appropriate option D is the correct answer.

Answer:

D). He is poised between two worlds but eager to be home.

Explanation:

According to the passage, the pairing verbs "balanced" and "leaped" :

The creator sets action words like 'adjusted' alongside 'jumped' to flag that in spite of the fact that Altaf was made under the two unique universes yet he wished to get back to his home. The utilization of words like 'balance' represents the perusers that he was in a quiet and guaranteed attitude while the word 'jumped' means his enjoyment and fervor to get back to his home.

Thus, the most appropriate option is D .

Know more :

https://brainly.com/question/924945?referrer=searchResults

Mom and Dad_to work everyday.
Drive or Drives ?

Answers

Answer:

Drive

Explanation:

Answer: Drive

Explanation:

If you are interested in working for a specific company, what type of job site should you look at for opening?
a. Geographic specific site
b. Industry specific site
C. Company site
d. General job site

Answers

Answer:

Company site

Explanation:

You get paid a bit more if you work for a company and it can be a compa

ny for anything like outfits fashion makeup beauty etc...

PLZ HELP IM GIVING 25 POINTS AND BRAINLIEST IF ITS RIGHT ITS READING
The next question refers to This Mystery Rocks! by Cynthia Schlagel.
The sentences have been numbered to help you identify them more easily.

This Mystery Rocks! By Cyntha Schlagel

1The Drifting Rocks are a strange phenomenon still unexplained by science. 2Located in Death Valley, California, the rocks sit on hot, flat ground. 3Unlike normal rocks, they have trails etched behind them as if they have traveled across the sand. 4Some trails are only a few feet. 5Some trails are over a half a mile long. 6Each trail is as baffling as the next.

7The variety of rock movement has baffled scientists for decades. 8Some rocks seem to roll as they move forward. 9Some take unexplainable routes. 10Large ones have traveled past small ones that have stayed still. 11Some scientists suggest that the rocks are pushed by wind. 12Others believe they slide on small amounts of ice or mud. 13So far, research has not confirmed any theory.

Which sentence best identifies the main idea of paragraph two? (4 points)

a
Scientists are baffled by the different ways the rocks move.
b
Scientists are confused by the different ways the rocks move, and theories involving wind, ice, and mud have not been confirmed.
c
Scientists have theories of how the rocks move.
d
The rocks have stumped scientists because some roll, some take unexplainable routes, and some have traveled past ones that have stayed still, but scientists have theories that the rocks are pushed by wind or that they slide on ice or mud.

Answers

Answer:

I would go with A.

Explanation:

The main point of paragraph two is how the rocks move and that scientists are surprised by it. That's the main idea of this paragraph.

4. PART B: Which detail from the text best supports the answer to
Part A?
O A “That word – 'guys'– might earn smiles and nods of
understanding in that world, but it brought the ultimate
insult in my neighborhood." ( Paragraph 5)
OB "With one boy in particular, my mother had to sit me down
and explain: 'Son, perhaps there's another reason why his
parents keep making excuses for why we can't get together."
(Paragraph 18)
O c "Painful as some of these experiences were, I was grateful to
have them in middle school and high school, so that when the
time came to head for college, I already had some fluency
navigating between different cultures" ( Paragkaph 12)
OD "I watched as too many others from my hometown and other
predominantly black cities struggled in a university setting
where suddenly they really were a minority." (Paragraph 20

Answers

Answer:

“With one boy in particular my mother had to sit me down and explain.”

Explanation:

Perhaps this one “boy” doesn’t want to be a boy anymore and gets offended when the main character refers to them as a “guy” or was never a guy to begin with. In that case it would make sense that the boy would get offended

Which two methods of performing poetry are most likely to involve musical accompaniment?
a. songs and spoken word
b. slam poetry and spoken word
c. songs and slam poetry
d. slam poetry and poetry readings

Answers

Answer:

songs and spoken word.

Explanation:

The two methods of performing poetry are most likely to involve musical accompaniment as songs and spoken word. Thus the correct option is A.

What is Poetry?

Poetry is referred to as a piece of literature written with the use of lyrical or rhythmic patterns describing events in a melodious manner by reflecting thoughts and emotions to engage the readers effectively.

Lyrics, poems, sketches, and stories were spoken instead of played in spoken word, a literary and performing art. The American Beat Poet movement of the 1940s and 1950s was the predecessor to the spoken word.

A general term for poetry written with performance in mind. Even though certain spoken word poems are sometimes printed on the page, the genre's origins are in oral customs and public performances.

Therefore, option A is appropriate.

Learn more about poetry, here:

https://brainly.com/question/1852007

#SPJ2

Other Questions
A line graph titled Video Rental Stores has year on the x-axis and stores (thousands) on the y-axis. In 2009, there were 4,000 stores.The line graph shows the number of video rental stores for the years 2005 through 2012.There were stores in 2009. Which statement below is NOT a statement within the Cell Theory?A. all cells come from other cellsB. all organisms are composed of cellsC. the cell is the basic unit or organization of organismsD. all cells contain DNA (genetic information) What is wrong with the claim statement: "Everyone should use a cell phone." What is the path alcohol takes to absorb into the bloodstream? in order 1. Stomach and small intestines2. Bloodstream3. Mouth4. Throat In the circular flow model, businesses provide goods and services to whichpart of the economy?A. BusinessesB. Product marketsC. Resource marketsO D. Households The Mauryan Empire was called India's Silver Age.True or False which experimental probability from coach nelson's experiment equals the theorectical probability? what is this probability? The radius of a circle is 7 miles. What is the circle's area?Use 3.14 for . A water pipe has a flow of 2 gallons per minute how many 2 qt could fill it in 1/2 hour? April ought some sports drinks and slices of pizza for her friends. She bought 3 more sports drinks than slices of pizza. If her total was $21.25, how many sports drinks did she purchase? (1 sports drink is $1.75, one pizza slice is $2.75){System of Operations} La oracin que representa un smil es: A. . Cerca del Tajo, en soledad amena, B. . Si no regresas pronto a mi lado, morir desangrado C. Los invisibles tomos del aire D. Eres como el viento tibio de los arenale What river connects the Great Lakes to the Atlantic Ocean? PLEASE HELP WILL GIVE BRAINLIEST!! Please please only answer if you know or can help!! I need help know if what i already put is correct or how i can fix it and also the answer to question E. THANK YOU! What is correct regarding trans fatty acids hi can you please help me with my work Add the two functions. f(x) = 3x3 + 7x 26 g(x) = x + 2 Please help! Thank you! HELP mE need math help 20 points no links or imma report HeLP mE Find the area of the white region in the diagram shown. what is the mRNA in TACCGGATGCCAGATCAAATC?