Click to fix any plural or possessive errors below. If there is no error, just click
"Submit Answer." ©
When Aaron Burr needed to cross a stream, he used
several board's to build a makeshift bridge.
Answers
Related Questions
The water cycle gets its energy from the ___?
Answers
Answer:
the sun
Explanation:
Please help out! It would be very nice !!
Answers
Answer:D
Explanation:
Cell wall provides structure and protection
Answer:
D is the answer to the question
The pattern of natural selection where BOTH of the extreme versions of a trait are more advantageous than the average, so a population evolves in both directions away from the average.
Answers
Answer:
Stabilizing Variation.
Explanation:
This is the type of variation that occurs when genetic diversity decreases as the population of organism in a particular population based on a specific trait.
Organisms with varied or specific traits within the population are selected against by the selection pressure, with little chances of reproduction, while organisms in between, ( with least variation of this particular traits) which are within the narrow range, survive to reproduce.Thus, this gives rise to narrow population of these particular organisms,(stabilizing variation) which are therefore naturally selected.
Therefore, the variation of the organisms in this population is kept close to the centre of the same mean value.
All living organisms are composed of what?
Answers
All living organisms are composed of one or more cells.So, your answer would be Cell.
hope it helps!
El aparato respiratorio presenta unas células productoras de ... Que atrapan los gérmenes y el polvo. En su superficie tienen una gran cantidad de unas estructuras celulares llamadas ... Cuya función es extender el mucus y dirigirlo hacia el exterior. En el estómago, las glándulas digestivas producen el ... El cual, por su extremada ... Ataca y destruye a los ... Que se introducen con la comida y la bebida.
Answers
Answer:
The respiratory system has cells that produce MOCO OR MUCUS, which trap germs and dust. On their surface they have a large number of cellular structures called CILIAS, whose function is to spread mucus and direct it outwards. In the stomach, the digestive glands produce the STOMACH ACID, which, due to its extreme ACIDITY, attacks and destroys the PATHOGEN MICROORGANISMS that are introduced with food and drink.
Explanation:
In the respiratory and digestive apparatus there are two types of super specialized mucous upholstery, where the cellular world is challenged.
In the respiratory mucosa the production of mucus and the mobilization of the cilia are part of the innate response of the organism as well as the acidity that is generated in the upholstery and in the gastric tract.
explain how gas is compressed into liquid in a gas barrel
Answers
Explanation:
A gas can be converted into a liquid by increasing the pressure & decreasing temperature. So that the condensation occurs. You must also make the molecules closer so that it is a phase change from a gas to liquid. In liquids, the molecules are very near than that of gases.
Which answer choice correctly lists the flow of food through the GI tract (gastrointestinal tract) of the digestive system?
mouth-- stomach-- small intestine-- large intestine-- rectum
rectum-- large intestine--- small intestine--- stomach--- esophagus-- mouth
mouth-- esophagus-- stomach-- small intestine--- large intestine--- rectum
mouth-- stomach-- small intestine-- esophagus--- large intestine-- rectum
Answers
Answer:
mouth--esophagus--stomach--small intestine---large intestine---rectum
Explanation:
The image shows groundwater zones.
Top to bottom: Porous rock or soil, Water, Impermeable rock. Zone 1 is at the top of porous rock. Zone 2 is between porous rock and water. Zone 3 is in the Water. Zone 4 is between the Water and Impermeable rock.
Which is the saturated zone?
1
2
3
4
Answers
Answer:
The answer is 3
Explanation:
Hope this helps
Answer:3 or c
Explanation:
Which action would be completed by skeletal muscle tissue 1.moving blood
2.increasing the heartbeat, or 3. kicking a soccer ball
Answers
Answer:
Kicking a soccer ball
Explanation:
Answer:
Kicking a soccer ball
Explanation:because moving blood and having a heartbeat arent in need of a skeletal system
which two technologies use reflected sound waves
Answers
Answer:
one of them is SONAR
Explanation:
Other one is megaphone
Answer: There are 3 of them that are: radar, sonar and lidar.
Explanation: I used google to answer this
A virus is ________ a cell.
A)bigger than
b) the same size as
C)smaller than
d)another word for
Answers
Answer:
smaller than
Explanation:
But they're nothing compared to the giants of the cellular world. ... And viruses are smaller again — they're about a hundredth the size of our cells. So we're about 100,000 times bigger than our cells, a million times bigger than bacteria, and 10 million times bigger than your average virus
Hope this helps <3
A factory that has not followed pollution control standards has been operating in an area that did not have such a factory before. Plants that used to grow well are not doing well. Fish in a nearby river are dying at a higher rate than usual. Why?
A Pollution from the factory is getting into the rain, which is making the pH levels in the soil and water rise.
B It hasn't rained enough and the plants aren't getting enough water.
C The factory has increased the temperature in the area.
D Pollution from the factory is getting into the rain, which is making the pH levels in the soil and water become lower.
Answers
Answer:
D
Explanation:
If the pH levels are becoming low then the water and dirt becomes acidic killing fish and plants
What is the role of DNA in an organism ? how is dna related to reproduction
Answers
Answer:
DNA plays a role in the growth and reproduction of organisms.The function of DNA is to store all of the genetic information that an organism needs to develop, function, and reproduce.DNA contains the instructions needed for an organism to develop, survive and reproduce.
DNA is a molecule that stores____information in the cells
Answers
Answer: instructions
Explanation: trust me
Answer:
genetic
Explanation:
Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG
Answers
Answer: DNA
Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.
RNA has all of those except for adenine which is replaced with Uracil.
I need to list the order of traits from sponges to mammals in which they appear from an evolutionary standpoint. I don't know how to find the correct order
Answers
Answer:
please put a picture of the work you have to do so i can help you
Explanation:
A multicellular organism typically begins as a single cell, and then many cell divisions occur to generate the cells of the adult organism. However, these cells are not identical to the original cell, and they are not identical to one another.
What is the most significant cause of cell differentiation in a multicellular organism?
A.
differences in the number of chromosomes per cell
B.
differences in the genetic code used by different cells
C.
differences in the DNA that is copied and distributed among the cells
D.
differences in gene regulation and gene expression among the cells
Answers
Answer:
D
Explanation:
Difference in cell regulation and cell expression. This is embedded in chromosomes which is the blue print of the organism. The chromosomes is like the house plan when you building a house.
The most significant cause of cell differentiation in a multicellular organism is: D. differences in gene regulation and gene expression among the cells.
What is cell differentiation?Cell differentiation can be defined as a process through which a young, unspecialized cell undergoes various changes in gene expression, so as to become a specialized that is more specific in terms of function.
In a multicellular organism, which is an organism with multiple cells, the most significant cause of cell differentiation is as a result of differences in gene regulation and gene expression among its cells.
Read more on cell differentiation here: https://brainly.com/question/13846411
A 30 kg object has 3 forces acting on it - one 40 N force to the right, one 20 N force to the right, and one 30 N force to the left. What is the acceleration of the object?
A. 1.0 m/s2 to the right
B. 0 m/s2
C. 1.6 m/s2 to the right
D. 3 m/s2 to the left
Answers
Answer:
Thats not biology , that's physics . Net force = F1+F2-F3=40+20-30=60-30=30
F=ma.
30=30a
a=30/30
a=1m/s^2
Which sex cell is produced in males?
Answers
Answer:
Sperm
Explanation:
Answer:
Sperm
Explanation:
. Why is the carpel considered female and the stamen male?
Answers
Answer: A carpel is the female reproductive part of the flower, interpreted as modified leaves that bear structures called ovules, inside which the egg cells ultimately form and composed of ovary, style and stigma. Stamen, the male reproductive part of a flower, consisting of a long slender stalk and the pollen-producing anther.
Explanation:
The landform pictured above is _____, which has formed out of _____ and _____.
O A. a glacier, snow; ice
B. a glacier; ocean water, snow
O C. a mountain; snow; ice
OD. an iceberg; ocean water, snow
Answers
Answer: a glacier; snow; ice
Explanation:
Just did it and it was right
Which of the following delivers oxygen to the body?
Mark all that apply
Arteries
Veins
Capillaries
Hemoglobin
Answers
how did darwin’s theory of evolution change the way biologists thought about classification categories
Answers
Answer:
hhh3h3h3hgegegegegeggegsgsggs
y
Explanation:
hhhhhhshshshshhdhdhdhghdhgd
Can somebody help with those 3 problems please
Answers
Answer:
first one is option A
second one option B
third is26 N
Explanation:
1.the law here is every action has an equal and opposite......
2. only unbalanced forces move objects from rest or of uniform motion
3.net force is the sum of forces ,if forces are in the same direction
hope this helps plz mark me brainliest
Force is directly proportional to the mass. As the mass of the fuel deceases as the fuel is burnt, the force also decreases as force is directly proportional to mass, and as the force decreases, the acceleration decreases as acceleration is also directly proportional to the force, and the shuttle may eventually come to a stop due to the increasing deceleration. However, initially if the forces are kept balanced as the space shuttle and the gases exert an equal amount of force on each other in the directions opposite to each other, the object will keep on moving upwards in a constant velocity as the amount of force is also kept constant.
3) Option B.
The motion will definitely change when the forces acting on an object are unbalanced-it will start to move, accelerate or decelerate or change its direction in the direction of the net force. The object will not move at all or continue moving with the same velocity and in the same direction if the forces acting on it are balanced or zero.
4) When the forces are unbalanced and are acting on an object in the same direction, the net force will be found by finding the sum of those forces.
Net force=17+9=26 N.
I really, really hope this helps! And please mark it as brainliest.
What are the differences between parents and offsprings ?
Answers
Answer:
Offspring is a person's daughter(s) and or son(s); a person's child. While a parent is one of two persons from whom one is immediately biologically descended; a mother or a father.
Answer:
Parents have offspring
Explanation:
Offspring is the result of sexual or asexual reproduction by parents.
1. Summarize the scientific information that leads to conservation in each of the articles.
2. What social issues affected the problem or its solution in each of the stories?
3. How did economics delay scientists' first attempts for conservation in each story?
4. Describe the political actions that led to successful conservation in both stories.
Answers
Answer:
Explanation:
BY USING FOREST WISELY;
It was learnt that people are cutting trees at an worrying rate.This problem is disturbing because ;
1)Those trees are responsible for releasing of oxygen and they made up at least a quarter of the world population.
2) Those trees of the world make up of portion land species by more than forth or fifth portion.
There are also economic implications as a result of trees been cut down, when there is no availability bot trees , it could result to situation whereby there would be scarce of resources for industries as well as
hike price of paper in market, regardless of this trees are needed for manufacturing of important materials such as usage in making houses and others developments or growth
Therefore, all the afformentioned economic concern result in economics delay scientists' first attempts.
COMMUNITY CONSERVATION;
It was learnt that there is to the forest that those gorilla habitated, those human being that reside in those region reside there so they can practice their farming because their is available land there. They also reside there because of housing.
These gorillas were affected as a result of the destruction made to their habitat as well as the activities of the poachers that hunt them for production of the and skin.
There are adverse effect of the obliteration of the gorilla from on the society, it can result to having reduction in tourism in country such as
Uganda as well as Rwanda, as result of this the means of livelihood of people in that part could be affected because there would be Reduction in profit making. Hence the reason behind the increase in number gorillas in the region, because they know they know that those gorilla influence the number of tourist that comes there and the revenue that is generated through this tourism.
The article 'By using Forest Wisely' can be summarised as:
People are cutting trees at the wrong rate and trees play a crucial role in an ecosystem. The trees produce oxygen and they made up at least a quarter of the world population.The trees occupy the fourth or fifth portion of the land organisms.In the absence of trees, the ecosystem will fail and the organisms dependent on them will eventually die. The resources available from the trees will be scarce and the factories and industries that are dependent on trees will no longer be available. Trees are required for manufacturing important materials.The article 'Community Conservation' can be summarised as:
In the article, it was mentioned that the human populace urbanized the land region where gorillas were habituating. The humans occupied the space to practice farming and make houses. The population of the gorillas was disturbed and diminished. The hunting of gorillas by poachers was also reduced. The people of Uganda and Rwanda also suffered reduction tourism and conservation of wildlife. Gorillas influence the number of tourists, therefore, the destruction of their habitats led to a reduction in profit-making.Therefore, all the mentioned economic concerns result in economics delaying scientists' first attempts.
To know more about forest conservation, refer to the following link:
https://brainly.com/question/16505239
Food contains a sugar called , which is broken down in a process called cellular . This process uses to break down food molecules and provide energy for cells.
Answers
Answer:
I think it is glucose.i hope this helps!
Explanation:
Answer:
the correct answers are glocose, respiration, and oxygen
Explanation:
i got it right
State the three parts of the cell theory.
Answers
Answer:
The three parts of the cell theory are: cells are the smallest unit of life; all cells come from preexisting cells; and living thing is made up of one or more cell.
burning fossil fuels, it makes the Earth colder.
What percent of the atmosphere is carbon dioxide?
A.4%
B.0.4%
C.40%
D.0.04%
Answers
Answer:
B i took the test
Explanation:
Answer: D
Explanation: Only 0.04% of the atmosphere is carbon dioxide.
Glaciers pushing rocks against rocks is an example of
Answers
Answer:
Erosion??
Explanation:
Answer:
Glacial Erosion
Explanation:
