como afecta la República Dominicana su geografía y locación en el mar Caribe?

Answers

Answer 1

Answer:

oi

Explanation:

oi mate

Answer 2

Answer:

La República Dominicana ocupa los dos tercios orientales de la isla y Haití ocupa la parte occidental. Al norte está el Océano Atlántico y al sur está el Mar Caribe. ... Es el punto más alto del Caribe y a menudo está cubierto de escarcha durante el invierno.

Explanation:

Espero que ayude


Related Questions

What did Gorbachev offer the people that led to an end of the Cold War?
Monetary gain
Religious opportunities
Opportunity to travel
Freedom

Answers

Answer:

freedom

Explanation:

Ultimately, the deepest causes of the Soviet collapse were the decline of communist ideology and economic failure. This would have happened even without Gorbachev. In the early Cold War, communism and the Soviet Union had considerable soft power. Many communists led the resistance against fascism in Europe and many people believed that communism was the wave of the future.

But Soviet soft power was undercut by the exposure of Stalin's crimes in 1956 and by the repression in Hungary in 1956, Czechoslovakia in 1968, and Poland in 1981.

Although in theory communism aimed to establish a system of class justice, Lenin's heirs maintained domestic power through a brutal security apparatus involving lethal purges, gulags, broad censorship and ubiquitous informants. The net effect of these brutal measures was a general loss of faith in the system.

The Soviet economy's decline, meanwhile, reflected the diminished ability of central planning to respond to global economic change. Stalin had created a command economy that emphasised heavy manufacturing and smokestack industries, making it highly inflexible—all thumbs and no fingers.

As the economist Joseph Schumpeter pointed out, capitalism is "creative destruction", a way of responding flexibly to major waves of technological change. At the end of the 20th century, the major technological change of the third industrial revolution was the growing role of information as the scarcest resource in an economy.

The Soviet system was particularly inept at handling information. The deep secrecy of its political system meant that the flow of information was slow and cumbersome.

Economic globalisation created turmoil throughout the world at the end of the 20th century, but the Western market economies were able to reallocate labour to services, restructure their heavy industries and switch to computers. The Soviet Union could not keep up.

Indeed, when Gorbachev came to power in 1985, there were 50,000 personal computers in the Soviet Union; in the United States, there were 30 million. Four years later, there were about 400,000 personal computers in the Soviet Union, and 40 million in the US.

Answer:

freedom :)

Explanation:

In what ways could the Black Death have led to improvements in health in surviving populations????????

Answers

Answer:

It could have lead to improvements like understanding how to quarantine properly, how to survive during it, staying home, etc.

I hope this helped!

3. According to Madison: (Select all that apply)
a) Ultimately, we must have faith that government will be run by enlightened statesmen who put themselves above politics and seek the public good.
b) Where there is no impartial judge to settle disputes the most powerful faction is likely to prevail
c) Settling disputes must be done by the people themselves, not by government authority
d) Many important acts of legislation, including taxation, require an impartial judge.

4. Why does Madison reject a pure democracy (a system where a small number of citizens assemble and administer the government in person)? (Select all that apply)
a) It can control factions if they are a minority but not if they form the majority
b) It doesn’t protect the weaker party in disputes
c) It cannot cure the mischiefs of faction
d) It is always incompatible with the rights of property and personal security

5. According to Madison, the true interests of the country are best determined by:
a) The election of a chosen body of citizens
b) The people themsleves
c) George Washington
d) By those committed to the protection of their property

Answers

Answer:

Read below

Explanation:

3: A ( Madison supported the good of the public )

4: C and maybe B (C because you can compare our world today that theres still some stuff needed to be fixed and maybe b because stuff like the Green's or whatever political parties that are small don't get there voice heard )

5: B ( since the country was meant to be decided by the people )

Which of the following explains the most likely purpose of Gonzalo’s answer to the second question in the interview?

Answers

Answer:

To justify the Shining Path’s use of violence to achieve its political objectives.

Explanation:

First, some context: the Shining Path was a revolutionary organization that endorsed employed guerrilla tactics and violent terrorism to overthrow the Peruvian government and establish a communist society.

In the interview, Gonzalo is asked about the people’s war. He discusses two of the aspects of this war. To state it simply, there needs to be change in a government.

This idea is used to promote the Shining Path and “demolish the outmoded Peruvian government.”

To justify the Shining Path’s use of violence to achieve its political objectives the most likely purpose of Gonzalo’s answer to the second question in the interview. Thus, option (c) is correct.

What is interview?

The term interview refers to a formal meeting with the involvement of two people as interviewer and interviewee. The interviewer is one who asks questions and the interviewee is one who answers questions. The conversion is related to the skills, knowledge, and experience related to the job.

Gonzalo’s answer to the second question in the interview was he discuss on the war. Gonzalo’s was they confidently answer the Shining Path’s use of aggression to accomplish its political aims. Shining Path was a revolutionary social group are the violent act of terrorism.

As a result, the significance of the Gonzalo’s answer to the second question in the interview are the aforementioned. Therefore, option (c) is correct.

Learn more about on interview, here:

https://brainly.com/question/13073622

#SPJ6

Your question is incomplete, but most probably the full question was.

Which of the following explains the most likely purpose of Gonzalo's answer to the second question in the interview?

A. To call for the prosecution of those responsible for mass violence in Peru

B. To challenge the continued political influence of Western states in Latin America

C. To justify the Shining Path's use of violence to achieve its political objectives

D. To appeal to politicians in Latin American states to adopt reforms to their respective political institutions

What are common mistakes people make when investing

Answers

Answer:

Not Understanding the Investment.

Falling in Love With a Company.

Lack of Patience.

Too Much Investment Turnover.

Attempting to Time the Market.

Waiting to Get Even.

Failing to Diversify.

Letting Your Emotions Rule.

Explanation:

What is a civil war?

Answers

Answer:

a war between citizens of the same country.

Explanation:

wich fight for civil rights

Answer:

a civil war is when a community is essentially split into opposing sides due to their different on a subject. They go to war with each other and the winning sides opinion is what stays

the government vs. the people

Explanation:

a community in this instance would be a country or a state.. a place that is unified by law

What does the judicial branch do? Check all that apply.

It is B,C,E,F
Got it right

Answers

Answer:

ok..

Explanation:

Answer:

What does the judicial branch do? Check all that apply.

X creates new laws

O rules on legal cases

O explains the meanings of laws

X operates departments and agencies to carry out laws

O resolves disputes about laws

O decides whether a law is constitutional

Explanation:

edge 2021

what does swagger mean​

Answers

Answer:

The description of the given topic is summarized throughout the explanation portion below.

Explanation:

Swagger enables you to create someone's API's configuration throughout order to facilitate machinery or computer to understand it.

The system can specify clients' API sequentially, or even have documentation or data throughout your programming language opportunities are being created.The power among APIs that could identify themselves would be at the core of Swagger's awareness.

1. A/An
is a form of government in which citizens
choose their leaders by voting.

Answers

Answer:

A "Republic" is a form of government in which citizens choose their leaders by voting.

Explanation:

Which of these is the Federal Trade Commission (FTC)?

A. cartel

B. consumer advocacy group

C. government contractor

D. competition regulator

Answers

Answer:

Explanation:

D: Competition regulator

The Federal Trade Commission is the Competition regulator. Thus, option D is correct.

What functions does the Federal Trade Commission have?

The Federal Trade Commission strives to stop unfair, dishonest, and fraudulent commercial activities. They also offer information to aid customers in recognizing, avoiding, and stopping fraud and scams.

Our goal is to defend consumers and the free market by eliminating unfair, dishonest, and anti-competitive corporate activities without unreasonably impeding legitimate commercial activity. We are the only federal organization that addresses concerns about financial regulation and competition in a variety of economic sectors.

The Federal Trade Commission is in charge of regulating the market. Option D is correct as a result.

Learn more about the Federal Trade Commission here:

https://brainly.com/question/891256

#SPJ3

Which statement accurately describes the us Supreme Court

Answers

Answer:

The US Supreme Court was inherent to the early success of the United States, and remains one of the three main bodies of power. The answer is D.

"The first elected Congress gave the Supreme Court the power to declare laws unconstitutional."

Explanation:

Question 7
Gambling in the long run can never be an investment and is always about losing
money, not making money.
True.
False.

Answers

I believe it is false option 2

Did the Olmecs settle near a river? What is the name of the area?

Answers

La Venta, ancient Olmec settlement, located near the border of modern Tabasco and Veracruz states, on the gulf coast of Mexico. La Venta was originally built on an island in the Tonalá River; now it is part of a large swamp.

The Carolingian Renaissance included all of theses developments listed below, except
a. the growth of monasteries and convents.
b.architectural innovations including the transept.
O c. a revival of Aristotelian philosophy.
d. a clearer style of writing and lavish illumination.
Please answer quickly I am doing an assignment.

Answers

The answer to the question is c

Economics is also weighing and choosing between two options before
your, by weighing what it will cost you to do or not to do that thing. You weigh the benefits and losses. True or false

Answers

Answer:

True.

Explanation:

Economics is also weighing and choosing between two options before you, by weighing what it will cost you to do or not to do that thing. You weigh the benefits and losses.

This cost benefit analysis is somewhat considered to be an opportunity cost.

Opportunity cost also known as the alternative forgone, can be defined as the value, profit or benefits given up by an individual or organization in order to choose or acquire something deemed significant at the time.

Simply stated, it is the cost of not enjoying the benefits, profits or value associated with the alternative forgone or best alternative choice available.

Which president would have been most likely to agree that access to higher
education among impoverished Americans required government
intervention?
A. Lyndon B. Johnson
B. Richard Nixon
C. George H. W. Bush
D. Ronald Reagan

Answers

A. Lyndon B. Johnson

Why did support for temperance grow during World War I?

A. Leaders of the temperance movement had strong connections to the military.
B. People believed that grain should be used to feed soldiers rather than to make alcohol.
C. People feared that drinking would prevent soldiers from effectively fighting in the war.
D.

Answers

Answer:

A. Leaders of the temperance movement had strong connections to the military.

The horrors of war encouraged people to protect their families by reducing alcohol use.

Answer:

B. People believed that grain should be used to feed soldiers rather than make alcohol

Explanation:

(I took a quiz)

Why were state run schools important to Stalin's communist goals

Answers

Answer:

Explanation:

Communist schools benefited the state and the communist parties because the schools educated future workers in order to build a modern industrial state. In addition, the schools taught communist values so they were grooming the next generation of communists.

What would you have done to survive in the Donner Party?Only answer if you're very good at History.Please don't put a link to a website.​

Answers

Answer:

Explanation:

I would have started by trying to bring a Native American guide along. It seems the Donner party wasn't very fluent in Native American customs, and before venturing into the west without an experienced guide. Sometimes having the right people on your team makes an effort easier.

Their fate was pretty much sealed by Jim Bridger, who hid letters from Edwin Bryant that advised against traveling on Hasting's Pass with wagons. At some point, before winter, I would have made a makeshift shelter for the women and children, and left a few men to guard them. I would have sent the rest of the men forward to explore the rest of the pass or find more help, fresh horses/oxen and more wagons to carry their belongings.

By stopping somewhere before winter, they could have taken advantage of any wild-grown food from the late summer and fall harvest seasons. When food got very scarce, I would have starved myself so my children would eat. I would like to say we would never have resorted to cannibalism. But desperation to keep children alive puts people's ethics at risk of being compromised. And for some, desperation to stay alive themselves makes them put their ethics aside.

I hope this gives you some ideas for your answer.

What is the purpose of this 'encyclopedia entry' in 1932?









In 1932 Mussolini wrote the entry below for the official Italian Encyclopedia​

Answers

whats the question??

Which of the following is NOT true of women serving in war?

Answers

Answer:

Hey! can you show me the picture of it please?

Racing toward War
Place these events in the correct order
Archduke Ferdinand was
Austria declared war on
Russia mobilized its
Germany declared war on
Britain declared war on
assassinated
Serbia
forces
France and Russia.
Germany
Correct!

Answers

The correct answer is Archduke Ferdinand was assassinated, Austria declared war on Serbia, Russia mobilized its forces, Germany declared war on France and Russia, and Britain declared war on Germany.

Explanation

The aforementioned events are part of the European warlike conflict known as World War I, which pitted the triple alliance against the triple entente. The first event that occurred during this war was the assassination of Archduke Francisco Fernando on June 28, 1914, at 11 a.m. in Sarajevo. After this, Austria-Hungary made a declaration of war against Serbia on July 23, 1914. This event caused Russia (allying with Serbia) to mobilize its troops towards the Baltic and Black Seas and the cities of Odesa, Kasan, Moscow, and Kyiv.

In response to Russia's military mobilization, Germany decided to declare war on August 1 and two days later on France (also allied with Serbia).

A day later, the United Kingdom entered the war by declaring war on Germany on August 4, since Germany had attacked Belgium even though it had remained neutral so far.

So the correct answer is Archduke Ferdinand was assassinated, Austria declared war on Serbia, Russia mobilized its forces, Germany declared war on France and Russia, and Britain declared war on Germany.

Answer:

1 Archduke

2 Austria

3 Russia

4 Germany

5 Britain

Explanation:

How did the Cold War end?

Answers

During 1989 and 1990, the Berlin Wall came down, borders opened, and free elections ousted Communist regimes everywhere in eastern Europe. In late 1991 the Soviet Union itself dissolved into its component republics. With stunning speed, the Iron Curtain was lifted and the Cold War came to an end.

Study the graph showing GDP in the US.

A line graph titled G D P Growth in the U S. The x-axis is labeled Year from 2004 to 2014. The y-axis is labeled Percent Growth from negative 4 to 6. 2004 is at 4 percent. 2006 is around 3 percent. 2007 is at 2 percent. 2009 is under negative 2 percent. 2010 is at 2 percent. 2012 is at 2 percent. 2014 is over 2 percent.

What conclusion can be drawn about the US economy as a whole between 2006 and 2009?

It remained level.
It declined steadily.
It wavered in growth.
It rose from a downturn.

Answers

Answer: it declined steadily

Explanation:

Took the test :)

How do the respiratory and circulatory systems work together to make gas exchange possible?

Answers

Answer:

Gas exchange between tissues and the blood is an essential function of the circulatory system. In humans, other mammals, and birds, blood absorbs oxygen and releases carbon dioxide in the lungs. Thus the circulatory and respiratory system, whose function is to obtain oxygen and discharge carbon dioxide, work in tandem.

Explanation:

brainliest plz

Answer:

The respiratory system works directly with the circulatory system to provide oxygen to the body. Oxygen taken in from the respiratory system moves into blood vessels that then circulate oxygen-rich blood to tissues and cells.

Pls brainliest it would really help! Hope I helped!

Explanation:

The Dust Bowl of the 1930s was caused by_______(choose multiple answers) ∆earthquakes
∆volcanic eruption
∆erosion
∆overgrazing
∆the clearing of grasslands
∆fertilizer runoff​

Answers

Answer:

Erosion, overgrazing, and the clearing of grasslands.

Explanation:

Answer:

Erosion, overgrazing, and clearing of grassland

Explanation:

got it right thanks to the other person.

One negative effect that tourism has had in the Caribbean is that it

A. takes jobs from local workers
B. leads to water shortages
C. has destroyed the sugar-based economy
D. has led to greater government control over the economy​

Answers

ANSWER:

From natural habitat loss, reduction in biodiversity, over-exploited land and water resources, pollution (land and marine) and coral reef damage, tourism places a great deal of stress on the natural resources on which it depends.

The answer is B-Leads to water shortages

Can I have brainliest please and have a good day :)

Until it was destroyed, the Library of Alexandria was important in Ancient Egypt because

A) Pharaoh Ramses II was buried there.
B) it taught most Egyptians how to read & write.
C) it served as center of learning and scholarship.
D) Caesar constructed it during his conquest there.

Answers

Answer:

The library of Alexandria was important in Ancient Egypt because C. it served as a center of learning and scholarship.

Hope this Helps!

Supporters of the view expressed in "An Awful Blot" would most likely call for
which of the following government actions?
O A. Expanded subsidies for industrial entrepreneurs
B. Increased regulation and oversight of industry
C. Reduced westward expansion into rural areas
D. Restrictions on strikes and labor stoppages
SUBMIT

Answers

Answer:

B increased regulation and oversight of industry

Explanation:

took the test

Answer:

Increased regulation and oversight of industry

Explanation:

What are the highlands in the northern portion of South America tha separate Venezuela, Suriname, and French Guiana from Brazil?

Answers

Answer:

Guiana Highlands, plateau and low-mountain region of South America located north of the Amazon and south of the Orinoco River.

Other Questions
what is the mRNA in TACCGGATGCCAGATCAAATC? a cup of coffee is left to cool inside a room and its cooling can be described by the function y = 85(.75)x/5 + 15 where x is time in minutes and t is the temperature of the coffee in degrees celsius. Help!!! I do not seem to understand this problem well. Dr. Seals borrows $15,000 to remodel her backyard. The interest rate is 3%. The interest is compounded twice a year for two years. Why would an investor want to choose a certificate of deposit over a corporate bond describe how the state of Washington and its residents played a huge part in winning World War II? Plzzz help NEED THIS FAST!!! What's the circumference of a circle with a radius of 10 inches Explain the lifecycle of mosquito in short Layla is going to invest $5,200 and leave it in an account for 15 years. Assuming the interest is compounded monthly, what interest rate, to the nearest tenth of a percent, would be required in order for Layla to end up with $13,800? Most Americans consume a varied diet. They eat foods that are both plant- and animal-based. Which words are clues to the meaning of the word consume? A. are both B. eat foods C. animal-based D. Most Americans plz no bit.yl stuff, just answers Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?A.It shows that a disease can cause genetic changes.B.It is a reflection of how genetic factors affect health.C.It shows how public health is affected by environmental factors.D.It indicates how a toxin can play a role in the development of disease. Find the surface area of this prism.Round to the nearest tenth. why is it important to save energy in our daily lives Solve for x. Round your answer to the nearest tenth (one decimal place). Red and white blood cells are produced inside the __________ of bones. This is an interaction between the skeletal, circulatory, and immune systems.A. MarrowB. Spongy BoneC. Compact BoneD. Liver What classification is an E7018?will give brainliest I will mark Brainliest for frist answer This Question: 1 pt20 of 20This QuthThe pH of a fruit juice is 2.9. Find the hydronium ion concentration, [H30 * ), of the juice. Use the formula pH = -log[H30*]The hydronium ion concentration [H30 + ] is approximately moles per liter.(Use scientific notation. Use the multiplication symbol in the math palette as needed. Round to the nearest tenth as needed.) A worldwide organization of academics claims that the mean IQ score of its members is 118, with a standard deviation of 17. A randomly selected group of 40 members of this organization is tested, and the results reveal that the mean IQ score in this sample is 115.8. If the organization's claim is correct, what is the probability of having a sample mean of 115.8 or less for a random sample of this size When riding your bike on a main road you should always follow the rules of the _________.roadbikers guidewalkerstown they are riding in