contrast primary growth and secondary growth

Answers

Answer 1

Answer:

There are contrast of the Primary growth and Secondary growth in many ways.

Explanation:

The Primary growth is to increase the length of that shoot and the root is referred to the primary growth.The primary growth act the way as shoot apical causing extension to the growth system into the root and ground they root are apical.The primary growth is the plant into that ground to contain water and nutrients that with the soil relation.The primary growth is that root can take different forms depends on the plant is Mono cot,the primary root replace by the stem after the plant germinates its called Adventitious root.The secondary growth is that performed to increase by the girth of the plant.Secondary growth is to produce the lateral cambiums that layer of tissue add to the plant growth.Secondary growth is that performed and support from the shoot system into the transporting  that water and nutrients.Secondary growth is to provide the cross section of the stem and the replace with newer layer, the layer of that growth bark.Secondary growth is to consist that bark remain that the narrow of band, it root is transformed.


Related Questions

A mangrove swamp is more likely to exist along shores of which location?

Answers

They are likely to exist in tropical and subtropical tidal areas

Saguaro cacti are very tall cylindrical plants that usually have two L-shaped arms, one on each side. Suppose you lived in southern Arizona where the Saguaro cactus is common and you happen to have one growing in your yard. Your Saguaro has two arms but one is longer than the other. Now, assume that arm length in these cacti are controlled by a single gene with arms of the same length (A) being dominant to arms of different lengths. What is the genotype of your cactus

Answers

Answer:

The genotype is aa. Sorry if I am wrong.

Explanation:

I put the answer in the wrong spot xD

In the quest to understand the basis of infertility in humans, researchers have identified a mutation in a gene associated with chiasmata. This protein normally acts to promote homologous recombination.Why might a defect in homologous recombination have consequences for fertility?A. The chiasmata halts the whole process of meiosis, if crossover do not form properly.B. Crossover formation is a necessary step in meiosis I to ensure proper chromosome segregationC. A checkpoint requires a certain level of genetic variability for meiosis to proceed.D. Chiasmata are the connections between the centromeres and the centromeres that pull them to each pole of the daughter cells.

Answers

Answer:

B. Crossover formation is a necessary step in meiosis I to ensure proper chromosome segregation

Explanation:

Crossing-over is a unique phenomenon that occurs in the prophase I stage of meiosis I, where non-sister chromatids of homologous chromosomes exchange their chromosomal segment. The physical point where this exchange occurs is called CHIASMATA. Hence, a mutation that affects the gene associated with the chiasmata will affect the occurrence of crossing over or homologous recombination.

Crossing-over, through the formation of the chiasmata, is responsible for the physical alignment and proper segregation of chromosomes into gametes. Naturally, the chiasmata formed as a result of recombination during meiosis helps ensure that the chromosomes stay together until it is the right time to separate. This way, any chromosomal defect in the resulting gamete is prevented.

However, an error or defect in homologous recombination might give rise to gametes with chromosomal disorder, a condition known as ANEUPLOIDY i.e. missing or additional chromosomes in gametes. This can affect the fertility of the involved human.

The medical term ____________________ describes a pus-filled lesion on the eyelid resulting from an infection in a sebaceous gland.​

Answers

Answer:

the medical term is hordeolum

Assume that the allele for curly tail is completely dominant to the allele for straight tail for an X-linked maternal effect gene. Which of the following can be true?

a. In order for a female to be curly tailed, her father must be curly tailed.
b. A straight tailed male must have a straight tailed mother
c. mother with a straight tail cannot have progeny with curly tails
d. A male with a curly tail received a straight tail allele from his mother.

Answers

Answer:

A

Explanation:

In order for a female to be curly tailed, her father must be curly tailed.

If tall is dominant over short, and yellow seed is dominant over green, how would you write the genotype of a pea plant that is heterozygous for tall, and that produces yellow seeds

Answers

Answer:

The answer has been written in paper and the image of the paper has been attached. Feel free to raise any doubt.

what are 3 major functions of the femur?

Answers

Answer:

The femur is the longest bone in the human skeleton. It functions in supporting the weight of the body and allowing motion of the leg. The femur articulates proximally with the acetabulum of the pelvis forming the hip joint, and distally with the tibia and patella to form the knee joint.

Explanation:

Holding the body weight once standing and moving. People are being stabilized as they move. Connecting the hips and knees' muscles, tendons, and ligaments to the rest of your body. These are three functions of femur.

What is femur?

The femur is the bone in the thigh. It is person's body's longest and strongest bone. It is an essential component of the ability to stand and move.

There can be many functions of this bone, some are listed below:

Hold the body weight.Stabilize the body while moving.Connecting hip and knees.

Thus, above mentioned are three functions of femur.

For more details regarding femur, visit:

https://brainly.com/question/3264785

#SPJ2


Fermentation converts organic material into a fuel whose primary component is
A. methane
B. sugar
C. yeast
D. alcohol​

Answers

Answer:

D. alcohol

Explanation:

Fermentation by microorganisms converts organic materials into alcohol

Cloning to produce embryonic stem cells is called A) regenerative cloning. B) transplantational cloning. C) reproductive cloning. D) therapeutic cloning. E) dedifferentiation.

Answers

Answer:

D

Explanation:

The correct option would be therapeutic cloning.

First and foremost, cloning refers to the process of producing genetically and phenotypically similar organisms or cells from a single organism/cell, be it naturally or artificially. The genotypically and phenotypically similar copies of the original organism are called clones.

Artificial clonings are of different types, namely:

Reproductive cloningGene cloningTherapeutic cloning

Reproductive cloning has to do with producing genetically identical organisms from a particular organism while gene cloning involves producing exact copies of a gene or segments of DNA. Therapeutic cloning, however, involves the production of embryonic stem cells in order to create tissues that would replace similar but damaged or worn-out tissues in living organisms.

Correct option: D

You cross a plant with red flowers with a plant with white flowers. Both plants are pure-breeding. All the offspring have pink flowers. What allele relationship does this display? codominance multiple alleles incomplete dominance pleiotropy

Answers

C. Incomplete dominance.

Explanation:

Incomplete dominance is the blending of alleles. If a plant with red flowers and a plant with white flowers produce offspring, then the flowers will be pink. Red and white mixed together will be pink, the alleles blended.

Codominance is where both traits are present, no blending occurs. If a plant with red flowers and a plant with white flowers produce offspring, the flowers will be both white and red. The flower may be white with red spots, or vice versa. Both alleles are present in the flower.

In this case, it is incomplete dominance, as the offspring is a mix of the parents. The alleles blend and the offspring is pink.

Answer:

incomplete dominance

Explanation:

gradpoint

Two of the many cycles in nature's web of life are the carbon cycle and the A. energy cycle B. water cycle C. food cycle D. heat cycle

Answers

━━━━━━━☆☆━━━━━━━

▹ Answer

B. water cycle

▹ Step-by-Step Explanation

Water is something that is dependent on amongst living things. Without the water cycle, there wouldn't be a source of water and living things wouldn't be able to survive.

Hope this helps!

CloutAnswers ❁

━━━━━━━☆☆━━━━━━━

Mechanical energy is the sum of energy and energy in a system

Answers

Answer:

kinetic and potential energy

Answer: Hey There,

Explanation: In physical energy is the sum of potential energy and kinetic energy.

Examples for mechanical energy are:

hammerdart gunwind millbowling ballhydropower plantcyclingmoon

The seven forms of energy:

meachanical,heat chemical, electrical radiant , nuclear and sound.

OKAY, I HOPE IT HELPS YOU TO UNDERSTAND

The basal side of epithelium is always connected to?
A) basement membranes
B) connective tissue
C) epithelial cells
D) blood vessels

Answers

Answer:

Basement membranes

Explanation:

DNA and RNA are structurally similar in some ways, but different in others. Identify whether each of the following statements applies to DNA, RNA. both or neither.
1. It can contain the purine adenine.
2. It can contain the pyrimidine uracil.
3. This contains the pyrimidine thymine.
4. In terms of base composition, the %T = %G.
5. This contains the sugar ribose.
6. The sugars are connected with a 3'-5' phosphodiester link.
7. It contains equal amounts of guanine and cytosine.
8. Bases are attached to sugars in an alpha N-glycosides linkage.

Answers

Answer:

DNA

It can contain the purine adenine

This contains the pyrimidine thymine

The sugars are connected with a 3'-5' phosphodiester link.

It contains equal amounts of guanine and cytosine. The percentage of A-T ,C-G are the same in DNA,,they are linked by hydrogen bonds.But varies in RNA.

Explanation:

.RNA

It can contain the purine adenine.

It can contain the pyrimidine uracil

This contains the sugar ribose. This is a 5C sugar with one oxygen atom deficient.The forms the lever for holding the bases and phosphate group

The sugars are connected with a 3'-5' phosphodiester link.This is the backbone of both DNA and RNA.It is formed between the sugars and the phosphate groups in both DNA and RNA.

None is made of  base composition, the %T = %G. This is wrong because purines must pair with pyrimidine,but not two purines or pyrimidine  pairing  as shown,

Bases are attached to sugars in an alpha N-glycosides linkage.This is wrong the beta N-glycisidic bonds are the linkages

Put the vocabulary words in order from largest level of organization to smallest. Reorder answers 1. Population Reorder answers 2. Organism Reorder answers 3. Organ Reorder answers 4. Atom Reorder answers 5. Biosphere Reorder answers 6. Species Reorder answers 7. Organ system Reorder answers 8. Community Reorder answers 9. Cell Reorder answers 10. Ecosystem Reorder answers 11. Organelle Reorder answers 12. Tissue Reorder answers 13. Molecule

Answers

Answer:

The level of organization in order from largest to smallest is;

1. Biosphere

2. Ecosystem

3. Community

4. Population

5. Species

6. Organism

7. Organ system

8. Organ

9. Tissue

10. Cell

11. Organelle

12. Molecule

13. Atom

Explanation:

All living things on Earth are arranged in an hierarchical level of organization. The order in descending way is as follows:

1. Biosphere- Biosphere refers to the part of the Earth that constitutes all living organisms in interaction with their environment. It is the total of all ecosystems on Earth.

2. Ecosystem: Ecosystem refers to a group of living organisms i.e plant, animal and microbes interacting with each other and their abiotic environment e.g water, air etc. An ecosystem comprises of several communities.

3. Community- Community refers to a group of organisms interacting with each other at a particular time and habitat. A community is made up of two or more populations.

4. Population- Population refers to a group of organisms of the same species living together in the same habitat and capable of interbreeding.

5. Species- A species is a group of organisms usually with the same appearance and capable of producing fertile offsprings by interbreeding.

6. Organism- An organism is an individual living thing i.e. plant, animal, microbe. An organism is made up of several organ systems that work together to make it whole.

7. Organ system- Organ system refers to a group of organs working in an interconnected manner to perform certain functions in an organism.

8. Organ- An organ is a structure in an organism that performs a specific function.

9. Tissue- A tissue is a group of cells working together for the same purpose.

10. Cell- A cell is the basic and fundamental unit of life, which is the building block of all living organisms.

11. Organelles- An organelle is a specialized structure in a cell that performs specific functions. e.g. nucleus, mitochondria etc.

12. Molecule- A molecule is the smallest unit of a chemical compound responsible for the chemical identity of that compound. A molecule is made up of two or more atoms chemically bonded together.

13. Atom- An atom is smallest indivisible unit of mattter that partakes in chemical reactions. Atom is considered the smallest unit of matter.

Answer:

:)

Explanation:

The pygmy shrew is the smallest mammal in North America. However, when comparing the amount of
food eaten to its body weight, the pygmy shrew eats more food than any other mammal. It will
consume two to three times its own body weight in food daily. One explanation is that the pygmy
shrew uses energy at a high rate. In fact, its heart beats over one thousand times per minute.
What is the best explanation for what happens to the food's mass and energy when it is consumed by
the pygmy shrew?
A. The mass is mostly excreted as waste. The
energy is burned up and destroyed by the
pygmy shrew's high rate of cellular respiration.
B. The mass is all used for creating new mass in
growth. The energy is stored, used in cellular
respiration, or lost to the environment as heat.
C. The mass is used for growth, stored, or excreted
as waste. The energy is stored, used in cellular
respiration, and lost to the environment as heat.
D. The mass is used for growth, stored, or excreted
as waste. The energy is burned up and
destroyed by the shrew's high rate of cellular
respiration

Answers

Answer:

C. The mass is used for growth, stored, or excreted

as waste. The energy is stored, used in cellular

respiration, and lost to the environment as heat.

Explanation:

I got it right on the quiz.

Mass used for growth, stored or excreted as waste. Energy is stored that is used in cellular respiration which is lost to the environment in the form of heat. So, the correct option is (C).

How Pygmy shrew uses its food for energy?

The pygmy shrew has a large appetite which is a result of small body mass, rapid heat loss and high metabolic rate. It is kept in captivity which provides some idea of ​​the energy requirements of the species.

The pygmy shrew has such a high metabolism that it must eat at least every 30 minutes otherwise it will die. This can be explained by food mass and energy is that due to very high metabolism most of the food mass which is rapidly used up to form shrew, and a large proportion of the food is lost from the body surface because of its very small size.

The combination of these two factors are

1. A very high metabolism which is rapidly utilizes food material, and generates large amounts of heat in a very short period of time.

2. Very small size due to which high surface area to volume ratio leading to heat loss.

Thus, Mass used for growth, stored or excreted as waste. Energy is stored that is used in cellular respiration which is lost to the environment in the form of heat. So, the correct option is (C).

Learn more about Metabolism, here:

https://brainly.com/question/29763323

#SPJ2

Knowledge of the driver mutations underlying cancer has led to targeted therapeutics, such as the protein kinase inhibitor imatinib (trade name Gleevec) in cases of chronic myeloid leukemia. Cancer cells often become resistant to a given drug, so researchers continue searching for new drugs that target proteins that contribute to the cancerous phenotype. One recent promising approach uses drugs that lead to ubiquitination and proteasomal degradation of the target protein. Which of the following mutated proteins are good candidates for this approach?
A) oncogenes
B) proteins with loss-of-function mutations
C) proteins with gain-of-function mutations
D) tumor suppressor genes

Answers

Answer:

C) proteins with gain-of-function mutations

Explanation:

Gain-of-function mutations: In biology, the term "gain-of-function mutation" is described as one of the different types of mutation in which the altered or changed "gene product" consists of an entirely new pattern or molecular function associated with gene expression. However, the "gene-of-function mutations" are being always considered as "Semidominant or Dominant".

In the question above, the correct answer is option C.

Scientists today are studying tidal power as an alternative energy source for generating electricity. Some scientists conclude that tidal power is a good alternative source of energy because it uses a natural process, does not rely on fossil fuels, and does not release greenhouse gases. These scientists recommend building tidal power plants around the United States in locations with high tidal power potential. Other scientists conclude that tidal power is not a good alternative energy source because tidal power plants can negatively impact the surrounding ecosystem by killing marine animals, restricting fish migration, reducing the natural flow of water, and causing silt buildup in waterways. These scientists recommend not building tidal power plants in U.S. waterways. Both conclusions are based on valid data and scientific reasoning. How can both conclusions be valid?

Answers

Answer:

See the answer below

Explanation:

Both conclusions can be valid because they are based on valid data and scientific reasoning.

In order for a data to be valid in making a conclusion, such data must have been collected through a scientific experiment that is devoid of subjectivism. In order words, the data must have been objectively collected via standard experimental procedures.

Once data have been collected, they are analyzed and used to make valid conclusions based on the hypothesis which must have been made earlier before the experiment.

Conclusions made from standard experimental procedures and scientific reasonings are valid and such experiments are reproducible.

Hence, as long as the data from which the conclusions were made can be reproduced through the same experiments, the conclusions are valid.

Mitotic cell division creates identical copies by replicating a cell's DNA __________ and then dividing ____________.

Answers

Answer:

Mitotic cell division creates identical copies by replicating a cell's DNA once and then dividing once.

I was finishing Summer B Plato Biology for High School when the program closed. All I had left to finish was my final. Does anyone have sample questions of the final I can study? I am bummed!

Answers

Study for the test and I will be there by a few minutes late but I will be in touch with you and the rest of the week and I have a few questions for the weak narrator is the same as last time we talked enough.

Do the spinal nerves include the sensory or motor neurons? Where do these neurons enter or exit the spinal cord?

Answers

Answer:

hd

Explanation:

The spinal nerves include the sensory or motor neurons sensory neuron → brain → motor neuron → muscles.

What are neurons?

Neurons are nerve cells that are specialized to process and transmit information. The brain then processes the information obtained from the sensory neuron and sends another signal trough the motor neuron carrying the message to the muscle.

The spinal cord acts as a nerve center between the brain and the rest of our body and it contains motor neurons that transmits nerve signals from the motor cortex to the body, and the spinal cord also receives all of the sensory information from the periphery of our bodies.

Motor neurons are also known as efferent neurons, they are part of the central nervous system that transmit impulses from the brain or spinal cord to the effector organ (muscles or glands).

Therefore, The spinal nerves include the sensory or motor neurons sensory neuron → brain → motor neuron → muscles.

Learn more about spinal nerves on:

https://brainly.com/question/29803860

#SPJ5

which particles is the fundamental unit of all matter in both living and nonliving

Answers

Answer:

atoms

Explanation:

all things in the universe are made of atoms and they are considered the fundamental unit of matter.

non-living things are composed of different compounds and molecules.

living things are made of cells, and cells themselves are made of different molecules. So living things are also made of atoms.

Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2.
5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'
3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'
a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA
b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA
c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA
d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT
e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG

Answers

Answer:

a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA

Explanation:

The Polymerase Chain Reaction (PCR) primers are short nucleotide sequences (composed of approximately 20  nucleotides in size) flanking a target sequence that is amplified during PCR reaction. These primers bind to the DNA template by means of complementary base pairing in order to make billions of copies of a target DNA region, which is then visualized as a band by electrophoresis. In this case, PCR primers from the item a- (i.e., AGCTAAGGCCTTTCGA and CCACGGGTACCTATAA) will bind to the DNA template of lines 1 and 2 in order to amplify a continuous region:

Schematically:

The Foward primer AGCTAAGGCCTTTCGA binds by complementary base pairing:

5'_(TCGATTCCGGAAAGCT)TAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC_3'

The Reverse primer CCACGGGTACCTATAA binds by reverse complementary base pairing:

3'_AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCA(TTATAGGTACCCGTGG)_5'

Which of the following statements is compatible with Darwin’s theory of evolution? much of the variation in individuals of a population is heritable resources are unlimited survival depends mostly on luck members of a population are usually very much alike in their characteristics

Answers

Answer:

A. much of the variation in individuals of a population is heritable

Explanation:

Charles Darwin is a scientist well known for his development of the concept of evolution. Darwin was able to deduce that the species of a population have a common ancestor and that as time passes there is a modification in the characteristics of these species that makes it easier for them to adapt to their environments. These traits that were inherited from past descendants, were helpful traits that made it possible for their own descendants to be able to survive better than their peers. He noted that there were limited resources for survival, therefore it was a case of the survival of the fittest.

Natural selection was the term used by him to describe how species of a population survived over time. Members of a population had varied traits that enabled them to survive. For example, the descendants of an ancestor could have slightly different shapes, colors, sizes, and other features but still maintain traceable heritable traits.

I need help FAST!! U have too match the letters with the #.!

Answers

8 B

9 B

10 D

11 C

12 C

13 B

14 A

15 A

16 C

17 A

18 A

19 D

20 A

21 D

22 D

A mutation causes a sequence of DNA that has the nucleotides TTG to be changed to TCG. The resulting protein has a different sequence of amino acids. Which type of mutation is this? a. missense b. nonsense c. silent d. frameshift

Answers

Answer:

The correct answer would be - a) missense.

Explanation:

A missense mutation is a type of a point mutation that is caused by the alteration or change in the a nucleotide of a triplet codon in a DNA sequence. This leads to a altered mRNA and incorporate different amino acid and ultimately different protein than usual.

This type of mutation can produce non functional protein by translation in most of the case and did not make any big change in the individual.

Thus, the correct answer would be - a) missense.

Answer:

A. Missense

Explanation:

edge 2020 100%

Prader-Willi syndrome is a genetic disorder involving a partial deletion of chromosome 15q on the paternal chromosome. When both copies of a gene (or chromosome) are functional but only one is expressed, this is an example of ________.

Answers

Answer:

monoallelic gene expression

Explanation:

Monoallelic expression is a type of gene expression where only a copy out of the two copies of a gene is expressed and the other is silent.

A gene is usually represented by two alleles representing alternate forms of the same character. Individuals inherit an allele each from their two parents for every gene within their genomes.

When only one of the alleles is expressed for a particular gene while the other allele remains silent, such phenomenon is referred to as monoallelic gene expression.

Reaching for your coffee cup is accomplished by the _____ subdivision of the peripheral nervous system.

Answers

Answer:

somatic subdivision

Explanation:

The peripheral nervous system is divided into somatic and autonomic systems. The somatic system is required to transport sensory and motor information to the central nervous system. The somatic system is composed of nerves that connect different parts of the body including sensory fibers, skin, and skeletal muscles. On the other hand, the autonomic system can be subsequently classified into sympathetic and parasympathetic systems, which are required in fight (potentially dangerous) and calm-associated responses, respectively.

Centrioles have pulled the chromosomes all the way to the spindle poles, the process of cleavage furrowing appears to be about to begin. What kind of a cell is this?

Answers

Answer:

An animal cell in the telophase

Explanation:

Telophase is one of the stages of cell division in animal cell .

In the animal cell during telophase, Centrioles have pulled the chromosomes all the way to the spindle poles, the process of cleavage furrowing appears to be about to begin because the nuclear membrane and nucleoli reform, cytokinesis is almost coming to completion and the chromosomes eventually uncoil to chromatin. Usually cytokinesis occurs during telophase.

Biochemical and genetic experiments have demonstrated that the _________ of tRNA are important for recognition by its cognate aminotransferase-tRNA synthetase.

Answers

Answer:  Acceptor stem and anticodon loop.

Explanation:

Transfer RNA (tRNA) is a small RNA nucleic acid involved in protein synthesis (translation). Each tRNA molecule has two important areas:

A region of trinucleotides, called the anticodon A region where a specific amino acid binds.

During translation, the ribosome reads the sequence of the mRNA in groups of three bases to assemble the protein. So, in the mRNA chain there are codons, set of three bases, which determine the amino acid to be added to the peptide chain. The tRNA transfers the amino acid to the ribosomes, and then arranges them along the messenger RNA (mRNA) molecule. Then, the tRNA must have an anticodon that is complementary to the codon. Each type of tRNA is specifically combined with 1 of the 20 amino acids to be incorporated into proteins.

This means, during translation, each time an amino acid is added to the growing chain, a tRNA molecule is formed whose base pairs have a complementary sequence with mRNA molecule, ensuring that the appropriate amino acid is inserted into the protein. So, tRNA is a key link between RNA transcription and the translation of that RNA into protein. On the other hand, aminotransferases are enzymes responsible for attaching amino acids to the 3ʹ‐end of cognate tRNAs.

The acceptor stem is the site of attachment of amino acids to tRNA, and anticodon loop is the site of tRNA that is complementary to the codons found in mRNA (that determine the amino acid that will be added) This means, both parts are important for recognition, because the acceptor stem is where the amino acid is, and the anticodon loop ensures that the appropriate amino acid is inserted into the protein.

Other Questions
Malcolm Lewis has come up with the idea of a system for picking up people's cars while they are at work, washing and waxing them, and returning them for a fee. Having been a big success in his home city, Malcolm plans to expand his operation into other cities. The service described here seems best suited to Just need helpthe equations are above Becky's ship is 43 miles west all the harbor.Clyde's yacht is a5 miles north from Beery. Howfar is Clyde from the Harbor? Show your work.x= Harbor25B.43 Question: 4 x 1 2/5 Answer with a mixed number in simplest form! Solve 2x^2+12=x3 help Which phrase best completes the sentence? Margarita: Fuimos _________________________ unas faldas, unos cinturones de marca, un vestido para Juanita y un lente nuevo para mi cmara. A. al supermercado y compramos B. a la feria artesanal y compramos C. al almacn y compramos D. al mall y compramos 4. What is the name of the map tool that measures distance? Esmereldas family went out to dinner paying 20% tip at the end of the meal. Their credit card was charged $51.00. What was the amount on the bill without the tip Do each of the following in the main function: a) Write the function prototype for function zero, which takes a double array big_nums and does not return a value. b) Write the function call for the function in part a. c) Write the function prototype for function add1AndSum, which takes an integer array one_small and returns an integer. d) Write the function call for the function described in part c. Select the correct text in the passage. What is Atellan farce? (A.) Atellan farce originated in Etruria, Italy. (B.) The Atellan farce was a type of Greek drama. (C.) Under Atellan farce, plays would comprise a simple plot, stock characters, masks, physical comedy of slapstick, and parody. please help asap Which statement describes the damage that results from earthquakes? A: Amount of damage can be used to determine intensity. B: Damage can be measured using the Richter scale. C: The amount of damage increases as magnitude decreases. D: Earthquakes that cause maximum damage are the most common. You are on your daily jog when a car negligentlypulls out in front of you. Unable to stop, you run intoit and injure yourself. Should you be able to recoverdamages for the harm done to you? One angle of a triangle has a measure of 66 degrees. The measure of the third angle is 57 degrees more than 1/2 the measure of the second angle. The sum of the angle measures of a triangle is 180 degrees. What is the Measure of the second angle? What is the measure of the third angle? shannon is paid 1150 a month after deductions.what is her net annual salary?(a year=12 months ) Millions of Americans moved out of urban ethnic neighborhoods and isolated rural enclaves into the army and industrial plants where they came into contact with people from various backgrounds, creating a melting pot that historians call Group of answer choices the second new wave. real Americanism. culture shock. patriotic assimilation. Candy is on sale for $0.75 each. You have a coupon for $0.25 off your total purchase. Write a function rule for the cost of n pieces of candy identify the factor relevant in each investigation ? The development manager is required to choose between two projects. Project A has an IRR of 25% and project B has an IRR of 30%. Which of the following statements is correct? A. If she can invest only in one project, the manager will choose project B B. None of the statements above is correct C. If she can invest only in one project, the manager will choose project A D. If she can invest in both projects, the manager will choose both projects A and B what does Woche mean The independent variable in the hypothesis "the longer a U.S. line worker has been employed at a U.S.-based assembly plant, the more difficult it is for that worker to find new employment when the assembly plant moves to Mexico" is _____ .