cytoplasm and nucleus together constitute which part​

Answers

Answer 1

Answer:

Cytoplasm and nucleus together constitute Protoplasm .

Answer 2

protoplasm is your answer mate

Related Questions

Help with this please anyone!!!

Answers

Answer:

top right

Explanation:

all of the following are examples of organic matter soil except

Answers

This question is incomplete; here is the complete question:

All of the following are examples of organic matter soil except

A. Decaying plants

B. Bacteria

C. Fungi

D. Water

The answer to this question is D. Water

Explanation:

Organic matter derives from living beings, due to this, organic matter is considered as a biological product. In this context, materials such as decaying plants are organic matter because they derive from living organisms and contain biological molecules (most contain carbon). This category does not apply to water, which is composed of hydrogen and oxygen and does not derive from living beings. Thus, the one that is not organic matter is water.

Answer:

D. Water

Hope this Helps!! :))

Protein that accounts for why water can cross a membrane more quickly than expected is Group of answer choices

Answers

Answer:

The correct answer is "Aquaporin".

Explanation:

The missing options of this question are:

A. ATP synthetase

B. Aquaporin

C. The sodium-potassium pump

D. Integrin

The correct answer is option B. "Aquaporin".

Aquaporins are microscopic channels that belong to a family of proteins that form pores. Aquaporins are also known as water channels for its specific biological role of allowing water to cross the cell membrane. The presence of aquaporins explains why water can cross cell membrane more quickly than expected, since they function as regulators of water transference.

Which process involves a decrease in the dispersal of matter? Select the correct answer below: heat exchange between two solids

Answers

Answer:

The options are

A.heat exchange between two solids

B.the decomposition of a compound into its constituent elements

C.the precipitation of a solid

D.none of the above

The answer is

C.the precipitation of a solid

Dispersal of matter involves the process whereby there is more space occupied by the resulting element/compound than the initial one. For example the conversion of liquid to gas means that it has an increase in the dispersal of matter as the gas particles will contain more space when compared to a liquid.

Precipitation of a solid means conversion of a liquid to a solid. A liquid is known to contain more space which means there is a decrease in the dispersal of matter.

The process that involved the reduction in the dispersal of matter should be the precipitation of a solid

What is the dispersal of matter?

It refers to the process in which it contains the additional space that should be occupied. Like the conversion of the liquid to gas represent there should be increment in the disperson of the matter since the particles of the gas comprise more space at the time when the comparison is to be done with the liquid. Here, precipitation of the solid represent the transformation of the liquid to the solid.

This question is incomplete. Please find the options below.

A.heat exchange between two solids

B.the decomposition of a compound into its constituent elements

C.the precipitation of a solid

D.none of the above

Learn more about dispersal of matter here: https://brainly.com/question/6529880?referrer=searchResults

General and Specific knowledge example

Answers

The sky is blue, Planes travel because of the pressure under the wings

GENERAL: the sky is blue SPECIFIC: Planes travel because of the pressure under the wings

Which term best describes the difference in colors of the birds below? 4 birds are shown. One has light brown feathers with darker wings. One has very dark feathers with lighter wings. Another has medium brown feathers with light wings. The last one has medium brown feathers with very dark wings. natural selection reproductive maturity genetic variation genetic drift Mark this and return

Answers

Answer:

genetic variation

Explanation:

Genetic variation refers to the difference in genetic content of organisms within a population. The genetic makeup of living organisms are made up of GENES, which exists in contrasting pairs called ALLELES. Each allele is responsible for variation in traits exhibited by the organisms. Differences in the allelic content of organisms of the same species leading to the display of varying phenotypic characteristics is referred to as GENETIC VARIATION.

This is the case in the example given in which four birds in a population possess a range of wing and feather colors i.e light brown feathers with darker wings, dark feathers with lighter wings, medium brown feathers with light wings, and medium brown feathers with very dark wings, all resulting from a variation in their genetic content. Hence, this is an example of GENETIC VARIATION.

Answer:    C. Genetic variation

Explanation: :)

ASAP Why is ATP used as an active energy source over glucose? A. It is more abundant in food sources. B. It releases its energy quickly in a single reaction. C. It releases its energy slowly through multiple reactions, allowing it to last longer. D. It has more energy.

Answers

Answer:

B.

Explanation:

Glucose is an organic molecule that stores ATP or energy while Adenosine triphosphate (ATP) is an energy-carrying molecule.

ATP used as an active energy source over glucose because ATP is a shorter process and releases energy in a single reaction as glucose first converted into ATP and then used as energy in cellular respiration.

Hence, the correct option is "B".

identify a probable reason that the dark moths survived while the light moths did not during the industrial revolution

Answers

Answer:

directional selection

Explanation:

The directional selection is a type of Darwinian selection where a particular phenotype is favored in the population, thereby modifying the allelic frequencies to increase the proportion of the favored phenotype. Biston betularia, also known as peppered moth, is a species that was influenced by directional selection in its recent past. Before the industrial revolution, the frequency of light-colored moths was predominant compared to the darker-colored phenotypes, because this color has higher adaptive fitness in a clean, no pollution environment, thereby light-colored moths were able to avoid predatory birds. However, during the industrial revolution, the frequency of dark-colored moths increased in response to pollution (i.e. darker environment), thereby conferring a higher adaptive fitness to darker phenotypes.

Answer:

Dark wings

Explanation:

Explain what, if any, is the issue facing DNA polymerase in regards to its 5’->3’ activity when replicating DNA.

Answers

Answer:

The two strands of DNA are replicated in different ways

Explanation:

DNA replication is a process that occurs during the S phase of the cell cycle that consists of making two identical copies of the double-stranded DNA molecule, which subsequently are distributed in the daughter cells during cell division. During this process, DNA polymerase can add nucleotides in 5' to 3' direction, but not in 3' to 5' direction. In consequence, the DNA strand that has 3’ to 5’ directionality can be synthesized directly, while the DNA template strand that has 5’ to 3’ directionality can't be synthesized in a continuous manner and thereby it is created by adding small DNA fragments, which are known as Okazaki fragments (150-200 nucleotides in size).

What is an example of nature exhibiting zero
waste?
1. Oxygen is a waste product
from plants.
2. Oxygen is a waste product
from animals
3. Animals consume oxygen in
respiration
4. Plants consume oxygen in
photosynthesis
A
1 and 3
B
1 and 4
С
2 and 3
D
2 and 4

Answers

Answer:

idontknow

Explanation:

you are aintelligent nice qiestion

Provide one example of quantitative data that can be collected when using a microscope?

Answers

Answer: there 3 ducks by the pond

Explanation:

Quantitative is numbers. how many.

Before using any chemical in the lab, why should one first read the Material Safety Data Sheet (MSDS)?
The MSDS provides information on safe handling of the chemical.
The MSDS explains where the chemical can be purchased.
The MSDS provides the chemical formula for the substance.
The MSDS describes how the chemical will react with other substances.​

Answers

Answer:

A

Explanation:

Took test on Edge.

Material Safety Data Sheet (MSDS) contains information related to occupational safety and health. The MSDS provides knowledge on the safe handling of chemicals. Thus, option A is correct.

What is MSDS?

Material Safety Data Sheet (MSDS) is the data safety sheet that states the rules and details of handling and using the laboratory chemicals that are related to health. It is of great importance as it allows the learning of chemical hazards.

Before entering the lab and using the chemicals one should read the MSDS book so to get aware of the handling and precautions that have to be taken while performing any experiments. To work safely one should know its danger and should be prepared for emergencies.

Therefore, the MSDS provides knowledge on the handling of hazardous chemicals.

Learn more about MSDS here:

https://brainly.com/question/3282390

#SPJ6

Recent research has found that on one island of the Galapagos two finch species interbred. This interbreeding may have resulted in a hybrid species that ultimately led to the extinction of one of the species Darwin discovered. They call this speciation in reverse, or despeciation. Based on what you know about speciation, why are these terms appropriate?

Answers

Answer:

Speciation is defined as an evolutionary process in which one population evolves into a distinct species.

Speciation in reverse, or despeciation is defined as the extinction of an old species due to combining with evolved species to produce hybrid species but it conserves biological lineage.

In the given research, the term used despeciation or speciation in reverse is appropriate as hybrid species resulted from interbreeding of Galapagos two finch species conserved the biological lineage but also loss one of the species Darwin discovered.

Answer:

Speciation is the method by which unique species evolve from a common ancestor. In this case, two of these species that split from a common ancestor interbred and created a hybrid. This hybrid was apparently stronger and possibly better adapted to the environment, which led to extinction of a species formed by the initial speciation event.

Explanation:

Plato

Epithelial tissue always has an exposed outer surface and an inner surface anchored to connective tissue by a thin, non- cellular structure called the (a) Nonstratified layer (b) Stratified layer (c) Basement membrane (d) Fibroblast

Answers

Explanation:

(a)Nonstratified layer

whats the answer guys help me out

Answers

Answer:

Read Exp:

Explanation:

1st one - Attracts Pollinators.

2nd one -  Prevents water loss.

3rd one - Traps insects.

g The ____ ring is built onto ribose-5-phosphate of PRPP for its de-novo nucleotide biosynthesis, while the ring structure of the ______ bases are synthesized separately and then coupled to ribose-5-phosphate via the C-N glycosidic bond.

Answers

Answer:

The purine ring is built onto ribose-5-phosphate of PRPP for its de-novo nucleotide biosynthesis, while the ring structure of the pyrimidine bases are synthesized separately and then coupled to ribose-5-phosphate via the C-N glycosidic bond.

Explanation:

Purines are produced as bases attached to the ribose 5-phosphate (pentose sugar). The adenine and guanine nucleotides derive from inosine monophosphate (IMP), which is synthesized on an existing ribose-phosphate. Thus, purine bases are built on a ribose sugar that is directly attached to the pyrimidine ring. On the other hand, pyrimidines are produced from the carbamoyl phosphate precursor. In this case, the ribose-5-phosphate pentose sugar is attached after the pyrimidine ring is made.

Predict what will happen to the following lung volumes and capacities during strenuous exercise. Assume that you are comparing from a baseline of normal resting respiration.


Lung Volume or Capacity Predicted change from resting baseline : Use Increase, Decrease or No Change

TLC (total lung capacity)
No change
VC (Vital capacity)
IC (Inspiratory capacity)
FRC (Functional residual capacity
TV (Tidal volume)
IRV (Inspiratory reserve volume)
ERV (Expiratory reserve volume)
RV (Residual volume)

Answers

Answer:

During intense exercise:

lung capacity increases

vital capacity increases

respiratory capacity increases

functional residual capacity increases

tidal volume increases

the inspiratory and expiratory reserve volumes decrease as does the residual volume.

Explanation:

Residual volumes decrease because having better lung capacity, better development of the secondary skeletal muscles that collaborate in expiration and inspiration, these are given in a better way, and more effectively.

If these processes take place more efficiently, their potentiality increases and expiration and inspiration move a large current of air into the lungs, thus leaving less reserve airs.

Those people who have increased exhalation or inspiration reserve, have a weak activity of the musculature in the processes and function as "stagnant air" which is synonymous with a lack of physical activity or aerobic capacity.

It is important to clarify that all the above processes are accompanied by an increase in the size of the chest cage

The shape of the path of a planet or asteroid around the sun is an

Answers

Answer: Elliptical (similar to an oval shape)

Explanation: planets and asteroids in orbit around the sun move in a path shaped like an elliptical

Explain why you selected the location recorded in Panel 1 as the ideal incubation site for culturing microbes?

Answers

Answer:

Due to optimum environment for microbes.

Explanation:

I selected Panel 1 as the ideal incubation site for culturing microbes because the environmental conditions such as temperature, humidity and nutrients medium etc are optimum. Microbes need a specific environmental conditions for its growth and development. If the environmental conditions are not suitable so it adversely affected the growth and development of microbes.

The Middle Latitudes have:

Answers

Answer:

The Middle Latitudes have cyclones and anticyclones

Explanation:

The Middle Latitude is a spatial region of the earth which are found between the tropics and the polar circles.

The climate in this region of the earth is usually very windy thereby forming cyclones and in serious conditions typhoons and hurricanes. The Middle Latitude is thereby characterized by cyclones and anticyclones.

In a population of flowers growing in a meadow, C1 and C2 are autosomal codominant alleles that control flower color. The alleles are polymorphic in the population, with f (C1) = 0.8 and f (C2) = 0.2. Flowers that are C1C1 are yellow, orange flowers are C1C2, and C2C2 flowers are red. A storm blows a new species of hungry insects into the meadow, and they begin to eat yellow and orange flowers but not red flowers. The predation exerts strong natural selection on the flower population, resulting in relative fitness values of C1C1 = 0.30, C1C2 = 0.60, and C2C2 = 1.0.

Required:
a. What is the C1C2 genotype frequency among the progeny of predation survivors?
b. What is the C2C2 genotype frequency among the progeny of predation survivors?
c. What is the C2C2 genotype frequency among the progeny of predation survivors?
d. What is the equilibrium C2 allele frequency in the predation environment?

Answers

B is yours answer have a nice day

What complications might arise from genetic screens targeting an organ that differentiates late in development?

Answers

Answer:

No sign of testicular development in boys and breast development in girls.

Explanation:

Complications like no sign of testicular development in boys and breast development in girls occurs if an organ develop very late. There are many causes of this type of complications such as long term illness, eating improper food and disorder of sexual development. Sometime these complications  also occurs due to genetically. These complications should be treated well with medication and use of nutritious food. These medicines increases the performance of sex hormones in order to initiate puberty.

Restriction digest A:

ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC

How many bases are in the second fragment?

Answers

Answer:

This question seem incomplete

Explanation:

This question seem incomplete. However, if the strand of the second fragment is what is provided above, then the answer is 51

This strand/fragment is definitely a DNA strand because of the absence of uracil (U) or because of the presence of thymine (T). The four bases in a DNA are adenine (A), Thymine (T), cytosine (C) and Guanine (G). These bases also bind to one another in the pattern described below

A ⇆ T

G ⇆ C

Hence, the adenine (A) on one strand can only bind to thymine (T) on the complementary strand (and vice versa) while the guanine (G) on one strand can only bind to cytosine (C) on the complementary strand (and vice versa).

Hence, the letters seen is the question are representations of bases in a DNA strand/fragment. The number of letters/bases here are 51

ASAP What is a photosynthetic pigment? What is a photosynthetic pigment? A. An oxygen based compound that captures light energy. B. A light sensitive compound that changes color. C. A colored compound that captures light energy. D. A manmade compound that reacts to light.

Answers

I think the answer is A.

Answer:

A. An oxygen based compound that captures light energy.

Transposons need to __________________ in order to limit their negative impact on the genome of the host cell. A. control their nucleotide length B. regulate their copy number C. control their target-site choice D. avoid transposing into their own genome

Answers

Answer:

The correct answer is B

Explanation:

Transposons need to regulate their copy number to avoid errors with chromosomal pairing during meiosis and mitosis such as unequal crossover.

A typical example of this error is called the Alu Sequence or Elements. Alu elements contain more than one million copies found everywhere in the genome of human beings.

Many inherited human diseases such as cancer are related to Alu insertions.

Cheers!

Consider that a certain gene is a maternal effect gene and that the allele for dark brown pigment is incompletely dominant to the allele for no pigment (white). The incomplete dominant phenotype is light tan. If a white female is crossed with dark brown male, what will be the phenotypic ratio of the progeny?
A) all white
B) all dark brown
C) all light tan
D) either all white or all light tan
E) either all light tan or all dark brown
F) none of the above choices (cannot be determined)

Answers

Answer:

The correct answer is C. All light tan        

Explanation:

You will find the answer and explanation in the attached file due to technical problems.

How are red blood cells able to move through narrow vessels to carry oxygen throughout a multicellular organism? (1 point) a)They are flexible because they lack a plasma membrane. b)They are small because they lack a nucleus. c)They are long and thin with a tail-like end. d)They are small because their organelles are smaller than those of other cells.

Answers

Answer:

The correct answer is - option B. They are small because they lack a nucleus.

Explanation:

Red blood cells or erythrocytes are specialized cell that produce in bone marrow and have specific role such as carrying oxygen from lungs to deliver it to the various organs and carry out carbon dioxide.

In mammals these cells lack cell organelles such as nucleus and mitochondria, a major factor that determined its smaller size. The size of RBC are move through narrow vessels throughout a organism because of its specific size and shape that provide it space for hemoglobin and allow to be flexible and bend to move through narrow vessels.

Thus, the correct answer is : option B. They are small because they lack a nucleus.

The anticodon (Select all that apply):

a. is a triplet of nucleotides in tRNA
b. determines the identity of the amino acid to be added to the peptide chain
c. is complementary to the codon
d. binds to the codon via hydrogen bonds

Answers

Answer:

choice A

Explanation:

An anticodon is a trinucleotide sequence complementary to that of a corresponding codon in a messenger RNA (mRNA) sequence. An anticodon is found at one end of a transfer RNA (tRNA) molecule.

Which phase of mitosis begins when the sister chromatids are cleaved, allowing the two sister chromatids of each pair to separate?

Answers

Answer:

Anaphase

Anaphase

Anaphase

Which structure is found in the cytoplasm of a prokaryotic cell, but is not found in the cytoplasm of a eukaryotic cell?
DNA
ribosomes
nucleus
mitochondria

Answers

Answer:

DNA

Explanation:

cytoplasm of a prokaryotic cell, but is not found in the cytoplasm of a eukaryotic cell.

Answer:

A- DNA

Explanation:

Other Questions
Which were included among the Three Principles of the People? Check all that apply. communism CLASSIFY THE TRIANGLES WHOSE SIDES MEASURE:A. a = 15cm, b = 20cm and c = 25cmB. a = 3cm, b = 3cm and c = 1cm What type of number is 17?There may be more than one correct answer.Select all that apply.If only one answer is correct, select "only" and the answer that applies.rationalonlyintegernaturalwholeRational Numbers Please help with this exercise A survey of undergraduates revealed the follwoing information: WOMEN MENsample mean weight 124.7 183.3sample standard deviation of weight 23.32 25.41sample proportion Roman Catholic 0.40 0.32Sample mean GPA 3.34 3.24Sample standard deviation of GPA 0.35 0.44Sample size 20 25Assume the populations are normally distributed. Suppose you want to determine whether the proportion of SCU women who are Roman Catholic is greater than the proportion of SCU men that are Roman Catholic.a. What are the null and alternative hypothesis to run this test?b. What is the calculated value of the test statistic?c. What is the p-value of the calculated test statistic?d. What is the conclusion of the hypothesis test, at 5% the significance level? In what way is apostrophe used in this poem?O The speaker uses figurative language to draw apicture in the reader's mind.O The speaker describes the fragrant memories of thevanished flowers.O The speaker speaks to a reader one hundred yearsin the future. Which of the following is true of Carters attempt to free the hostages in Iran? Design of experiments is a technique that helps identify which variables have the most influence on the overall outcome of a process. Understanding which variables affect outcome is a very important part of quality planning. I will mark u brainleiest if u help me and 5 stars What do you think Native Americans believed about who owned this land and how it should be used? I need help with this guys ! Your car gets 15 miles per gallon and your friend's car averages 25 mpg. You decidehead off to St. George Island on vacation, 361 miles away. If gas costs $2.79/gallon and you decide to split thegas costs, how much money will you save by driving your friend's car? Of the 34 cars in a parking lot, 20 are green, 8 are gold, and the rest are black. What arethe odds against the next car leaving the lot being black?A) 3:14B) 3:28C) 28:3D) 14:3 36 minus 20 minus 32 times 1/4 What is the difference between a rational and irrational numbers? Draiman Guitars is offering 110,000 shares of stock in an IPO by a general cash offer. The offer price is $39 per share and the underwriter's spread is 8 percent. The administrative costs are $350,000. What are the net proceeds to the company? Write the polar form of a complex number in standard form for [tex]8[cos(\frac{\pi}{2}) + isin(\frac{\pi}{2})][/tex] I've known1 my new neighbours.2 Anna for over ten years. find x, if sq.root(x) +2y^2 = 15 and sq.root(4x) - 4y^2=6 colleen's family plans to paint the windows of their house. her father will paint twice as many windows as her mother, and Colleen and her 2 brothers will paint an equal number of the rest of the windows. Colleen decided to do her own share and her mother's share and paints 7 window, which is one less than her father's share. how many windows are in their house? Who was the first lead guitarist in Metallica?