describe environment and its causes

Answers

Answer 1

Answer:

The definition including its particular circumstance is outlined in the subsection below on clarification.

Explanation:

The environment seems to be the reason why things like waterlogged as well as the warm environment are dissimilar. It can sometimes be aspects that are alive or nonalive.

Some causes related to the given topic are as follows:

This comprises all the usual physical, biological, and perhaps other causes.They deal with that as well constantly and therefore are adjusting to just the circumstances in their world.


Related Questions

Mr. B has been transferred to your floor to wait and see whether the chest tube allows his lungs to completely re-expand. But when he arrives, he is in severe respiratory distress. He says "I felt better before I came into the ER! Is this tube doing anything

Answers

The question is incomplete,below is the complete question.

Mr. B has been transferred to your floor to wait and see whether the chest tube allows his lungs to completely re-expand. But when he arrives, he is in severe respiratory distress. He says "I felt better before I came into the ER! Is this tube doing anything?"

You tell the Clinical Nurse Specialist (CNS). As the two of you move him into the bed, you notice that his chest tube bottle is lying on its side on the gurney, with air going into it. When you point this out to the CNS, she immediately grabs the bottle and sets it upright on the floor. You see air start bubbling through the fluid right away. "That was the problem!" she says. "They lost the water seal, and air was going into his chest from the bottle. You would not believe how many times that happens on transport." When you examine Mr. B, you have trouble detecting his lung sounds on the left. Even stranger, his apical heart sound is in the wrong place - it is over toward the right side of his chest. His respiration rate and heart rate are both increased, and he is struggling to breathe. "Let's give him a little oxygen. He'll be a lot better in a half-hour," says the CNS. "Check back on him."

QUESTION - Why would accumulation of air in his pleural space cause his heart sounds to be in the wrong place?

Accumulation of air in Mr B pleural space will cause his heart sound to be heard in the wrong place because the left side is his chest is being filled up with air making the organs in his chest to to be pushed over to the right side.

what does Ecology mean

Answers

The branch of biology that deals with the relations of organisms to one another and to their physical surrounding

Answer:

a branch of science concerned with the relationships between living things and their environment or the pattern of relationships between living things and their environment.

Explanation:

Only ------ percent of the food eaten is turned into its own body. ​

Answers

Answer:

10%

Explanation:

there is a the rule that only 10% of the energy is transferred from one trophic level to the other.

this means that only 10% of the food an organism eats  is passed onto the next organism. eg only 10% of the energy in a plant is transferred to a rabbit that eats the plant. After that if  a wolf eats the rabbit only 10% of the energy of food will pass on to the wolf.

algae's general habitat?

Answers

Answer:

Algae is the process to describe that diverse group of photosynthetic lifeforms.

Explanation:

Algae is that environments process to the rivers and lakes to ponds waters an snow, algae living in the contain snow pigments that addition to the surrounding contain distinctive.

Algae is environment near inside water bodies, algae in many components in plants as stems and shoots or leaves nutrients water their body.

Algae like plants an special structure and algae is well defined body in the structure stems and leaves are photosynthetic organisms, algae are free living and symbolic relationship other organisms, there are many types of algae:- Green algae, blue and green algae ,red algae.

Green algae:- green algae to that conduct photosynthesis symbolic relation with higher organisms.

Blue and green algae:- this algae are include dams, river, lakes.

Red algae:- red algae is used in species found in freshwater ecosystem.

Algae is in unicellular and multicellular in environment nature.

6. Which type of seismic wave is highlighted in the image?
O A. P wave
B. S wave
O C. Love wave
D. Rayleigh wave

Answers

Answer:

Rayleigh wave

Explanation:

Rayleigh waves are a type of surface acoustic wave that travel along the surface of solids. They can be produced in materials in many ways, such as by a localized impact or by piezo-electric transduction, and are frequently used in non-destructive testing for detecting defects.

hope it helps :)

please mark it the brainliest!

Rayleigh wave, surface acoustic waves called Rayleigh waves move along the surface of solids, hence option D is correct.

What is seismic wave?

They are commonly employed in non-destructive testing to find flaws and can be created in materials in a variety of methods, as by a localized impact or by piezoelectric transduction.

These include what are known as Rayleigh waves. A Rayleigh wave's amplitude decreases with depth below the surface and becomes noticeably tiny at depths greater than a few wavelengths.

As a result, the disturbance is limited to a solid's surface layers. The motion experienced by the surface layers includes both transverse and longitudinal components.

Therefore, Rayleigh wave type of seismic wave is highlighted in the image.

Learn more about seismic wave, here:

https://brainly.com/question/12651581

#SPJ5

If Earth’s average surface temperature continues to change over the next 30 years at the same rate it changed between 1980 and 2010, the average temperature will most likely be around

Answers

Answer:

Its B....

Explanation:

Get that 100.

Differentiate between endangered species and extinct species (1 point 2 examples)

Answers

Answer:

Endangered: Still around but at risk of going extinct (example: tiger)Extinct: Gone forever (example: wooly mammoth)

Explanation:

An endangered species is one with a reduced population. These species can easily become extinct if all the remaining members die.

I'm always happy to help :)

what is the answer to 9k=27

Answers

Answer:

K=3

Explanation:

We divide both sides by 9 which is 9k/9=27/9 then cancel 9 by 9 and by 9 once by 9 thrice.

On May 18, 1980, Mount St. Helens in Washington State experienced a huge volcanic eruption after a magnitude 5.1 earthquake. During the eruption, hot ash and pumice poured down the west, south, and east sides of the mountain, melting the snow and ice at the top of the volcano and producing volcanic mudflows. Which type of process first occurred in the ecosystem around Mount St. Helens after it erupted?
primary succession
secondary succession
a climax community
species extinction

Answers

Answer:

Primary succession

Explanation:

Primary succession is mostly cause by volcanic eruption

The first ecosystem to occur in the Mount St. Helens after eruption is the primary succession.

What is a primary succession?

The term primary succession refers to the organisms that first occur in an ecosystem after a major event such as the volcanic eruption has taken place.

In this case, the first ecosystem to occur in the Mount St. Helens after eruption is the primary succession.

Learn more about primary succession: https://brainly.com/question/26675203

Cómo explicarías tu que el soporte vegetal es más importante que los animales en un ecosistema?

Answers

Answer:

Las plantas son productores primarios, mientras que los animales son consumidores

Explanation:

La cadena alimenticia está conformada por niveles tróficos donde la energía fluye desde los niveles basales representados por la base de la pirámide, hasta los niveles superiores (pico de la pirámide). De este modo, los organismos representan diferentes eslabones de acuerdo a su posición en la cadena alimenticia. En el primer nivel se encuentran los productores primarios como lo son, por ejemplo, las plantas y algas de ambientes terrestres y acuáticos, respectivamente, siguiendo por los consumidores primarios (por ejemplo, especies hervívoras), continuando sucesivamente por los consumidores secundarios, terciarios y cuaternarios (especies carnívoras), los cuales se encuentran en posiciones cada vez más altas de la pirámide. No obstante, es importante indicar que existen ocasiones donde los consumidores superiores (ya sea secundarios, terciarios y cuaternarios) se alimentan de especies situadas por debajo de diferentes niveles no consecutivos e incluso también de especies pertenecientes al mismo nivel trófico, con lo cual encajando en más de una categoría y dificultando su clasificación en la cadena.

The removal of waste products from the body is called

Answers

Answer:

It is called EXCRETION.

Explanation:

This is a process by which metabolic waste is removed from a living organism.

The excretory organs removes these waste.

Accumulation of these in the body is very harmful to our system.

Hope all these helps.

Why might an ecosystem be better able to
cope with a season of forest tent caterpillar
outbreak than an increase in acidic
precipitation?

Answers

Answer: It contains leach aluminium.

Explanation:The ecological effect of acid rain are most Clearly seen in aquatic environment such as, stream, lakes and marshe where it can be harmful to fish and other wildlifes.

name 3 physiological processes of cell membrane?{3mks} plz help me guys

Answers

Answer:

the cell membrane is an extremely pliable structure composed primarily of back -to- back phospholipids (a "bilayer")

2. What happens in
terms of energy
when you hold a
craft stick and bend
it slightly?

Answers

Answer:

In a similar way a wooden tongue-depressor stick (like the kind used at the doctor's office) stores elastic potential energy when you bend it (though not if you break it). ... The elastic potential energy that was stored in the stick is transformed into movement, called kinetic energy.

Explanation:

What has a greater influence on protein levels? A. Protein degradation has a greater influence because they are denatured faster than the cell can produce them B. mRNA destroyer concentration has a greater influence because it is destroying mRNA before proteins can even be produced C. mRNA destroyer concentration has a greater influence because mRNA is destroyed right after the proteins are produced D. Protein degradation has a greater influence because outside factors like antibiotics can cause it, and it is difficult to recover from

Answers

Answer: b

Explanation: i got the answer wrong and i’m looking at the results rn

Protein is being produced with the help of a process called translation in which mRNA gets translated to produce proteins. The translation is followed after the process of transcription of DNA to RNA.

The cause of the greater influence of protein levels has defined as follows:

The destruction of mRNA could greatly influence protein levels as mRNA is considered the source for proteins to get synthesized. This is because if mRNA gets destroyed, proteins would not have been produced at all. Thus, directly influences the levels of protein.

Thus, we can conclude that mRNA destroyer concentration has a greater influence because it is destroying mRNA before proteins can even be produced. Hence, option (b) is the correct answer.

Learn more about protein here:

https://brainly.com/question/22241855

What is conjunctivitis

Answers

Answer:

[tex] \underline{ \underline \orange{see \: below}}[/tex]

Explanation:

Conjunctivitis is an inflammation, infection of the conjunctiva. It is the most common ocular disease worldwide.It is characterized by a pink appearance because of subconjuctival blood vessels hemorrhage.

Simply, we can define it as :

Conjunctivitis ( pink eye ) is an inflammation or infection of the transparent membrane ( conjunctiva ) that lines your eyelid and covers the white part of your eyeball.

Pink eye is commonly caused by a bacterial or viral infection , an allergic reaction or in babies.

The most common pink eye symptoms include:

Redness in one or both eyesItchiness in one or both eyesA gritty feeling in one or both eyes

Hope I helped !

Best regards!

Evaluate this statement: Gene flow increases the genetic divergence of populations. Evaluate this statement: Gene flow increases the genetic divergence of populations. This statement is true. This statement is false. Gene flow is not able to influence the genetic divergence of populations. This statement is false. Gene flow reduces the divergence of populations. This statement is false. Gene flow increases the number of genes in populations.

Answers

The correct answer is C. This statement is false. Gene flow reduces the divergence of populations.

Explanation:

In biology and related areas, genetic divergence occurs if populations with a common ancestor develop unique traits, which are the result of genetic changes over time. On the other hand, gene flow occurs when traits including genes flow from one population to another, usually because the populations are in contact. In this context, gene flow reduces divergence because if genetic material flows between populations is less likely each population can develop unique traits, instead the populations involved will have similar traits after some time.

The correct answer is C. This statement is false. Gene flow reduces the divergence of populations.

The following information should be considered;

In terms of biology and related areas, genetic divergence arise at the time when the populations are with a common ancestor that created unique traits, due to this there are genetic changes over time. While gene flow arise at the time when traits involved genes flow from one population to another, normally due to the populations are in contact. In this given situaton, gene flow reduces divergence since genetic material flows between populations is less likely every population can create unique traits, rather the populations involved will have similar traits.

Learn more: https://brainly.com/question/5303391?referrer=searchResults

Which space exploration activity has most helped astronomers determine the age of the solar system?

collection of lunar rock samples

experiments performed on the International Space Station

placement of mirrors on the lunar surface

collection of deep space images by the Hubble telescope

Answers

The best answer about the space exploration activity that has helped astronomers determine the age of the solar system is :  Collection of Lunar rock samples ( option 1 )

There are several exploration activities in which astronomers partake when they visit the solar system and they include :

experiments on the space station, placement of mirrors on the lunar surface and the collection of space images

But to determine the age of the solar system, collection of rock samples is the best activity, because rocks (one of the first substances found in the solar system )  are as old as where they are found.

Hence the space exploration activity that has helped astronomers determine the age of the solar system is the collection of lunar rock samples

learn more : https://brainly.com/question/21668746

Answer:A

Explanation:Collection of lunar rock samples will help understand the moon more than the other options.

Los cuyes del pelo crespo, al ser cruzados con cuyes de pelo liso, producen solamente cuyes de pelo crespo, si se cruza uno de los cuyes de pelo crespo de F1 con el homocigoto recesivo. ¿Qué proporciones es posible esperar

Answers

Answer and Explanation:

Datos:

El alelo dominante del gen que codifica para el tipo de pelo, determina el pelo crespo. Llamemos P al alelo dominante. Genotipos que expresan pelo crespo: PP (Homocigota dominante) y Pp (Heterocigota)El alelo recesivo del gen que codifica para el tipo de pelo determina el pelo liso. p es el alelo recesivo.Genotipo homocigota recesivo, pp, expresa pelo liso.La cruza entre un cuy de pelo crespo y un cuy de pelo liso producen solo cuyes de pelo crespo. Esto implica que el parental con pelo crespo era homocigota dominante.

1º Cruza: un cuy de pelo crespo y un cuy de pelo liso

Parental)  PP    x    pp

Gametas) P   P      p   p

Cuadro de Punnet)      P          P

                             p     Pp       Pp

                             p     Pp       Pp

F1) 100 % de la progenie posee pelo crespo

     4/4 tienen genotipo heterocigoto.

2º Cruza: un cuy heterocigoto de la F1 y un cuy homocigoto recesivo

Parental)   Pp      x       pp

Gametas) P    p        p     p

Cuadro de Punnet)     P         p

                          p    Pp        pp

                          p    Pp        pp

F2)   50% de la progenie tiene pelo crespo

       50% de la progenie tiene pelo liso

       2/4=1/2 de la progenie es heterocigota

       2/4 = 1/2 de la progenie es homocigota recesiva.

how do i explain this?

Answers

Answer:

Oxygen debt is a physiological phenomenon in which a person consume oxygen at fater rate that it replaced by new oxygen molecules.

As shown in the graph, oxygen debt occurs just after the end of exercise because oxygen is consumed at faster rate during exercise that leads to  increased respiration and body attempts to replace the used oxygen.

To overcome the problem of oxygen debt, a person should take rest that allows the body to replenish its oxygen supply.

Which element is being cycled through Earth's system in the image shown
below?
Fossil fuels
Cellular
respiration
Photosynthesis
Animals
Plants
Industry and Home
Death and
decay
A. Oxygen
B. Nitrogen
c. Hydrogen
O D. Carbon

Answers

I took this quiz about 2 weeks ago but I forgot the answer. I think it was Carbon but you shouldn’t trust me till someone confirms it
carbon! hope this helps!!

While performing an experiment, it is important to:
a. change the control setup
b. test many different variables at the same time
c. reach a conclusion
d. record observations and measurements

Answers

Answer:

D

Explanation:

While performing an experiment, it is important to record observations and measurements, as in Option d. Option d is correct regarding the facts of the experiments, while the others are wrong.

What is an experiment?

The experiment is carried out to observe the hypothesis, and in this process, a control set-up is taken whose value or result is already known, and the variables are taken and compared with the control. The controls set should never change in the experiment because the variables are tested with reference to them, and the measurements and observations of the experiment should be taken into consideration to prove the hypothesis. All the variables should not be tested at once because if this is done, it would introduce error into the experiment, and not all the experiments are done to get the conclusion.

Hence, while performing an experiment, it is important to record observations and measurements, as in Option d.

Learn more about the experiment here.

https://brainly.com/question/11256472

#SPJ2

What will happen if external factors affect cell division in a group of cells placed in a culture dish? A) Anchorage dependence will cause the cells to attach to each other after dividing. B) Anchorage dependence will prevent the cells from dividing until they attach to the dish. C) Density-dependent inhibition will cause the cells to divide until the dish is completely full. D) Density-dependent inhibition will destroy large cells to create room for new cells.

Answers

Answer:

C) density-dependent inhibition will cause the cells to divide until the dish is completely full

Explanation:

Just took the exam

Which label in the graphic represents the energy that is released from glucose by cellular respiration?
Oxygen
Glucose
Energy stored as ATP
Carbon dioxide and water

Answers

Answer:

C) Energy stored as ATP

Explanation:

100% on edge

Which type of chromosomal disorders seems to have the greatest affect on a person’s health—disorders involving autosomes or sex chromosomes? Why do you think this might be the case? thanks in advance

Answers

Answer:

Disorders involving sex chromosomes.

we can take Turner's syndrome n klinefelter's syndrome as examples.

Which of the following items was Darwin able to use to study the structures of
extinct organisms?
A. Fossils
O B. Species
O C. Amino acids
O D. Adaptations

Answers

Answer:

a

Explanation:

because that is all he had left of extinct animal's.

Answer:

A

Explanation:ithink not sure

The proximal convoluted tubule is A. lined with epithelial cells that lack microvilli. B. the site of glucose and amino acid reabsorption. C. permeable to water if ADH is present. D. impermeable to water. E. the site of water secretion.

Answers

Answer:

The correct answer is - option B.

Explanation:

The proximal convoluted tubule or PCT is the the part of nephron that lies in between of loop of Henle and bowman's capsule. The PCT is responsible for the most amount reabsorption of sodium, glucose, amino acids, water, potassium and chloride and reabsorbs around 65% to 100% of filtered substance.

Epithelial cells in the PCT reabsorb substances that have nutritional importance by the numerous microvilli on their surface.

Thus, the correct answer is - option B.

Examine the statement. A scientific theory can become a scientific law, but a scientific law cannot become a scientific theory. If the statement is true, select “True.” If it is false, select the option that is true 1.) True 2.) A scientific theory can become a scientific law, and a scientific law can become a scientific theory. 3.) A scientific law can become a scientific theory, but a scientific theory cannot become a scientific law. 4.) A scientific theory cannot become a scientific law, and a scientific law cannot become a scientific theory.

Answers

Answer:

It's true.

Explanation:

In general, a scientific law is the description of an observed phenomenon. It doesn't explain why the phenomenon exists or what causes it. The explanation of a phenomenon is called a scientific theory. It is a misconception that theories turn into laws with enough research.

When the scientists test the idea, they develop a theory by following a set of logical steps. A theory becomes a scientific law once it has been rigorously examined and accepted. Thus, option A is correct.

What A scientific theory can become a scientific law?

One prevalent fallacy is the idea that hypotheses eventually become laws. Despite the number of supporting examples, hypotheses do not actually become laws after repeated testing.

Scientific laws, like theories, explain occurrences that the scientific community has determined to be verifiably true. In general, laws explain what will occur in a specific circumstance and are proven by a mathematical equation, whereas theories explain how the phenomenon occurs.

Therefore, A testable explanation of a natural event is what constitutes a scientific hypothesis. The concept of gravity, for instance, explains why an apple always falls to the ground when.

Learn more about scientific theory here:

https://brainly.com/question/2375277

#SPJ2

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

Please help!

A. I only

B. II only

C. III only

D. I and III only

Answers

Answer:

a

Explanation:

my reason is that the capacity carrying is 35

Answer:

[tex]\boxed{\mathrm{A. \: I \ only}}[/tex]

Explanation:

The graph does not mention any seasons. The graph is not growing geometrically. For about 9 months the population has been about 35.

Other Questions
Please answer this question now What drives us to undertake a mission In which two sentences do the words in parenthesis represent prepositional phrases? -(The man in the house) seemed to be asleep. -The soldiers crept cautiously (through the tunnel.) -(Having been washed,) Jim's dog seemed a little smaller than before. -(Their faces brightening), they thanked us for our offer. -I was informed that the bus would arrive (in 45 minutes.) By 2015, at least 130 prisons were being operated by private companies. Multiply. (2x - 3)(x + 4) a 2x + 11x - 12 b 2x + 5x - 12 c 2x + 11x - 7 d 2x + 3x - 7 f(x)=x^2 what is g(x)? pls help me Soame Jenyns pointed out that many British subjects paid taxes directly to the British government, but were still unable to vote.Which of the following combinations does this represent? John Lewis: Together, You Can Redeem the Soulof Our NationWhat event from the text do you think is the most important in developing a main idea of the text? Support youranswer with details from the text The keys to the success of the Mongolian military in the 1200s includedThe keys to the success of the Mongolian military in the 1200s included Emergency Operations Centers are part of the standard, national framework for incident management. This is described in A. the Command and Coordination component of the National Incident Management System (NIMS). B. the Resource Management component of the National Incident Management System (NIMS). C. the Operational Period Planning Cycle and Incident Action Plan for each individual incident. D. the Communications and Information Management component of the National Incident Management System (NIMS). 4If Randy flips a coin 3 times, what is the probability that it will come up heads 3 times? Find the slope of ABA (-3, 12), B (-11, -16) Use the diagram below to answer the questions.Which are shown on the diagram? Check all that apply.JLKMJKPKLJKMJ Find the common ratio of the geometric sequence: 3,4,16/3,...A.1B.3/4C.4/3D.-1 How many pencils are in a bundle of 10 What is the balanced equation for the reaction of aqueous cesium sulfate and aqueous barium perchlorate? how many quarts are there in 12 gallons and 3 quarts? enter the number only. Do not include units Lew's has 500 bonds outstanding with a price quote of 98.6. There are also 12,000 shares of common stock selling for $47 a share and 5,000 shares of preferred stock at $70 a share. What is the weight of equity How did Dickinson view fame, based on her poems beginning with "Fame is a fickle food" and "I'm nobody"? The price of oil in the United States has been very volatile over the last 50 years, with the real price of oil showing a few dramatic swings. When did these swings occur, and what can explain them? The first dramatic swing happened in the 1970s when there was a sharp drop rise in the real price of oil caused by a large financial crisis the formation of OPEC increased demand from emerging economies . The second swing happened in the 2000s when there was a sharp rise drop in the real price of oil caused by increased demand from emerging economies a large financial crisis the formation of OPEC . The most recent swing happened in 2008 when there was a sharp rise drop in the real price of oil caused by