Describe five of these properties and provide an example of each: Hydrogen bonding, cohesion and adhesion, surface tension, heat of vaporization, specific heat, density, and universal solvent

Answers

Answer 1

Answer:

Explanation:

Hydrogen bond is an intermolecular force of attraction, it occur between a proton in a molecule and an electronegative atom in the another. It is weak bond and can be found in water molecule.

Cohesion is force of attraction thst occur when molecules are attracted to other molecules of the same type

this can be found in hydrogen bonding.

Adhesion occur when molecules are attracted to different substances. It can be founf in water when reaction with other substance

A universe solvent is a substance that is used to dissolves many substance. Example is water it can be used in dissolving many substance.

Surface tension is the ability of a liquid surfaces to reduce into the minimum surface area. It allows some insect that are less dense to float in water

Head of vapourization is the amount of heat required to change a liquid into a vapor. Heat to convert water into vapour

Answer 2

Answer:

pH

Explanation:

"The pH of a solution is a measure of the molar concentration of hydrogen ions in the solution and as such is a measure of the acidity or basicity of the solution. The letters pH stand for 'power of hydrogen' and numerical value for pH is just the negative of the power of 10 of the molar concentration of H+ ions."

hope this helps :)


Related Questions

Examine the statement. A scientific theory can become a scientific law, but a scientific law cannot become a scientific theory. If the statement is true, select “True.” If it is false, select the option that is true 1.) True 2.) A scientific theory can become a scientific law, and a scientific law can become a scientific theory. 3.) A scientific law can become a scientific theory, but a scientific theory cannot become a scientific law. 4.) A scientific theory cannot become a scientific law, and a scientific law cannot become a scientific theory.

Answers

Answer:

It's true.

Explanation:

In general, a scientific law is the description of an observed phenomenon. It doesn't explain why the phenomenon exists or what causes it. The explanation of a phenomenon is called a scientific theory. It is a misconception that theories turn into laws with enough research.

When the scientists test the idea, they develop a theory by following a set of logical steps. A theory becomes a scientific law once it has been rigorously examined and accepted. Thus, option A is correct.

What A scientific theory can become a scientific law?

One prevalent fallacy is the idea that hypotheses eventually become laws. Despite the number of supporting examples, hypotheses do not actually become laws after repeated testing.

Scientific laws, like theories, explain occurrences that the scientific community has determined to be verifiably true. In general, laws explain what will occur in a specific circumstance and are proven by a mathematical equation, whereas theories explain how the phenomenon occurs.

Therefore, A testable explanation of a natural event is what constitutes a scientific hypothesis. The concept of gravity, for instance, explains why an apple always falls to the ground when.

Learn more about scientific theory here:

https://brainly.com/question/2375277

#SPJ2

Which element is being cycled through Earth's system in the image shown
below?
Fossil fuels
Cellular
respiration
Photosynthesis
Animals
Plants
Industry and Home
Death and
decay
A. Oxygen
B. Nitrogen
c. Hydrogen
O D. Carbon

Answers

I took this quiz about 2 weeks ago but I forgot the answer. I think it was Carbon but you shouldn’t trust me till someone confirms it
carbon! hope this helps!!

Which of the following items was Darwin able to use to study the structures of
extinct organisms?
A. Fossils
O B. Species
O C. Amino acids
O D. Adaptations

Answers

Answer:

a

Explanation:

because that is all he had left of extinct animal's.

Answer:

A

Explanation:ithink not sure

What will happen if external factors affect cell division in a group of cells placed in a culture dish? A) Anchorage dependence will cause the cells to attach to each other after dividing. B) Anchorage dependence will prevent the cells from dividing until they attach to the dish. C) Density-dependent inhibition will cause the cells to divide until the dish is completely full. D) Density-dependent inhibition will destroy large cells to create room for new cells.

Answers

Answer:

C) density-dependent inhibition will cause the cells to divide until the dish is completely full

Explanation:

Just took the exam

On May 18, 1980, Mount St. Helens in Washington State experienced a huge volcanic eruption after a magnitude 5.1 earthquake. During the eruption, hot ash and pumice poured down the west, south, and east sides of the mountain, melting the snow and ice at the top of the volcano and producing volcanic mudflows. Which type of process first occurred in the ecosystem around Mount St. Helens after it erupted?
primary succession
secondary succession
a climax community
species extinction

Answers

Answer:

Primary succession

Explanation:

Primary succession is mostly cause by volcanic eruption

The first ecosystem to occur in the Mount St. Helens after eruption is the primary succession.

What is a primary succession?

The term primary succession refers to the organisms that first occur in an ecosystem after a major event such as the volcanic eruption has taken place.

In this case, the first ecosystem to occur in the Mount St. Helens after eruption is the primary succession.

Learn more about primary succession: https://brainly.com/question/26675203

What is conjunctivitis

Answers

Answer:

[tex] \underline{ \underline \orange{see \: below}}[/tex]

Explanation:

Conjunctivitis is an inflammation, infection of the conjunctiva. It is the most common ocular disease worldwide.It is characterized by a pink appearance because of subconjuctival blood vessels hemorrhage.

Simply, we can define it as :

Conjunctivitis ( pink eye ) is an inflammation or infection of the transparent membrane ( conjunctiva ) that lines your eyelid and covers the white part of your eyeball.

Pink eye is commonly caused by a bacterial or viral infection , an allergic reaction or in babies.

The most common pink eye symptoms include:

Redness in one or both eyesItchiness in one or both eyesA gritty feeling in one or both eyes

Hope I helped !

Best regards!

Cómo explicarías tu que el soporte vegetal es más importante que los animales en un ecosistema?

Answers

Answer:

Las plantas son productores primarios, mientras que los animales son consumidores

Explanation:

La cadena alimenticia está conformada por niveles tróficos donde la energía fluye desde los niveles basales representados por la base de la pirámide, hasta los niveles superiores (pico de la pirámide). De este modo, los organismos representan diferentes eslabones de acuerdo a su posición en la cadena alimenticia. En el primer nivel se encuentran los productores primarios como lo son, por ejemplo, las plantas y algas de ambientes terrestres y acuáticos, respectivamente, siguiendo por los consumidores primarios (por ejemplo, especies hervívoras), continuando sucesivamente por los consumidores secundarios, terciarios y cuaternarios (especies carnívoras), los cuales se encuentran en posiciones cada vez más altas de la pirámide. No obstante, es importante indicar que existen ocasiones donde los consumidores superiores (ya sea secundarios, terciarios y cuaternarios) se alimentan de especies situadas por debajo de diferentes niveles no consecutivos e incluso también de especies pertenecientes al mismo nivel trófico, con lo cual encajando en más de una categoría y dificultando su clasificación en la cadena.

Mr. B has been transferred to your floor to wait and see whether the chest tube allows his lungs to completely re-expand. But when he arrives, he is in severe respiratory distress. He says "I felt better before I came into the ER! Is this tube doing anything

Answers

The question is incomplete,below is the complete question.

Mr. B has been transferred to your floor to wait and see whether the chest tube allows his lungs to completely re-expand. But when he arrives, he is in severe respiratory distress. He says "I felt better before I came into the ER! Is this tube doing anything?"

You tell the Clinical Nurse Specialist (CNS). As the two of you move him into the bed, you notice that his chest tube bottle is lying on its side on the gurney, with air going into it. When you point this out to the CNS, she immediately grabs the bottle and sets it upright on the floor. You see air start bubbling through the fluid right away. "That was the problem!" she says. "They lost the water seal, and air was going into his chest from the bottle. You would not believe how many times that happens on transport." When you examine Mr. B, you have trouble detecting his lung sounds on the left. Even stranger, his apical heart sound is in the wrong place - it is over toward the right side of his chest. His respiration rate and heart rate are both increased, and he is struggling to breathe. "Let's give him a little oxygen. He'll be a lot better in a half-hour," says the CNS. "Check back on him."

QUESTION - Why would accumulation of air in his pleural space cause his heart sounds to be in the wrong place?

Accumulation of air in Mr B pleural space will cause his heart sound to be heard in the wrong place because the left side is his chest is being filled up with air making the organs in his chest to to be pushed over to the right side.

2. What happens in
terms of energy
when you hold a
craft stick and bend
it slightly?

Answers

Answer:

In a similar way a wooden tongue-depressor stick (like the kind used at the doctor's office) stores elastic potential energy when you bend it (though not if you break it). ... The elastic potential energy that was stored in the stick is transformed into movement, called kinetic energy.

Explanation:

The removal of waste products from the body is called

Answers

Answer:

It is called EXCRETION.

Explanation:

This is a process by which metabolic waste is removed from a living organism.

The excretory organs removes these waste.

Accumulation of these in the body is very harmful to our system.

Hope all these helps.

One reason cancer cells are easier to culture than normal cells extracted from an organism is that ________. Group of answer choices cancer cells grow in a more regulated fashion. cancer cells do not need to adhere to a substratum to grow. nutrient requirements for cancer cells are precisely defined. cancer cells are better models for demonstrating what happens in an intact organism.

Answers

Let's list the given options alphabetically to choose the appropriate answer.

One reason cancer cells are easier to culture than normal cells extracted from an organism is that ________. Group of answer choices

A. cancer cells grow in a more regulated fashion.

B. cancer cells do not need to adhere to a substratum to grow.

C. nutrient requirements for cancer cells are precisely defined.

D. cancer cells are better models for demonstrating what happens in an intact organism

Answer:

B.

Explanation:

Cancer cells are easier to culture in comparison to normal cells because cancer cells do not need to adhere to a substratum to grow.

As cancer cells are uncontrolled growth of cells and they do not require any substratum to grow and can easily grow to a culture while a normal cell require optimal conditions to grow in a culture.

Hence, the correct option is "B".

what does Ecology mean

Answers

The branch of biology that deals with the relations of organisms to one another and to their physical surrounding

Answer:

a branch of science concerned with the relationships between living things and their environment or the pattern of relationships between living things and their environment.

Explanation:

Which space exploration activity has most helped astronomers determine the age of the solar system?

collection of lunar rock samples

experiments performed on the International Space Station

placement of mirrors on the lunar surface

collection of deep space images by the Hubble telescope

Answers

The best answer about the space exploration activity that has helped astronomers determine the age of the solar system is :  Collection of Lunar rock samples ( option 1 )

There are several exploration activities in which astronomers partake when they visit the solar system and they include :

experiments on the space station, placement of mirrors on the lunar surface and the collection of space images

But to determine the age of the solar system, collection of rock samples is the best activity, because rocks (one of the first substances found in the solar system )  are as old as where they are found.

Hence the space exploration activity that has helped astronomers determine the age of the solar system is the collection of lunar rock samples

learn more : https://brainly.com/question/21668746

Answer:A

Explanation:Collection of lunar rock samples will help understand the moon more than the other options.

If Earth’s average surface temperature continues to change over the next 30 years at the same rate it changed between 1980 and 2010, the average temperature will most likely be around

Answers

Answer:

Its B....

Explanation:

Get that 100.

Why might an ecosystem be better able to
cope with a season of forest tent caterpillar
outbreak than an increase in acidic
precipitation?

Answers

Answer: It contains leach aluminium.

Explanation:The ecological effect of acid rain are most Clearly seen in aquatic environment such as, stream, lakes and marshe where it can be harmful to fish and other wildlifes.

what is the answer to 9k=27

Answers

Answer:

K=3

Explanation:

We divide both sides by 9 which is 9k/9=27/9 then cancel 9 by 9 and by 9 once by 9 thrice.

algae's general habitat?

Answers

Answer:

Algae is the process to describe that diverse group of photosynthetic lifeforms.

Explanation:

Algae is that environments process to the rivers and lakes to ponds waters an snow, algae living in the contain snow pigments that addition to the surrounding contain distinctive.

Algae is environment near inside water bodies, algae in many components in plants as stems and shoots or leaves nutrients water their body.

Algae like plants an special structure and algae is well defined body in the structure stems and leaves are photosynthetic organisms, algae are free living and symbolic relationship other organisms, there are many types of algae:- Green algae, blue and green algae ,red algae.

Green algae:- green algae to that conduct photosynthesis symbolic relation with higher organisms.

Blue and green algae:- this algae are include dams, river, lakes.

Red algae:- red algae is used in species found in freshwater ecosystem.

Algae is in unicellular and multicellular in environment nature.

While performing an experiment, it is important to:
a. change the control setup
b. test many different variables at the same time
c. reach a conclusion
d. record observations and measurements

Answers

Answer:

D

Explanation:

While performing an experiment, it is important to record observations and measurements, as in Option d. Option d is correct regarding the facts of the experiments, while the others are wrong.

What is an experiment?

The experiment is carried out to observe the hypothesis, and in this process, a control set-up is taken whose value or result is already known, and the variables are taken and compared with the control. The controls set should never change in the experiment because the variables are tested with reference to them, and the measurements and observations of the experiment should be taken into consideration to prove the hypothesis. All the variables should not be tested at once because if this is done, it would introduce error into the experiment, and not all the experiments are done to get the conclusion.

Hence, while performing an experiment, it is important to record observations and measurements, as in Option d.

Learn more about the experiment here.

https://brainly.com/question/11256472

#SPJ2

Evaluate this statement: Gene flow increases the genetic divergence of populations. Evaluate this statement: Gene flow increases the genetic divergence of populations. This statement is true. This statement is false. Gene flow is not able to influence the genetic divergence of populations. This statement is false. Gene flow reduces the divergence of populations. This statement is false. Gene flow increases the number of genes in populations.

Answers

The correct answer is C. This statement is false. Gene flow reduces the divergence of populations.

Explanation:

In biology and related areas, genetic divergence occurs if populations with a common ancestor develop unique traits, which are the result of genetic changes over time. On the other hand, gene flow occurs when traits including genes flow from one population to another, usually because the populations are in contact. In this context, gene flow reduces divergence because if genetic material flows between populations is less likely each population can develop unique traits, instead the populations involved will have similar traits after some time.

The correct answer is C. This statement is false. Gene flow reduces the divergence of populations.

The following information should be considered;

In terms of biology and related areas, genetic divergence arise at the time when the populations are with a common ancestor that created unique traits, due to this there are genetic changes over time. While gene flow arise at the time when traits involved genes flow from one population to another, normally due to the populations are in contact. In this given situaton, gene flow reduces divergence since genetic material flows between populations is less likely every population can create unique traits, rather the populations involved will have similar traits.

Learn more: https://brainly.com/question/5303391?referrer=searchResults

Los cuyes del pelo crespo, al ser cruzados con cuyes de pelo liso, producen solamente cuyes de pelo crespo, si se cruza uno de los cuyes de pelo crespo de F1 con el homocigoto recesivo. ¿Qué proporciones es posible esperar

Answers

Answer and Explanation:

Datos:

El alelo dominante del gen que codifica para el tipo de pelo, determina el pelo crespo. Llamemos P al alelo dominante. Genotipos que expresan pelo crespo: PP (Homocigota dominante) y Pp (Heterocigota)El alelo recesivo del gen que codifica para el tipo de pelo determina el pelo liso. p es el alelo recesivo.Genotipo homocigota recesivo, pp, expresa pelo liso.La cruza entre un cuy de pelo crespo y un cuy de pelo liso producen solo cuyes de pelo crespo. Esto implica que el parental con pelo crespo era homocigota dominante.

1º Cruza: un cuy de pelo crespo y un cuy de pelo liso

Parental)  PP    x    pp

Gametas) P   P      p   p

Cuadro de Punnet)      P          P

                             p     Pp       Pp

                             p     Pp       Pp

F1) 100 % de la progenie posee pelo crespo

     4/4 tienen genotipo heterocigoto.

2º Cruza: un cuy heterocigoto de la F1 y un cuy homocigoto recesivo

Parental)   Pp      x       pp

Gametas) P    p        p     p

Cuadro de Punnet)     P         p

                          p    Pp        pp

                          p    Pp        pp

F2)   50% de la progenie tiene pelo crespo

       50% de la progenie tiene pelo liso

       2/4=1/2 de la progenie es heterocigota

       2/4 = 1/2 de la progenie es homocigota recesiva.

Which label in the graphic represents the energy that is released from glucose by cellular respiration?
Oxygen
Glucose
Energy stored as ATP
Carbon dioxide and water

Answers

Answer:

C) Energy stored as ATP

Explanation:

100% on edge

how do i explain this?

Answers

Answer:

Oxygen debt is a physiological phenomenon in which a person consume oxygen at fater rate that it replaced by new oxygen molecules.

As shown in the graph, oxygen debt occurs just after the end of exercise because oxygen is consumed at faster rate during exercise that leads to  increased respiration and body attempts to replace the used oxygen.

To overcome the problem of oxygen debt, a person should take rest that allows the body to replenish its oxygen supply.

Only ------ percent of the food eaten is turned into its own body. ​

Answers

Answer:

10%

Explanation:

there is a the rule that only 10% of the energy is transferred from one trophic level to the other.

this means that only 10% of the food an organism eats  is passed onto the next organism. eg only 10% of the energy in a plant is transferred to a rabbit that eats the plant. After that if  a wolf eats the rabbit only 10% of the energy of food will pass on to the wolf.

name 3 physiological processes of cell membrane?{3mks} plz help me guys

Answers

Answer:

the cell membrane is an extremely pliable structure composed primarily of back -to- back phospholipids (a "bilayer")

The proximal convoluted tubule is A. lined with epithelial cells that lack microvilli. B. the site of glucose and amino acid reabsorption. C. permeable to water if ADH is present. D. impermeable to water. E. the site of water secretion.

Answers

Answer:

The correct answer is - option B.

Explanation:

The proximal convoluted tubule or PCT is the the part of nephron that lies in between of loop of Henle and bowman's capsule. The PCT is responsible for the most amount reabsorption of sodium, glucose, amino acids, water, potassium and chloride and reabsorbs around 65% to 100% of filtered substance.

Epithelial cells in the PCT reabsorb substances that have nutritional importance by the numerous microvilli on their surface.

Thus, the correct answer is - option B.

What has a greater influence on protein levels? A. Protein degradation has a greater influence because they are denatured faster than the cell can produce them B. mRNA destroyer concentration has a greater influence because it is destroying mRNA before proteins can even be produced C. mRNA destroyer concentration has a greater influence because mRNA is destroyed right after the proteins are produced D. Protein degradation has a greater influence because outside factors like antibiotics can cause it, and it is difficult to recover from

Answers

Answer: b

Explanation: i got the answer wrong and i’m looking at the results rn

Protein is being produced with the help of a process called translation in which mRNA gets translated to produce proteins. The translation is followed after the process of transcription of DNA to RNA.

The cause of the greater influence of protein levels has defined as follows:

The destruction of mRNA could greatly influence protein levels as mRNA is considered the source for proteins to get synthesized. This is because if mRNA gets destroyed, proteins would not have been produced at all. Thus, directly influences the levels of protein.

Thus, we can conclude that mRNA destroyer concentration has a greater influence because it is destroying mRNA before proteins can even be produced. Hence, option (b) is the correct answer.

Learn more about protein here:

https://brainly.com/question/22241855

Which type of chromosomal disorders seems to have the greatest affect on a person’s health—disorders involving autosomes or sex chromosomes? Why do you think this might be the case? thanks in advance

Answers

Answer:

Disorders involving sex chromosomes.

we can take Turner's syndrome n klinefelter's syndrome as examples.

Differentiate between endangered species and extinct species (1 point 2 examples)

Answers

Answer:

Endangered: Still around but at risk of going extinct (example: tiger)Extinct: Gone forever (example: wooly mammoth)

Explanation:

An endangered species is one with a reduced population. These species can easily become extinct if all the remaining members die.

I'm always happy to help :)

Please help!

A. I only

B. II only

C. III only

D. I and III only

Answers

Answer:

a

Explanation:

my reason is that the capacity carrying is 35

Answer:

[tex]\boxed{\mathrm{A. \: I \ only}}[/tex]

Explanation:

The graph does not mention any seasons. The graph is not growing geometrically. For about 9 months the population has been about 35.

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA
Other Questions
Hughey Co. as lessee records a capital lease of machinery on January 1, 2011. The seven annual lease payments of $350,000 are made at the end of each year. The present value of the lease payments at 10% is $1,704,000. Hughey uses the effective-interest method of amortization and sum-of-the-years'-digits depreciation (no residual value). Round to the nearest dollar. a) Prepare an amortization table for 2 011 and 2012. b) Prepare all of Hughey's journal entries for 2011. Hakim is making a mosaicfrom square tiles. The area heneeds to fill measures 150 mmby 180 mm. The tiles have sidelengths of 4, 6 or 8mm and aretoo small to cut. Which tilesshould Hakim use? How does Madame Loisel interact with Madame Forestier after seeing her for the first time in 10 years? The graphic below shows a protractor, which is used to measure angles. What is the level of accuracy of this measurement tool? its a projractor last week a worm was 10 millimeters long. This week it is 13 millimeters long. What is the percent of increase of the worm's length from last week to this week? sin theta upon 1 + cos theta + 1 + cos theta upon sin theta is equals to 2 cosec theta prove One of the world's most-recognizable franchisers is McDonald's. Advantages of franchising in global markets include: which of the following is typically most important to the adolescent when being examined You add 500 mL of water at 10C to 100 mL of water at 70C. What is themost likely final temperature of the mixture?O A. 80COB. 10-COC. 20CO D. 60C Read the excerpt from "Lather and Nothing Else." I went on lathering his face. My hands began to tremble again. The man could not be aware of this, which was lucky for me. But I wished he had not come in. Probably many of our men had seen him enter the shop. And with the enemy in my house I felt a certain responsibility. Which statements about the barber are correct Niko is 3 times as old as Lila. Niko's age is the same as adding Lila's age to the product of 3 and Amber's age. Niko is 45 years old. Kameron's age is equal to 2 times the sum of Amber's age and Lila's age. How old is Kameron? years old Boden is making a prize wheel for the school fair. The ratio of winning spaces to losing spaces is shown in the diagram. The table shows the number of winning and losing spaces that could be on the wheel. Based on the ratio, complete the missing values in the table. A homeowner purchases insulation for her attic rated at R-15. She wants the attic insulated to R-30. If the insulation she purchased is 10 cm thick, what thickness does she need to use When a criminal case is appealed, a panel of judges can reverse the case if:A. a witness has decided to change his testimony.B. there was a legal problem during the first trial.C. the defendant has hired a new attorney.D. the police have found convincing new evidence. The statement "Automobiles manufactured by this brand are the safest" is an example of the _____ component of attitude. Solve for a.ab+c=da= b + c/da = b/(c-d)a = (d - c)/b The law of conservation of momentum states that the total momentum of interacting objects does not _____. This means the total momentum _____a collision or explosion is equal to the total momentum _____ a collision or explosion. Please please please help Find the surface area of the pyramid.A.)311.4B.)230.4C.)212.6D.)200.4Please someone help I am struggling with this The length and width of a book cover are 22.2 centimeters and 12 centimeters respectively. The actual length (and width) can be 0.3 unit less than the measured length (and width) or 0.3 unit greater than the measured length (and width). a. Find the minimum and maximum possible lengths and widths of the book cover. b. Calculate the minimum and maximum possible areas of the book cover.