Discuss how the idea of vertical farming reflects the role of science in society.

Answers

Answer 1

Answer:

average global food prices have gone up by 2.6 percent annually in the past two decades. if that trend continues , not only does it threaten a baseline quality of life as more disposable income goes toward.

Answer 2

Vertical farming is the practice of growing local crops like fruits and vegetables with minimal resources by using high technological methods in a controlled environment.

Why vertical farming is important?

It has been said to be the future of agriculture in the UAE since they huge amount of goods and have to find ways to be self sustaining by boosting local production. Apart from being self sustaining, they also aim to provide safe and nutritious food.

The vertical garden is an agriculture concept for growing plants inside buildings or multi-story skyscrapers, often called farmscrapers, a term derived from the English skyscraper. In these buildings, which would function as large greenhouses, agriculture involves the use of technologies such as hydroponics to aid in plant growth. Some projects include the practice of livestock (especially poultry) on the lower floors.

Therefore, Vertical farming is the practice of growing local crops like fruits and vegetables with minimal resources by using high technological methods in a controlled environment.

Learn more about Vertical farming on:

brainly.com/question/2063033

#SPJ5


Related Questions

Ultra-high-temperature sterilization effectively reduces microbes that cause spoilage. removes only mesophilic microbes. reduces microbes that cause disease. removes all microbes that cause diseases or spoilage. reduces microbes that cause disease or spoilage.

Answers

Answer:

kills all microbes that cause disease or spoilage.

Explanation:

There are different methods of sterilization, such as ultraviolet radiation, autoclave mechanisms, etc.

The sterilization mechanisms eliminate the microorganisms completely, thus generating sterile surfaces.

These mechanisms are used with surgical instruments, the operating room environment.

The autoclave method is the most widely used today due to its economical price, its ease of use and its practicality.

Sterilization methods must be strictly controlled with pilot or test microbiological cultures to be able to corroborate that these mechanisms function correctly, since otherwise they could trigger strong pathologies due to cross contamination.

what does Ecology mean

Answers

The branch of biology that deals with the relations of organisms to one another and to their physical surrounding

Answer:

a branch of science concerned with the relationships between living things and their environment or the pattern of relationships between living things and their environment.

Explanation:

Why was the Nationalist Party more popular in China’s cities than in the countryside? Wealthy people who supported the party were concentrated in cities. People in the countryside were less active in politics than people in the city. Poor city dwellers hoped the Nationalist Party would bring economic change. The Nationalist Party threatened to end crop trade with Western nations.

Answers

Answer:

Wealthy people who supported the party were concentrated in cities.

Explanation:

Answer:

The answer is A on edge

Explanation:

SIOM CSserials
What has a greater influence on protein levels?
(1 point)
Protein degradation has a greater influence because outside factors like antibiotics can
cause it, and it is difficult to recover from.
O
Protein degradation has a greater influence because they are denatured faster than the cell
can produce them.
mRNA destroyer concentration has a greater influence because it is destroying mRNA before
proteins can even be produced.
mRNA destroyer concentration has a greater influence because mRNA is destroyed right
after the proteins are produced.

Answers

Answer:

mRNA destroyer concentration has a greater influence because it is destroying mRNA before  proteins can even be produced.

Explanation:

Proteins are synthesized from mRNA through the process of translation. mRNAs are first synthesized from a coding DNA template through the process of transcription. Hence, if mRNAs are destroyed, it means proteins will not be synthesized at all.

Protein not being synthesized at all means that mRNA destroyer concentration has a greater influence on protein levels than protein degradation. With protein degradation, not all the protein is degraded at once and some quantity of the protein can still be found, but with mRNA destroyer concentration, no protein can be found at all because it was not synthesized in the first place.

The image shows groundwater zones. Top to bottom: Porous rock or soil, Water, Impermeable rock. Zone 1 is at the top of porous rock. Zone 2 is between porous rock and water. Zone 3 is in the Water. Zone 4 is between the Water and Impermeable rock. Which is the saturated zone?

Answers

Answer:

zone 3

Explanation:

Answer:

C

Explanation:

What is another name of molecular biology????

Answers

Answer:

biotechnology

Explanation:

hope it help you

Answer:

biotechnology biotech

biological engineering biological science

The hypothalamic hormone that triggers the secretion of FSH and LH from the anterior pituitary is

Answers

Answer:

Hypothalamic-Pituitary-Gonadal Axis

GnRH produced by the hypothalamus stimulates the production of both LH and FSH. FSH functions by stimulating ovarian follicular development in females and regulating spermatogenesis in males. LH induces ovulation and corpus luteum formation in the ovaries.

plz give brainlist

hope this helped

Why is environmental science important?

Answers

Explanation:

it is where we live and share resources with order species

I hope this was helpful

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

Which is most likely a source of air pollution? littering CFCs oil spill runoff

Answers

Answer: CFCs

Explanation: The other options aren’t as relevant to air pollution.

Answer:

cfcs

Explanation:

what are the different types of waste? and what are the methods used in biodegrable waste managment​

Answers

2 ypes of waste liquid and solid

Explanation:

biodegradable waste can be found in municipal soild waste or sometimes called biodegradable municipal waste ,or as green waste ,food waste,paper waste and biodegradable plastic.other biodegradable waste include human waste ,manure,sewage,sewage sludge and slaughterhouse waste .

you can send it for recycling into compost.

you can treat biodegradable waste on an industrial scale by either composting or anaerobic digestion.

composting is more suitable for fibrous materials.

anaerobic digestion is more suitable for wastes and sludgest that degrade easily.

Question What was the ratio of tall to short plants in the F2 generation of Mendel's experiments? A. 3:1 B. 2:1 O C. 1:1 D. 6:1 ​

Answers

Answer:

A

Explanation:

Answer: 3:1

Explanation:

i got it right on the test

What percentage of the Earth's surface do forests cover? 20% 30% 40% 10%

Answers

30% of the earth's surface is covered by forests.

----------------------------------------------------------------------------------------

Only ------ percent of the food eaten is turned into its own body. *



20%

12%

10%

40%​

Answers

Answer:

12% I think this is right answer v

guy plz chat with me

Answer:

the answer is 10%

Explanation:

the 10% rule states that only 10% of energy is passed from one trophic level to the other (organism to organism)

Consider the following chromosomes and if they are affected by hemophilia. X - unaffected X chromosome, x = X affected by hemophilia, and Y = Y chromosome. If an Xx female and XY male have children, what fraction of their offspring will have an affected chromosome, and what fraction is likely to be affected by the hemophilia? (1 point) A. 1/4 and 1/2 B. 1/2 and 1/4 C. 1/2 and 1/3 D. 1/4 and 1/4 Ive been stuck on this for a while now, can someone please assist?

Answers

Answer:

B. 1/2 and 1/4

Explanation:

Hemophilia is a disease inherited in humans. It is only carried on the X chromosome, hence, it is said to be X-linked. In this question;

X - unaffected X chromosome

x = X chromosome affected by hemophilia,

Y = Y chromosome

Hence, in a cross between a Xx female (carrier) and a XY male (unaffected), the following chromosomes will be present in the gametes produced by each parent:

Xx- X and x gametes

XY- X and Y gametes

Using these gametes in a punnet square (see attached image), offsprings with genotypes: XX, Xx, XY and xY are produced.

XX (1) - unaffected normal female

Xx (1) - unaffected carrier female

XY (1) - unaffected normal male

xY (1) - affected male

Based on the questions;

- 2 out of the possible 4 children have the affected chromosomes i.e. both xY son and Xx daughter have the x chromosome. Hence, the fraction is 1/2

- 1 out of the 4 possible children is affected by hemophilia, which is the xY son. Hence, the fraction is 1/4.

Answer:

1/2 and 1/4

Explanation:

Took the test

what action is a reflex action

Answers

Answer:

A reflex action is an involuntary , quick  response to a stimulus, which minimises any damage to the body from potentially harmful conditions, such as touching something hot.

Explanation:

Muscle cell are richer in lysosomes , as they require lot of energy. correct and rewrite the following statement.

Answers

Answer:

See below

Explanation:

The correct statement is:

=> Muscle cells are richer in mitochondria, as they required lots of energy.

Mitochondrion acts as power house of the cell providing the cell with the required energy.

Correct Statement:-

Muscle cells are richer in Mitochondria, as they require a lot of energy.

[tex] \large{ \underline{ \boxed{ \pink{ \rm{Explanation}}}}}[/tex]

Especially in Skeletal muscles, Mitochondria and glycogen granules are found in abundance. Our limbs that includes our arms and legs shows movement which needs energy. The food is oxidized and energy is released.

More to know:-Mitochondria is popularly known as Power house of the cell or ATP generation site.It is a double-membranous structure with outer membrane smooth and inner membrane surrounds the matrix.The inner membrane have cristae which increase surface area.The cristae bear Oxysomes or F0-F1 particles.Mitocondria is semi-autonomous, it have it's own DNA and ribosomes.

━━━━━━━━━━━━━━━━━━━━

How are the proteins inside your body affected by the presence of water and other molecules?

Answers

Answer:

Our body is constitute of several essential molecules such as proteins, fat, carbohydrate, water, and other molecules.

Each molecule has some of the impact of other molecules in the body. Impact of water and other molecules on proteins inside the body are as follows:

Proteins have ligand-binding site and water provide stability to the ligand-binding site of proteins through its hydrogen bonds.Conformational flexibility and transitions of proteins are due to the presence of water molecules in it.Disbalance in the pH of body due to changing concentration of sodium-potassium ions can denature the protein. Enzymes present in the body can control the rate of formation of proteins in the body.

Consider this animal cell. The organelles in an animal cell are labeled. Part E represents small dots on the nucleolus. What is the function of the small, dark organelles labeled E? They contain enzymes for the digestion of old cell parts. They regulate what enters and leaves the cell. They produce proteins for the cell. They store water and other materials.

Answers

The dark organelles labelled E is called the Ribosomes.    

The answer is Ribosomes

Metals are useful in industry because they can be shaped without breaking. What is this property of metals called?

Answers

Answer:

malleable ................

Answer:

versatility ductility conductivity malleability

How much time is required for a P-wave to travel 6,000 kilometers?

Answers

Answer:

294.1 minutes

Explanation:

5,882 seconds (98 minutes) to travel 2,000 km.

2,000 x 3 = 6,000

5,882 seconds x 3 = 17,646

(294.1 minutes) to travel 6,000 km

I have four brothers
"This is what type of
observation?

Answers

Quantatative data since it is physically counting


which of the following is not irrational number?
(1)√2
(2)2/√6
(3)√36/1296
(4)-√6+6

Answers

Explanation:

hi !!

here i think all areirrational expect root 36/1296,

1. root 2= root 2= 1.414213562

2. 2/root 6= root 6 /3 = 0.8164965809

3. root 36/1296=1/6=1.66666667

4. - root 6+6= -2 root 3 = -3.464101615

so, they are extended and dont have exact value so all are irrational expect no. 3 because it can be expressed in 1/6 fraction form but others will come on root form.

Hope it helps...

Answer:

[tex]\frac{\sqrt{36} }{1296}[/tex]

Explanation:

[tex]\sf A \ rational \ number \ can \ be \ expressed \ as \ a \ quotient \ of \ two \ whole \ integers.[/tex]

[tex]\sqrt{2} = 1.41421356237...[/tex]

[tex]\frac{2}{\sqrt{6} } = 0.816497...[/tex]

[tex]\frac{\sqrt{36} }{1296} =\frac{6}{1296} =\frac{1}{216}[/tex]

[tex]-\sqrt{6} +6= 3.55051...[/tex]

[tex]\sf The \ rational \ number \ from \ the \ list \ is \ \frac{\sqrt{36} }{1296}[/tex]

Write TRUE or FALSE
(a)
A 'system' is the part of an organism that carries out a certain function.​

Answers

Answer:

TRUE

Explanation:

what type of cash crops have been genetically modified..... please help!!!!!

Answers

Answer:

Most food modifications have primarily focused on cash crops in high demand by farmers such as soybean, corn, canola, and cotton. Genetically modified crops have been engineered for resistance to pathogens and herbicides and for better nutrient profiles.

Explanation:

How are the molecules in photosynthesis and cellular respiration similar? Please include descriptions of the molecules

Answers

Answer:

They are similar because they both produce energy but in two different forms.

Photosynthesis- It produces oxygen and G3P, simple carbohydrate molecules that are high in energy and can be converted into glucose, sucrose, or other sugar molecules.

cellular respiration-During cellular respiration, a glucose molecule is gradually broken down into carbon dioxide and water.

They exhibit the same responses, but they do so in reverse. Carbon dioxide and water are converted during photosynthesis into glucose and oxygen. Carbon dioxide and water are produced during respiration in exchange for glucose and oxygen.

What similarity in photosynthesis and cellular respiration?

Energy transformations from one form to another are a part of both respiration and photosynthesis through a sequence of metabolic reactions.

The reactions that are carried out by both processes—which both use and produce ATP—are carried out on membranes and are managed by enzymes.

Light energy is converted by photosynthesis into chemical energy that is stored in glucose, which is then released by cellular respiration to create ATP, the life-sustaining compound.

Therefore, They are similar because they both produce energy, but in two different forms.

Learn more about cellular respiration here:

https://brainly.com/question/28532054

#SPJ2

Metamorphosis is:______.a. changing of one body form to another within a species, such as the change from an aquatic tadpole to a terrestrial frog. b. an intermediate condition, such as length of legs in mice between longer legs of some mice and shorter legs in others, a condition caused by Hox genes. c. the evolutionary transition from fishes to amphibians. d. the developmental changing of a scale to a feather.

Answers

Answer:

changing i think

Explanation:

what are sex hormones?why are they named so? state their function.

Answers

Answer:

Sex hormones or hormones of the reproductive organs are certain cells in the reproductive organs that produce hormones.

The testis produces testosterone,the male sex hormone,and the ovaries produces oestrogen and progesterone, the female sex hormones.

In a sexually mature male,testosterone influences sexual behaviour, and together with FSH,regulates sperm production in the seminiferous tubules of the testes.

Sexually matured females undergo a regular 4-week reproductive or menstrual cycle during which a mature egg is released.This cycle is regulated by oestrogen and progesterone. During pregnancy, progesterone inhibits egg production (ovulation),brings about the development of the placenta and prevents the uterus from contracting....I hope this answers your question... Thank you for the question.

steps of Biological method of study taking malaria as an examples

Answers

Explanation:

The different steps which are involved in biological method are the the invasion, the rapid division followed by the spread of infection. ... Malaria results in infection after the bite of the female anopheles mosquito. The parasites enter the bloodstream. as a result of this there is predominant infection.

a pupil performed an experiment in a school lab to show the action of a digestive enzyme on a food substance

a) Name and enzyme suitable for such an experiment
b) Name a food substance on which the enzyme that you have named will act
c) Describe any preparation of the food required before the experiment is performed. If no preparation is required state why?
d) give the temperature at which the enzyme-food mix should be maintained for the experiment to work
e) how much time is needed for digestion of food in this experiment?
f) describe a test to confirm that digestion has occurred ​

Answers

I prefer d as the correct answer!!!
Other Questions
Which property is shown by -6 + 0 = -6? A. Commutative Property of Addition B. Identity Property of Addition C. Distributive Property D. Associative Property of Addition What is 25x + 67y if x = 23 and y = 36. Give explanation please! Section #2 - Growth of the Aztecs Description of the growth of the Aztecs: (complete sentences) (Suggestions: Social classes, jobs, daily life) What are the skills areas covered on the nursing assistant competency evaluation test? Check all that apply.diagnostic care skillsphysical care skillspsychosocial care skillstherapeutic care skills Two 1.0 nF capacitors are connected in series to a 1.5 V battery. Calculate the total energy stored by the capacitors. can you please help ? 6x - 10 = 4(x + 3) x = ? x = 9 x = 10 x = 11 x = 12 Becker Industries is considering an all equity capital structure against one with both debt and equity. The all equity capital structure would consist of 30,000 shares of stock. The debt and equity option would consist of 15,000 shares of stock plus $255,000 of debt with an interest rate of 8 percent. What is the break-even level of earnings before interest and taxes between these two options Matter must have two physical properties 1. Have mass, and 2 Must move Use energy Take up space Be measureable The range of values for x? Discuss three major factors that contribute to an employee's decision to join a union. Discuss the five reasons that have contributed to the trend of decline in unionization g Both Fred and Ed have a bag of candy containing a lemon drop, a cherry drop, and a lollipop. Each takes out a piece and eats it. What are the possible pairs of candies eaten? A. Lemon-lemon, cherry-lemon, lollipop-lollipop, lemon-cherry, cherry-cherry, lemon-lollipop, lollipop-cherry, cherry-lollipop, lollipop-lemon B. Cherry-lemon, lemon-lollipop, lollipop-cherry, lollipop-lollipop, lemon-lemon C. Lemon-cherry, lemon-cherry, lemon-cherry, lemon-lollipop, lemon-lollipop, lemon-lollipop, cherry-lollipop, cherry-lollipop, cherry-lollipop D. Lemon-lemon, cherry-lemon, lollipop-lollipop, lemon-lollipop, cherry-cherry, lemon-lollipop, lollipop-cherry, cherry-lemon, lollipop-lemon A 25-year old single client has just started his own small business and is not covered by a retirement plan. He has $5,000 to invest and currently has a low level of income. He wishes to start saving for retirement. The BEST recommendation is a: Answer it answer it answer it. (MC)Read this story and then answer the question that follows:Sarah saw them again. Out of the corner of her eye she could see the kids ganging up on the new girl, Lara. She was late to her band practice and only had a few minutes to get there. "I barelykrow her stemmered to herset as she waked qulody to the car. "I'm sure she can take care of herself." Sarah knew this was an important rehearsal and could not miss it. "Hurry up,shouted her to from the one's seat. Sarah threw her guitar in the back seat and slammed the door. "Let's go," she said. As they rounded the comer and stopped at the stop sign-her heartmong-Sarah locked at the mom "Mom, Lara needs our help. Let's go back." which of the following is an example of theme in this story Why did Ted Johnson write paragraph 3 in the letter? A. to demonstrate that it is the property manager's responsibility to build a dog park B. to explain that dogs are happier when they get to play with other dogs C. to assure the property manager that the dog park would not be too expensive D. to explain that a dog park would benefit the health of the dogs in the property Ohno Company specializes in manufacturing a unique model of bicycle helmet. The model is well accepted by consumers, and the company has enough orders to keep the factory production at 10,000 helmets per month (80% of its full capacity). Ohnos monthly manufacturing cost and other expense data are as follows. Rent on factory equipment $11,600 Insurance on factory building 2,500 Raw materials (plastics, polystyrene, etc.) 79,700 Utility costs for factory 900 Supplies for general office 300 Wages for assembly line workers 63,700 Depreciation on office equipment 800 Miscellaneous materials (glue, thread, etc.) 1,200 Factory managers salary 6,400 Property taxes on factory building 500 Advertising for helmets 14,500 Sales commissions 10,600 Depreciation on factory building 1,600Required:Prepare an answer sheet with the following column headings:Cost Item Direct Materials Direct Labor Manufacturing Overhead Period Costs Shortly after receiving a traffic ticket for speeding, Fred made numerous comments about the road signs being inadequate and is GPS telling him a different speed limit. This would be an example of: Manuel made at least one error as he found the value of this expression. Identify the step in which Manuel made his first error. After identifying the step with the first error, explain the corrected steps and find the final answer. What is hand sanitizer