does anyone know a free app that i can watch shows on? what show u may ask it called the 100​

Answers

Answer 1
Answer:

You can download Tubi or Pluto tv they have shows and movies as well

Explanation:

Related Questions

Suppose Americans working in the textile industry decide to boycott goods made in the European Union. Explain how this boycott will affect each of the following: The supply of dollars The international value of the dollar

Answers

Answer: See explanation

Explanation:

The supply of dollars: The boycott by the Americans would result in the reduction in the supply of dollars on the international market. This is due to the fact that there will be less dollar going to the European Union.

The international value of the dollar: There'll be a depreciation in the value of the dollar. A reduction in demand would lead to decline in it's value.

A company had net income of $40,000, net sales of $300,000, and average total assets of $200,000. Its profit margin and total asset turnover were respectively:
Select one:
a. 13.3%; 0.2.
b. 13.3%; 1.5.
c. 2.0%; 1.5.
d. 1.5%; 0.2.
e. 1.5%; 13.3.

Answers

Answer:

a. 13.3%; 0.2.

Explanation:

Profit margin can be expressed as a ratio or a percentage. It is also called the gross profit ratio

The formula for gross margin

= net income/ net sales x 100

= $40,000/ $300,000 x 100

=13.33%

The formula for calculating asset turnover ratio is net sales divide by

average total assets.

=Net sales/ average total sales

=$40,000/$200,000

=0.2

On July 1, 2016, Killearn Company acquired 110,000 of the outstanding shares of Shaun Company for $14 per share. This acquisition gave Killearn a 25 percent ownership of Shaun and allowed Killearn to significantly influence the investee's decisions. As of July 1, 2016, the investee had assets with a book value of $5 million and liabilities of $620,000. At the time, Shaun held equipment appraised at $308,000 above book value; it was considered to have a seven-year remaining life with no salvage value. Shaun also held a copyright with a five-year remaining life on its books that was undervalued by $1,208,000. Any remaining excess cost was attributable to goodwill. Depreciation and amortization are computed using the straight-line method. Killearn applies the equity method for its investment in Shaun. Shaun's policy is to declare and pay a $1 per share cash dividend every April 1 and October 1. Shaun's income, earned evenly throughout each year, was $591,000 in 2016, $634,400 in 2017, and $682,400 in 2018. In addition, Killearn sold inventory costing $98,400 to Shaun for $164,000 during 2017. Shaun resold $117,000 of this inventory during 2017 and the remaining $47,000 during 2018. Determine the equity income to be recognized by Killearn during each of these years. Compute Killearn's investment in Shaun Company's balance as of December 31, 2018.

Answers

Answer:

A. 2017 $61,400

2018 $49,400

B. $1,650,800

Explanation:

A. Calculation to Determine the equity income to be recognized by Killearn during each of these years.

2017 EQUITY INCOME

Equity Income =(25%*$634,400)-($ 1 per share April 1 Cash dividend+$ 1 per share October 1 Cash dividend*$110,000)

Equity Income =$158,600-($2per share*110,000)

Equity Income =$158,600-$220,000

Equity Income =$61,400

2018 EQUITY INCOME

Equity Income =(25%*$682,400)-($ 1 per share April 1 cash dividend+$ 1 per share October 1 cash dividend*$110,000)

Equity Income =$170,600-($2per share*110,000)

Equity Income =$170,600-$220,000

Equity Income =$49,400

Therefore the equity income to be recognized by Killearn during 2017 is $61,400 and 2018 is $49,400 .

b. Computation for Killearn's investment in Shaun Company's balance as of December 31, 2018

Original Investment at Cost $1,540,000

( 110,000*14per share)

Add 2017 Profit shared (Net of Dividend) $61,400

Add 2018 Profit shares (Net of Dividend) $ 49,400

2018 Investment Value $1,650,800

($1,540,000+$61,400+$ 49,400)

Therefore Killearn's investment in Shaun Company's balance as of December 31, 2018 will be $1,650,800

When is a manufacturer most likely to RAISE the price of a product?
when demand for the product increases
when a competitor makes a better product
ОООО
C
when a cheap substitute for the product appears in stores
when the cost of raw materials declines

Answers

Answer:

Its (A) When demand for the product increases

Explanation: I just tooke the Economics Exam.

the area of a rectangle is 600 cm2 and its breadth is two-third of its length find the length and breadth of the rectangle​

Answers

Given:

Area of a rectangle is [tex]600 \text{cm}^2[/tex].

Breadth is two-third of its length.

To find:

The length and breadth of the rectangle​ .

Solution:

Let x cm be the length of the rectangle.

Then, Breadth or width of the rectangle = [tex]\dfrac{2}{3}x[/tex] cm

Area of a rectangle is

[tex]Area=Length \times Breadth[/tex]

[tex]600=x \times \dfrac{2}{3}x[/tex]

[tex]600=\dfrac{2}{3}x^2[/tex]

Multiply both sides by 3.

[tex]1800=2x^2[/tex]

Divide both sides by 2.

[tex]900=x^2[/tex]

Taking square root on both sides.

[tex]\pm \sqrt{900}=x[/tex]

[tex]\pm 30=x[/tex]

Length cannot be negative. So, x=30.

Now,

Length = [tex]30\text{ cm}[/tex]

Breadth = [tex]\dfrac{2}{3}\times 30\text{ cm}[/tex]

             = [tex]2\times 10\text{ cm}[/tex]

             = [tex]20\text{ cm}[/tex]

Therefore, the length of the rectangle is 30 cm and the breadth is 20 cm.

Select the correct answer.
if you are friendly, outgoing, and love to travel, you might consider a career in what cluster?
A Arts and communication
B. Logistics and transportation
C Hospitality and tourism
D. Agriculture

Answers

B is the answer because logistics has to do with alot of transporting
C. Hospitable and outgoing travel. I think it works

RWJ inc., produces the different medical devices. the following relates to the three products for next year. under an activity-based costing system, the per-unit overhead cost of device z is closest to

Answers

Answer:

Exing relates to the three products for next yeaplaRWJ inc., produces the different medical devices. the following relates to the three products for next year.nation:

2008 crisis question.

Answers

Answer:

The correct answer is D.

Explanation:

The Great Recession was an almost global recession that began around 2007 and peaked in 2009. The recession was triggered by various factors, in particular the bursting of a property price bubble in the USA and the associated financial crisis from 2007 and the banking crisis, which was later followed by sovereign debt crises such as the Greek sovereign debt crisis. In addition, there were hunger crises in poor countries.  At the start of the crisis there were several negative announcements about the mortgage system of the United States of America; the crisis stemmed from what became known as 'toxic lending', the greed of companies to make a profit and to give mortgages to people who could not afford to pay it back. This housing crisis, known as the Subprime mortgage crisis, spread worldwide.

Other Questions
The table represents a function.What is f(-2)?0 -3-6-2f(x)314-2O-1O 1O 3 The 12 students in the Environmental Club represent 20% of the students in the seventh grade. How many students are in the seventh grade? In 1965 King and his wife, Coretta Scott King, led demonstrators on ahistoric 54-mile march that took five days, from where to where? HELPPPPPPPPPPPPPPP!!!!!!!!!!! BRAINLIEST IS ON THE LINE!!!!!!!!!!!!!!!!!Write a summary for Macbeth Act 1 Scene 2. What is the answer to question 7, NH4C2H3O2 what country has not experienced balkanization? Match the expression with an equivalent expression 6( n + 4 ) = 3(2(8-2x4)+25divided by 5 )-(2(8 divided by 4x2)-7(7-2x3) can you please help me:) write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC RIP grandsonhow does earths crust change earths surface y32c-4-3 -2 -1-1+1 2 3 4-2+-3+-4+41What is the slope of the line? hi...need help....thank you.. A restaurant customer left $1.35 as a tip...Plz help me Need answers for #3 please hep Identify the number of solutions for the equation below: What is (-3,4) (5,-2) in slope intercept form? How did the use of paper help contribute to the spread of Islam? The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.What is the best use of an atomic model to explain the charge of the particles in Thomsons beams?An atoms negative particles are surrounded by positive matter, so the positive particles are easier to remove.An atoms positive particles are surrounded by negative matter, so the negative particles are easier to remove.An atoms smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.An atoms larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove. PLS HURRY!!Can you tell how many different notes are played at a particular time (chords)? for manic by conan gray